Orientational interactions in low-concentration DNA solutions

The rotational relaxation tiem τ₃ of DNA molecules (M_w ? 5 × 10⁶) in solution has been determined by the transient electric birefringence method. The analysis of the birefringence decay makes it possible to study only the higher-molecular-weight fraction, the molecules being considered as rigid elongated particles in a short time scale. A marked concentration dependence of the relaxation time has been observed for DNA in low ionic strengths. Above a critical concentration c*, τ₃ increases with the DNA concentration, c. The value of c* increases with the ionic strength. For 10^?3 ionic strength (with NaCl), c* is about 10 μg/mL; then we observe the same strong concentration dependence of rotational relaxation times as recently reported for rodlike M-13 viruses [Maguire, J. F., McTague, J. P. & Rondelez, F. (1980) Phys. Rev. Lett. 45 , 1891–1894]. These results may be discussed in terms of the Doi-Edwards theory for rotational relaxation time of rigid macromolecules [Doi, M. (1975) J. Phys. 36 , 607–611; Doi, M. & Edwards, S. F. (1978) J. Chem. Soc. Faraday Trans. 74 , 918–932] and the critical concentration above which the interactions between the molecules begin to appear allows determining the corresponding molecular length. We observe a very good agreement between the DNA lengths obtained from the c* values and by using the infinite dilution value of τ₃ and Broersma's equation. Therefore, only highly diluted solutions can be used if intrinsic molecular properties based on the rotational diffusion of high-molecular-weight elongated molecules are studied.     

Biophysical characterization of DNA and RNA aptamer interactions with hen egg lysozyme

This work characterized the binding of an RNA aptamer recognizing hen egg white lysozyme, as well as a literature-reported single-stranded DNA analog of sequence identical to the original RNA aptamer, using fluorescence anisotropy, isothermal titration calorimetry (ITC) and analytical ultracentrifugation. The polyanionic DNA aptamer analog is selective for lysozyme even over cationic cytochrome c and has been reported to be successfully used in biosensing applications. The association however, is predominantly of electrostatic character, strongly salt-sensitive and entropically-driven, in contrast to previously described enthalpically-driven antibody-lysozyme and DNA aptamer-VEGF interactions. With a moderate selectivity for their target, high salt-sensitivity along with fast association and dissociation behavior, these molecules might serve as pseudo-affinity ligands for biomolecular separations.     

Recognition imaging with a DNA aptamer

We have used a DNA-aptamer tethered to an atomic force microscope probe to carry out recognition imaging of IgE molecules attached to a mica substrate. The recognition was efficient (approximately 90%) and specific, being blocked by injection of IgE molecules in solution, and not being interfered with by high concentrations of a second protein. The signal/noise ratio of the recognition signal was better than that obtained with antibodies, despite the fact that the average force required to break the aptamer-protein bonds was somewhat smaller.     

Energetic basis of molecular recognition in a DNA aptamer

The thermal stability and ligand binding properties of the L-argininamide-binding DNA aptamer (5'-GATCGAAACGTAGCGCCTTCGATC-3') were studied by spectroscopic and calorimetric methods. Differential calorimetric studies showed that the uncomplexed aptamer melted in a two-state reaction with a melting temperature T(m)=50.2+/-0.2 degrees C and a folding enthalpy DeltaH(0)(fold)=-49.0+/-2.1 kcal mol(-1). These values agree with values of T(m)=49.6 degrees C and DeltaH(0)(fold)=-51.2 kcal mol(-1) predicted for a simple hairpin structure. Melting of the uncomplexed aptamer was dependent upon salt concentration, but independent of strand concentration. The T(m) of aptamer melting was found to increase as L-argininamide concentrations increased. Analysis of circular dichroism titration data using a single-site binding model resulted in the determination of a binding free energy DeltaG(0)(bind)=-5.1 kcal mol(-1). Isothermal titration calorimetry studies revealed an exothermic binding reaction with DeltaH(0)(bind)=-8.7 kcal mol(-1). Combination of enthalpy and free energy produce an unfavorable entropy of -TDeltaS(0)=+3.6 kcal mol(-1). A molar heat capacity change of -116 cal mol(-1) K(-1) was determined from calorimetric measurements at four temperatures over the range of 15-40 degrees C. Molecular dynamics simulations were used to explore the structures of the unligated and ligated aptamer structures. From the calculated changes in solvent accessible surface areas of these structures a molar heat capacity change of -125 cal mol(-1) K(-1) was calculated, a value in excellent agreement with the experimental value. The thermodynamic signature, along with the coupled CD spectral changes, suggest that the binding of L-argininamide to its DNA aptamer is an induced-fit process in which the binding of the ligand is thermodynamically coupled to a conformational ordering of the nucleic acid.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Effects of a modified dye-labeled nucleotide spacer arm on incorporation by thermophilic DNA polymerases

The ability of eight commercially available thermophilic DNA polymerases to sequentially incorporate fluorescently labeled nucleotides sequentially was analyzed by a gel based primer extension assay. Cy5-dUTP or a variant nucleotide in which the linker had been lengthened by 14 atoms between the dye and the nucleobase were compared. We found that the Cy5-dUTP with a longer linker resulted in longer primer extension lengths. Furthermore, some of the assayed polymerases are capable of extending the primer to the full or near full length of 30 nucleotides using dye-labeled nucleotides exclusively.     

High-throughput AFLP analysis using infrared dye-labeled primers and an automated DNA sequencer

Amplified fragment length polymorphism (AFLP) analysis is currently the most powerful and efficient technique for the generation of large numbers of anonymous DNA markers in plant and animal genomes. We have developed a protocol for high-throughput AFLP analysis that allows up to 70,000 polymorphic marker genotype determinations per week on a single automated DNA sequencer. This throughput is based on multiplexed PCR amplification of AFLP fragments using two different infrared dyelabeled primer combinations. The multiplexed AFLPs are resolved on a two-dye, model 4200 LI-COR automated DNA sequencer, and the digital images are scored using semi-automated scoring software specifically designed for complex AFLP banding patterns (AFLP-Quantar). Throughput is enhanced by using high-quality genomic DNA templates obtained by a 96-well DNA isolation procedure.     

Dynamics of an anti-VEGF DNA aptamer: a single-molecule study

Single-molecule fluorescence resonance energy transfer (SMFRET) was used to study the interaction of a 25-nucleotide (nt) DNA aptamer with its binding target, vascular endothelial growth factor (VEGF). Conformational dynamics of the aptamer were studied in the absence of VEGF in order to characterize fluctuations in the unbound nucleic acid. SMFRET efficiency distributions showed that, while the aptamer favors a base-paired conformation, there are frequent conversions to higher energy conformations. Conversions to higher energy structures were also demonstrated to be dependent on the concentration of Mg²⁺-counterion by an overall broadening of the SMFRET efficiency distribution at lower Mg²⁺ concentration. Introduction of VEGF caused a distinct increase in the frequency of lower SMFRET efficiencies, indicating that favorable interaction of the DNA aptamer with its VEGF target directs aptamer structure towards a more open conformation.     

External-loop free energy affects dye-labeled terminators premature terminations in DNA cycle-sequencing reactions

Although dideoxy terminators labeled with energy-transfer dyes (BigDyes) provide the most versatile method of automated DNA sequencing, premature terminations result in a substantially reduced reading length of the DNA sequence. I recently demonstrated that combining the annealing step with the extension step at a single temperature (60°C) reduces premature terminations of DNA sequences that ordinarily contain premature terminations when three temperature steps are used in sequencing. I studied a novel class of DNA sequences of 100-bp length and located upstream from the point that causes premature terminations. I determined the thermodynamics of 49 DNA sequences with premature terminations at three temperature steps by using DNA mfold profiles. Sequencing results for 28 samples were improved with two-step cycle sequencing, whereas two-step cycle-sequencing reactions did not improve the results for 21 sequences. Nearest-neighbor thermodynamic parameters for all 49 sequences were compared at temperatures 50°C and 60°C. The parameters predicted that thermodynamic free-base (external-loop) energies (δδG°) were significantly different for these two study groups of samples. The results indicate that changes in free energy in single-strand base (external-loop) sequences can have a significant effect in reducing premature terminations in DNA sequencing reactions run with energy-transfer-based fluorescent-dye terminators.     

Remyelination induced by a DNA aptamer in a mouse model of multiple sclerosis

Multiple sclerosis (MS) is a debilitating inflammatory disease of the central nervous system (CNS) characterized by local destruction of the insulating myelin surrounding neuronal axons. With more than 200 million MS patients worldwide, the absence of treatments that prevent progression or induce repair poses a major challenge. Anti-inflammatory therapies have met with limited success only in preventing relapses. Previous screening of human serum samples revealed natural IgM antibodies that bind oligodendrocytes and promote both cell signaling and remyelination of CNS lesions in an MS model involving chronic infection of susceptible mice by Theiler's encephalomyelitis virus and in the lysolecithin model of focal demyelination. This intriguing result raises the possibility that molecules with binding specificity for oligodendrocytes or myelin components may promote therapeutic remyelination in MS. Because of the size and complexity of IgM antibodies, it is of interest to identify smaller myelin-specific molecules with the ability to promote remyelination in vivo. Here we show that a 40-nucleotide single-stranded DNA aptamer selected for affinity to murine myelin shows this property. This aptamer binds multiple myelin components in vitro. Peritoneal injection of this aptamer results in distribution to CNS tissues and promotes remyelination of CNS lesions in mice infected by Theiler's virus. Interestingly, the selected DNA aptamer contains guanosine-rich sequences predicted to induce folding involving guanosine quartet structures. Relative to monoclonal antibodies, DNA aptamers are small, stable, and non-immunogenic, suggesting new possibilities for MS treatment.     

Synthesis and application of charge-modified dye-labeled dideoxynucleoside-5'-triphosphates to 'direct-load' DNA sequencing

A novel series of charge-modified, dye-labeled 2′,3′-dideoxynucleoside-triphosphate terminators were synthesized and evaluated as reagents for DNA sequencing. These terminators possess an advantage over existing reagents in that no purification is required to remove unreacted nucleotide or associated breakdown products prior to electrophoretic separation of the sequencing fragments. This obviates the need for a time consuming post-reaction work up, allowing direct loading of DNA sequencing reaction mixtures onto a slab gel. Thermo Sequenase™ II DNA polymerase poorly incorporates the charge-modified terminators compared with regular dye-labeled terminators. However, extending the linker arm between dye and nucleotide and using a mutant form of a related DNA polymerase can in part mitigate the decrease in substrate efficiency. We also present evidence that these charge-modified terminators can relieve gel compression artefacts when used with dGTP in sequencing reactions.     

Selection of a DNA aptamer that binds 8-OHdG using GMP-agarose

DNA aptamers, which bind specific molecule, such as 8-OHdG, with high affinity were investigated using an in vitro selection strategy called systematic evolution of ligands by exponential enrichment (SELEX). However, 8-OHdG was difficult to immobilize on a carrier for SELEX. Therefore, a DNA aptamer binding to 8-OHdG was selected using GMP-agarose as an analogue from a library of about 4⁶⁰ random ssDNA sources. As a result, three aptamer candidates were selected. Among the selected DNA aptamers, the No. 22 DNA aptamer exhibited a high affinity for 8-OHdG. The dissociation constant, K_D, of No. 22 DNA aptamer was on the order of 0.1 μmol/L. This result suggests that using an analogue will be a useful new SELEX method for obtaining various aptamers that are difficult to immobilize on a matrix.     

Orientational dynamics of T2 DNA during agarose gel electrophoresis: influence of gel concentration and electric field strength

The understanding, on a molecular level, of the mechanisms responsible for the improved separation in DNA gel electrophoresis when using modulated electric fields requires detailed information about conformational distribution and dynamics in the DNA/gel system. The orientational order due to electrophoretic migration ("electrophoretic orientation") is an interesting piece of information in this context that can be obtained through linear dichroism spectroscopy [M. Jonsson, B. Akerman, and B. Nordén, (1988) Biopolymers 27, 381-414]. The technique permits measurement of the orientation factor S of DNA (S = 1 corresponds to perfect orientation) within an electrophoretic zone in the gel during the electrophoresis. It is reported that the degree of orientation of T2 DNA [170 kilo base pairs (kpb)] is considerable (S = 0.17 in 1% agarose at 10 V/cm) compared to relatively modest orientations of short fragments found earlier (for 23-kbp DNA, S = 0.03 in 1% agarose at 10 V/cm), showing that large DNA coils are substantially deformed during the migration. Growth and relaxation dynamics of the orientational order of the T2 DNA are also reported, as functions of gel concentration (0.3-2%), electric field strength (0-40 V/cm), and pulse characteristics. The rise profile of the DNA orientation, when applying a constant field, is a nonmonotonic function that displays a pronounced overshoot, followed by a minor undershoot, before it reaches steady-state orientation (after 12 s in 1% agarose, 9 V/cm). The orientational relaxation in absence of field shows a multiexponential decay in a time region of some 10 s, when most of the DNA anisotropy has disappeared. A surprising phenomenon is a memory over minutes of the DNA/gel system to previous pulses: with two consecutive rectangular pulses (of the same polarity), the orientational overshoot and undershoot as a response to the second pulse are significantly reduced compared to the first pulse. The time required to recover 90% of their amplitudes is typically 1200 s (1% agarose, 9 V/cm), which may be compared to the time required to relax 90% of the DNA orientation, which is only 6 s. The major part of the over- and undershoot recovery is thus a reorganization of a system in which DNA is already randomly oriented. The different response amplitudes and relaxation times, including the amplitude and recovery time of the overshoot, of the orientational order of DNA in the electrophoretic gel have been studied as functions of gel concentration and field strength. The results are discussed against relevant theories of polymer dynamics.     

Molecular dynamics of spermine-DNA interactions: sequence specificity and DNA bending for a simple ligand.

We used molecular dynamics to model interactions between the physiologically important polyamine spermine and two B-DNA oligomers, the homopolymer (dG)10-(dC)10 and the heteropolymer (dGdC)5-(dGdC)5. Water and counterions were included in the simulation. Starting coordinates for spermine-DNA complexes were structures obtained by molecular mechanics modeling of spermine with the two oligomers; in these models, spermine binding induced a bend in the heteropolymer but not in the homopolymer. During approximately 40 psec of molecular dynamics simulation, spermine moves away from the floor of the major groove and interacts nospecifically with d(G)10-d(C)10. In contrast, a spermine-induced bend in the helix of (dGdC)5-(dGdC)5 is maintained throughout the simulation and spermine remains closely associated with the major groove. These results provide further evidence that the binding of spermine to nucleic acids can be sequence specific and that bending of alternating purine-pyrimidine sequences may be a physiologically important result of spermine binding.     

Molecular interactions and metal binding in the theophylline-binding core of an RNA aptamer

An RNA aptamer containing a 15-nt binding site shows high affinity and specificity for the bronchodilator theophylline. A variety of base modifications or 2' deoxyribose substitutions in binding-site residues were tested for theophyllinebinding affinity and the results were compared with the previously determined three-dimensional structure of the RNA-theophylline complex. The RNA-theophylline complex contains a U6-A28-U23 base triple, and disruption of this A28-U23 Hoogsteen-pair by a 7-deaza, 2'-deoxy A28 mutant reduces theophylline binding >45-fold at 25 degrees C. U24 is part of a U-turn in the core of the RNA, and disruption of this U-turn motif by a 2'-deoxy substitution of U24 also reduces theophylline binding by >90-fold. Several mutations outside the "conserved core" of the RNA aptamer showed reduced binding affinity, and these effects could be rationalized by comparison with the three-dimensional structure of the complex. Divalent ions are absolutely required for high-affinity theophylline binding. High-affinity binding was observed with 5 mM Mg2+, Mn2+, or Co2+ ions, whereas little or no significant binding was observed for other divalent or lanthanide ions. A metal-binding site in the core of the complex was revealed by paramagnetic Mn2+-induced broadening of specific RNA resonances in the NMR spectra. When caffeine is added to the aptamer in tenfold excess, the NMR spectra show no evidence for binding in the conserved core and instead the drug stacks on the terminal helix. The lack of interaction between caffeine and the theophylline-binding site emphasizes the extreme molecular discrimination of this RNA aptamer.