Accessibility of the 5 S RNA in yeast ribosomes

The accessibility of yeast 5 S RNA to modification by diethyl pyrocarbonate was compared in the free 5 S RNA molecule, 60 S subunits and whole ribosomes. All the reactive sites in the free RNA were eliminated or suppressed in ribosomes but two sites. A₅₁ and A₆₄, remained accessible and a slight reactivity was observed at four new sites (G₃₀, G₄₉, G₅₂ and A₇₂). Nucleotide sequences that have been implicated in initiator transfer RNA binding or subunit interactions are not accessible.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Number of tRNA binding sites on 80 S ribosomes and their subunits

The ability of rabbit liver ribosomes and their subunits to form complexes with different forms of tRNAPhe (aminoacyl-, peptidyl- and deacylated) was studied using the nitrocellulose membrane filtration technique. The 80 S ribosomes were shown to have two binding sites for aminoacyl- or peptidyl-tRNA and three binding sites for deacylated tRNA. The number of tRNA binding sites on 80 S ribosomes or 40 S subunits is constant at different Mg2+ concentrations (5-20 mM). Double reciprocal or Scatchard plot analysis indicates that the binding of Ac-Phe-tRNAPhe to the ribosomal sites is a cooperative process. The third site on the 80 S ribosome is formed by its 60 S subunit, which was shown to have one codon-independent binding site specific for deacylated tRNA.     

The effect of tRNA binding on the structure of 5 S RNA in Escherichia coli. A chemical modification study

The structure of 5 S RNA within the 70 S ribosome from Escherichia coli was studied using the chemical reagent kethoxal (alpha-keto-beta-ethoxybutyraldehyde) to modify accessible guanosines. The modification pattern of 5 S RNA from free 70 S ribosomes was compared with that of poly(U) programmed ribosomes where tRNA had been bound to both the A- and P-sites. Binding to the ribosomal A-site was achieved enzymatically using the elongation factor Tu and GTP in the presence of deacylated tRNA which blocks the ribosomal P-site. Modified guanosines were identified after partial RNase T1 hydrolysis and separation of the hydrolysis products on sequencing gels. Binding of tRNA to the ribosome leads to a strong protection of 5 S RNA guanosine G-41 and to some degree G-44 from kethoxal modification. The limited RNase T1 hydrolysis pattern provides evidence for the existence of a 5 S RNA conformation different from the known 5 S RNA A- and B-forms which are characterized by their gel electrophoretic mobility. The importance of 5 S RNA for the binding of tRNA to the ribosome is discussed.     

tRNA binding sites of ribosomes from Escherichia coli

70S tight-couple ribosomes from Escherichia coli were studied with respect to activity and number of tRNA binding sites. The nitrocellulose filtration and puromycin assays were used both in a direct manner and in the form of a competition binding assay, the latter allowing an unambiguous determination of the fraction of ribosomes being active in tRNA binding. It was found that, in the presence of poly(U), the active ribosomes bound two molecules of N-AcPhe-tRNAPhe, one in the P and the other in the A site, at Mg2+ concentrations between 6 and 20 mM. A third binding site in addition to P and A sites was observed for deacylated tRNAPhe. At Mg2+ concentrations of 10 mM and below, the occupancy of the additional site was very low. Dissociation of tRNA from this site was found to be rather fast, as compared to both P and A sites. These results suggest that the additional site during translocation functions as an exit site, to which deacylated tRNA is transiently bound before leaving the ribosome. Since tRNA binding to this site did not require the presence of poly(U), a function of exit site bound tRNA in the fixation of the mRNA appears unlikely. Both the affinity and stability of binding to the additional site were found lower for the heterologous tRNAPhe from yeast as compared to the homologous one. This difference possibly indicates some specificity of the E. coli ribosome for tRNAs from the same organism.     

Role of polyamines in the binding of initiator tRNA to the 70S ribosomes of extreme thermophilic bacterium Calderobacterium hydrogenophilum

Slowly cooled cells of an extreme thermophilic eubacterium Calderobacterium hydrogenophilum possess ribosomes with weakly associated subunits. These ribosomal subunits are capable of association to 70S ribosomes either at higher Mg²⁺ concentrations (30–40 mM) or at 4–10 mM Mg²⁺ and in the presence of polyamines. The contribution of 30S and 50S subunits to the hydrodynamic stability of ribosomes was examined by forming hybrid 30S–50S couples from C. hydrogenophilum and Escherichia coli. At lower Mg²⁺ (4–10 mM) heterogeneous subunits containing 30S E. coli and 50S C. hydrogenophilum and homogeneous subunits of the thermophilic bacterium associated only in the presence of polyamines. Ribosomal subunits associated at 30 mM Mg²⁺ lose thermal stability and activity concerning poly(AUG)-dependent binding of f[³H]Met-tRNA to the P-site on 70S ribosomes or translation of poly(UG). Poly(AUG), deacylated-tRNA or initiator-tRNA have no valuable effect on association of 30S and 50S subunits. Protein synthesis initiation factor IF3 of C. hydrogenophilum prevents association of ribosomal subunits to 70S ribosomes at physiological temperature (70°C). The factor also stimulates dissociation of 70S ribosomes of E. coli at 37°C. The codon-specific binding of f[³H]Met-tRNA to homogeneous 70S ribosomes of C. hydrogenophilum at 70°C is dependent on the presence of initiation factors and concentrations of tri-pentaamines. However, excess of polyamines inhibited the reaction. Our results indicate that tri-pentaamines enhance conformational stability of 70S initiation complex at elevated temperatures.     

The 5-S RNA binding protein from yeast (Saccharomyces cerevisiae) ribosomes. Evolution of the eukaryotic 5-S RNA binding protein.

The ribonucleoprotein complex between 5-S RNA and its binding protein (5-S RNA . protein complex) of yeast ribosomes was released from 60-S subunits with 25 mM EDTA and the protein component was purified by chromatography on DEAE-cellulose. This protein, designated YL3 (Mr = 36000 on dodecylsulfate gels), was relatively insoluble in neutral solutions (pH 4--9) and migrated as one of four acidic 60-S subunit proteins when analyzed by the Kaltschmidt and Wittman two-dimensional gel system. Amino acid analyses indicated lower amounts of lysine and arginine than most ribosomal proteins. Sequence homology was observed in the N terminus of YL3, and two prokaryotic 5-S RNA binding proteins, EL18 from Escherichia coli and HL13 from Halobacterium cutirubrum: Ala1-Phe2-Gln3-Lys4-Asp5-Ala6-Lys7-Ser8-Ser9-Ala10-Tyr11-Ser12-Ser13-Arg14-Phe15-Gln16-Tyr17-Pro18-Phe19-Arg20-Arg21-Arg22-Arg23-Glu24-Gly25-Lys26-Thr27-Asp28-Tyr29-Tyr35; of particular interest was homology in the cluster of basic residues (18--23). Since the protein contained one methionine residue it could be split into two fragments, CN1 (Mr = 24700) and CN2 (Mr = 11300) by CNBr treatment; the larger fragment originated from the N terminus. The N-terminal amino acid sequence of CN2 shared a limited sequence homology with an internal portion of a second 5-S RNA binding protein from E. coli, EL5, and, based also on the molecular weights of the proteins and studies on the protein binding sites in 5-S RNAs, a model for the evolution of the eukaryotic 5-S RNA binding protein is suggested in which a fusion of the prokaryotic sequences may have occurred. Unlike the native 5-S RNA . protein complex, a variety of RNAs interacted with the smaller CN2 fragment to form homogeneous ribonucleoprotein complexes; the results suggest that the CN1 fragment may confer specificity on the natural 5-S RNA-protein interaction.     

Terbium binding to ribosomes and ribosomal RNA.

Terbium binding to rat liver ribosomes and ribosomal RNA (rRNA) was examined by equilibrium dialysis and fluorescence spectroscopy. Upon binding to ribosomes and rRNA, the enhancement of terbium fluorescence emission at both 488 and 541 nm was dependent only upon the amount of bound terbium and independent of ionic strength. Binding profiles for ribosomes and rRNA suggested that terbium was bound to ribosomes primarily through rRNA interactions. Data suggested that terbium mimicked characteristics previously described for interactions between ribosomes and magnesium. It is proposed, therefore, that fluorescence of terbium bound to ribosomes may prove useful in studies on the nature and extent of interactions between ribosomes and magnesium.     

RNA binding targets aminoacyl-tRNA synthetases to translating ribosomes

Here, we examine tRNA-aminoacyl synthetase (ARS) localization in protein synthesis. Proteomics reveals that ten of the twenty cytosolic ARSs associate with ribosomes in sucrose gradients: phenylalanyl-RS (FRS), and the 9 ARSs that form the multi-ARS complex (MSC). Using the ribopuromycylation method (RPM) for localizing intracellular translation, we show that FRS and the MSC, and to a lesser extent other ARSs, localize to translating ribosomes, most strikingly when translation is restricted to poxvirus or alphavirus factories in infected cells. Immunoproximity fluorescence indicates close proximity between MSC and the ribosome. Stress induced-translational shutdown recruits the MSC to stress-granules, a depot for mRNA and translation components. MSC binding to mRNA provides a facile explanation for its delivery to translating ribosomes and stress granules. These findings, along with the abundance of the MSC (9 × 10(6) copies per cell, roughly equimolar with ribosomes), is consistent with the idea that MSC specificity, recently reported to vary with cellular stress (Netzer, N., Goodenbour, J. M., David, A., Dittmar, K. A., Jones, R. B., Schneider, J. R., Boone, D., Eves, E. M., Rosner, M. R., Gibbs, J. S., Embry, A., Dolan, B., Das, S., Hickman, H. D., Berglund, P., Bennink, J. R., Yewdell, J. W., and Pan, T. (2009) Nature 462, 522-526) can be modulated at the level of individual mRNAs to modify decoding of specific gene products.     

tRNA binding sites on the subunits of Escherichia coli ribosomes

Programmed 30 S subunits expose only one binding site, to which the different classes of tRNA (deacylated tRNAPhe, Phe-tRNAPhe, and N-acetylphenylalanyl (AcPhe)-tRNAPhe) bind with about the same affinity. Elongation factor Tu within the ternary complex does not contribute to the binding of Phe-tRNA. Binding of acylated or deacylated tRNA to 30 S depends on the cognate codon; nonprogrammed 30 S subunits do not bind tRNA to any significant extent. The existence of only one binding site/30 S subunit (and not, for example, two sites in 50% of the subunits) could be shown with Phe-tRNAPhe as well as deacylated tRNAPhe pursuing different strategies. Upon 50 S association the 30 S-bound tRNA appears in the P site (except the ternary complex which is found at the A site). Inhibition experiments with tetracycline demonstrated that the 30 S inhibition pattern is identical to that of the P site but differs from that of the A site of 70 S ribosomes. In contrast to 30 S subunits the 50 S subunit exclusively binds up to 0.2 and 0.4 molecules of deacylated tRNAPhe/50 S subunit in the absence and presence of poly(U), respectively, but neither Phe-tRNA nor AcPhe-tRNA. Noncognate poly(A) did not stimulate the binding indicating codon-anticodon interaction at the 50 S site. The exclusive binding of deacylated tRNA and its dependence on the presence of cognate mRNA is reminiscent of the characteristics of the E site on 70 S ribosomes. 30 and 50 S subunits in one test tube expose one binding site more than the sum of binding capacities of the individual subunits. The results suggest that the small subunit contains the prospective P site and the large subunit the prospective E site, thus implying that the A site is generated upon 30 S-50 S association.     

Sequence and conformation of 5 S RNA from Chlorella cytoplasmic ribosomes: comparison with other 5 S RNA molecules

The sequence of Chlorella cytoplasmic 5 S RNA has been determined by fingerprinting techniques. Partial digests were fractionated by a two-dimensional acrylamide gel electrophoretic technique, which indicates whether specific fragments are paired in the molecule. In this way, the four main base-paired regions of the molecule were located. The sequence of Chlorella cytoplasmic 5 S RNA is related to, but different from, that of other eukaryotic 5 S RNAs: it shows approximately 60% homology with vertebrate 5 S RNA and 40% homology with yeast 5 S RNA. In some respects the conformation of the molecule in solution is quite different from that of other sequenced 5 S RNAs: in particular, the highly accessible region found around position 40 in all other 5 S RNAs (prokaryotic and eukaryotic) does not exist in this molecule.     

Factor-dependent binding of Rauscher leukemia virus RNA to ribosomes

Rauscher leukemia virus (RLV)-³H-RNA was shown to bind to ribosomes with the sedimentation properties of polyribosomes when incubated in a cell-free amino acid incorporation system derived from RLV-infected JLS-V5 cells. The binding of RLV-³H-RNA to ribosomes requires factors present in the high-salt wash of JLS-V5 polyribosomes, and is inhibited by aurintricarboxylic acid (ATA). The RLV-³H-RNA-ribosome complexes are sensitive to ribonucleases (RNase), ethylenediaminetetraacetate (EDTA), and puromycin.     

The nucleotide sequence of phenylalanine tRNA and 5S RNA from Rhodospirillum rubrum

The complete nucleotide sequence of tRNAPhe and 5S RNA from the photosynthetic bacterium Rhodospirillum rubrum has been elucidated. A combination of in vitro and in vivo labelling techniques was used. The tRNAPhe sequence is 76 nucleotides long, 7 of which are modified. The primary structure is typically prokaryotic and is most similar to the tRNAPhe of Escherichia coli and Anacystis nidulans (14 differences of 76 positions). The 5S ribosomal RNA sequence is 120 nucleotides long and again typical of other prokaryotic 5S RNAs. The invariable GAAC sequence is found starting at position 45. When aligned with other prokaryotic 5S RNA sequences, a surprising amount of nucleotide substitution is noted in the prokaryotic loop region of the R. rubrum 5S RNA. However, nucleotide complementarity is maintained reinforcing the hypothesis that this loop is an important aspect of prokaryotic 5S RNA secondary structure. The 5S and tRNAPhe are the first complete RNA sequences available from the photosynthetic bacteria.