Variation and classification of B low-molecular-weight glutenin subunit alleles in durum wheat

 The B low-molecular-weight (LMW) glutenin subunit composition of a collection of 88 durum wheat cultivars was analyzed. Extensive variation has been found and 18 different patterns were detected. Each cultivar exhibited 4–8 subunits, and altogether 20 subunits of different mobility were identified. The genetic control of all these subunits was determined through the analysis of nine F₂ populations and one backcross. Five subunits were controlled at the Glu-A3 locus, 14 at Glu-B3 and 1 at Glu-B2. At the Glu-A3 locus each cultivar possessed from zero to three bands and eight alleles were identified. At the Glu-B3 locus each cultivar showed four or five bands and nine alleles were detected. Only one band was encoded by the Glu-B2 locus. A nomenclature for these alleles is proposed and the relationship between them and the commonly used LMW-model nomenclature is discussed. Received: 10 February 1997 / Accepted: 25 April 1997     

Development of haplotype-specific molecular markers for the low-molecular-weight glutenin subunits

Low-molecular-weight glutenin subunits (LMW-GSs) are one of the major components of gluten, and their allelic variation has been widely associated with different wheat end-use quality parameters. These proteins are encoded by multigene families located at the orthologous Glu-3 loci (Glu-A3, Glu-B3, and Glu-D3); the genes at each locus are divided by large intergenic and highly recombinogenic regions. Among the methods used for the LMW-GS allele identification, polymerase chain reaction (PCR)-based molecular markers have the advantages of being simple, accurate, and independent from the plant stage of development. However, the available LMW-GS molecular markers are either incapable of capturing the complexity of the LMW-GS gene family or difficult to interpret. In the present study, we report the development of a set of PCR-based molecular markers specific for the LMW-GS haplotypes present at each Glu-3 locus. Based on the LMW-GS gene sequences available in GenBank, single nucleotide polymorphisms (SNPs) specific for each Glu-3 haplotype were identified and the relevant PCR primers were designed. In total, we developed three molecular markers for the Glu-A3 and Glu-B3 loci, respectively, and five molecular markers for the Glu-D3 locus. The markers were tested on 44 bread wheat varieties previously characterized for their LMW-GS genic profile and found to be equally or more efficient than previously developed LMW-GS PCR-based markers. This set of markers allows an easier and less ambiguous identification of specific LMW-GS haplotypes associated with gluten strength and can facilitate marker-assisted breeding for wheat quality.     

Characterization of low-molecular-weight glutenin subunit genes and their protein products in common wheats

To characterize the low-molecular-weight glutenin subunit (LMW-GS), we developed specific PCR primer sets to distinguish 12 groups of LMW-GS genes of Norin 61 and to decide their loci with nullisomic–tetrasomic lines of Chinese Spring. Three, two, and ten groups were assigned to Glu-A3, Glu-B3, and Glu-D3 loci, respectively. To identify the proteins containing the corresponding amino acid sequences, we determined the N-terminal amino acid sequence of 12 spots of LMW-GSs of Norin 61 separated by two-dimensional gel electrophoresis (2DE). The N-terminal sequences of the LMW-GS spots showed that 10 of 12 groups of LMW-GSs were expressed as protein products, which included LMW-i, LMW-m, and LMW-s types. Four spots were encoded by Glu-A3 (LMW-i). Three spots were encoded by Glu-B3 (LMW-m and LMW-s). Five spots were encoded by Glu-D3 (LMW-m and LMW-s). A minor spot of LMW-m seemed to be encoded by the same Glu-B3 gene as a major spot of LMW-s, but processed at a different site. Comparing among various cultivars, there were polymorphic and non-polymorphic LMW-GSs. Glu-A3 was highly polymorphic, i.e., the a, b, and c alleles showed one spot, the d allele showed four spots, and the e allele had no spot. Insignia used as one of the Glu-A3 null standard cultivars had a LMW-GS encoded by Glu-A3. We also found that Cheyenne had a new Glu-D3 allele. Classification of LMW-GS by a combination of PCR and 2DE will be useful to identify individual LMW-GSs and to study their contribution to flour quality.     

Sequence similarity between allelic Glu-B3 genes related to quality properties of durum wheat

 Low-molecular-weight glutenin subunits (LMW-GSs) are wheat endosperm proteins mostly encoded by genes located at the Glu-3 loci. These proteins are of particular interest in durum wheat because a correlation between LMW-GSs encoded by genes at the Glu-B3 locus and the pasta-making quality of durum wheat semolina has been shown. We isolated and characterized two allelic lmw-gs genes located at the Glu-B3 locus and present in durum wheat lines displaying different qualitative properties. The clones pLMW1CL and λLMW3.1 were found to contain allelic sequences encoding LMW-GSs belonging to the good and poor quality-related groups named LMW-2 and LMW-1, respectively. The LMW-GSs specified by these genes have very large repetitive domains which are composed of repeats regularly distributed along the domain. The main difference between these two proteins is an insertion of 13 amino acids within the repetitive domain which, by itself, seems insufficient to explain the qualitative differences between LMW-2 and LMW-1. These results further support the hypothesis that the greater amount of LMW-2, rather than sequence peculiarities, accounts for the better quality observed in durum wheat cultivars possessing these subunits. The characterization of the complete primary structure of these alleles, other than providing information for an understanding of the structure-function relationship among LMW-GSs and furnishing basic material for wheat engineering, should also assist in our understanding of the evolutionary relationship between the different lmw-gs genes. Received: 8 May 1998 / Accepted: 5 August 1998     

Genetic characterization of storage proteins in a set of F1-derived haploid lines in bread wheat

Wheat storage proteins were evaluated by SDS-PAGE in a population of 206 doubled haploid (DH) lines, produced from a cross between bread wheat cvs Chinese Spring (CS) and Courtot (CT). The analysis of gliadins and high- and low-molecular-weight glutenins gave rise to 11 protein markers between parental varieties. Among these, one each was encoded at the Glu-A1, Gli-A1, Gli-A2, Gli-A5, Glu-B3, Gli-B1 and Gli-D1 loci and four were encoded at the Glu-D3 locus. Only the Gli-A2 marker showed a distorted segregation. A distance of 1.94 cM was evaluated between the Gli-A1 locus and the recently found Gli-A5 locus. Among the DH lines, only nine exhibited an unexpected pattern. The chromosome allocation was determined for almost all the LMW-GS and gliadin bands of CS using nullitetrasomic and ditelosomic lines. Two C LMW-GS were found to be coded by 6DS. Similarly, substitution lines into CT allowed the allelic determination of numerous LMW-GS and gliadin bands. A correspondence between gliadin markers separated in SDS-PAGE and in A-PAGE revealed that the common allele Gli-Aa between CS and CT determined in A-PAGE was able to be separated into two alleles when SDS-PAGE was used.     

Molecular characterization and genomic organization of low molecular weight glutenin subunit genes at the Glu-3 loci in hexaploid wheat (Triticum aestivum L.)

In this study, we report on the molecular characterization and genomic organization of the low molecular weight glutenin subunit (LMW-GS) gene family in hexaploid wheat (Triticum aestivum L.). Eighty-two positive BAC clones were identified to contain LMW-GS genes from the hexaploid wheat ‘Glenlea’ BAC library via filter hybridization and PCR validation. Twelve unique LMW glutenin genes and seven pseudogenes were isolated from these positive BAC clones by primer-template mismatch PCR and subsequent primer walking using hemi-nested touchdown PCR. These genes were sequenced and each consisted of a single-open reading frame (ORF) and untranslated 5′ and 3′ flanking regions. All 12 LMW glutenin subunits contained eight cysteine residues. The LMW-m-type subunits are the most abundant in hexaploid wheat. Of the 12 LMW-GS, 1, 2 and 9 are i-type, s-type and m-type, respectively. The phylogenetic analysis suggested that the LMW-i type gene showed greater differences to LMW-s and LMW-m-type genes, which, in turn, were more closely related to one another. On the basis of their N-terminal sequences, they were classified into nine groups. Fingerprinting of the 82 BAC clones indicated 30 BAC clones assembled into eight contigs, while the remaining clones were singletons. BAC end sequencing of the 82 clones revealed that long terminal repeat (LTR) retrotransposons were abundant in the Glu-3 regions. The average physical distance between two adjacent LMW-GS genes was estimated to be 81 kb. Most of LMW-GS genes are located in the d-genome, suggesting that the Glu-D3 locus is much larger than the Glu-B3 locus and Glu-A3 locus. Alignments of sequences indicated that the same type (starting with the same N-terminal sequence) LMW-GS genes were highly conserved in the homologous genomes between hexaploid wheat and its donors such as durum wheat and T. tauschii. Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users.     

Seed-storage-protein loci in RFLP maps of diploid, tetraploid, and hexaploid wheat

 Linkages between high- and low-molecular-weight (M_r) glutenin, gliadin and triticin loci in diploid, tetraploid and hexaploid wheats were studied by hybridization of restriction fragments with DNA clones and by SDS-PAGE. In tetraploid and hexaploid wheat, DNA fragments hybridizing with a low-M_r glutenin clone were mapped at the XGlu-3 locus in the distal region of the maps of chromosome arms 1AS, 1BS, and 1DS. A second locus, designated XGlu-B2, was detected in the middle of the map of chromosome arm 1BS completely linked to the XGli-B3 gliadin locus. The restriction fragments mapped at this locus were shown to co-segregate with B subunits of low-M_r glutenins in SDS-PAGE in tetraploid wheat, indicating that XGlu-B2 is an active low-M_r glutenin locus. A new locus hybridizing with the low-M_r clone was mapped on the long arm of chromosome 7A^m in diploid wheat. No glutenin protein was found to co-segregate with this new locus. Triticin loci were mapped on chromosome arms 1AS, 1BS, and 1DS. A failure to detect triticin proteins co-segregating with DNA fragments mapped at XTri-B1 locus suggests that this locus is not active. No evidence was found for the existence of Gli-A4, and it is concluded that this locus is probably synonymous with Gli-A3. Recombination was observed within the multigene gliadin family mapped at XGli-A11 (1.2 cM).1 Although these closely linked loci may correspond to the previously named Gli-A1 and Gli-A5 loci, they were temporarily designated XGli-A1.1 and XGli-A1.2 until orthology with Gli-A1 and Gli-A5 is established. Received: 25 March 1997 / Accepted: 23 June 1997     

Identification of LMW glutenin-like genes from Secale sylvestre host

Three low-molecular-weight (LMW) glutenin-like genes (designated as Ssy1, Ssy2 and Ssy3) from Secale sylvestre Host were isolated and characterized. The three genes consist of a predicted highly conservative signal peptide with 20 amino acids, a short N-terminal region with 13 amino acids, a highly variable repetitive domain and a less variable C-terminal domain. The deduced amino acid sequences of the three genes were the LMW-m type due to a methionine residue at the N-terminus. The phylogenic analysis indicated that the prolamin genes could be perfectly clustered into five groups, including HMW-GS, LMW-GS, alpha/beta-, gamma- and omega-prolamin. The LMW glutenin-like genes of S. sylvestre were more orthologous with the LMW-GS genes of wheat and B hordein genes of barley, which also had been confirmed by the homology analysis with the LMW-GS of wheat at Glu-A3, Glu-B3 and Glu-D3 loci. These results indicated that a chromosome locus (designated as Glu-R3) might be located on the R genome of S. sylvestre with the functions similar to the Glu-3 locus in wheat and its related species.     

Characterization of Low Molecular Weight Glutenin Subunit Gene Representing Glu-B3 Locus of Indian Wheat Variety NP4

Low molecular weight (LMW) glutenin subunits represent major part (30%) of storage proteins in wheat endosperm and determine the quality of dough. Despite their importance few LMW glutenin genes have been characterized so far and none from Indian wheat variety. In the present investigation PCR technique was employed to characterize LMW-GS gene representing Glu-B3 locus from Indian bread wheat cultivar NP4. The deduced protein sequence coded by Glu-B3 locus of LMW-GS gene from NP4 showed the presence of regular structure of the repetitive domain with varying numbers of glutamine (Q) residues and the presence of 1^st cysteine residue within the repetitive domain at 40^th position in mature polypeptide. Such structure might increase and stabilize the gluten polymer through intermolecular interactions of the large numbers of glutamine side chains and cysteine residues for intermolecular disulphide bond formation leading to stronger dough quality of NP4. Moreover, Glu-B3 specific primers could also be used for identifying 1BL/1RS translocation in addition to amplifying LMW glutenin genes. There was no amplification in 1B/1R translocation lines as short arm of wheat was replaced by short arm of rye chromosome in these lines. Such information can be useful in wheat improvement for dough properties for better chapati and bread quality.     

HMW and LMW glutenin alleles among putative tetraploid and hexaploid European spelt wheat (<Emphasis Type="Italic">Triticum spelta</Emphasis> L.) progenitors

The allelic compositions of high- and low-molecular-weight subunits of glutenins (HMW-GS and LMW-GS) among European spelt (Triticum spelta L.) and related hexaploid and tetraploid Triticum species were investigated by one- and two-dimensional polyacrylamide-gel electrophoresis (PAGE) and capillary electrophoresis (CE). A total of seven novel glutenin alleles (designated A1a*, B1d*, B1g*, B1f*, B1j*, D1a* at Glu-1 and A3h at the Glu-3 loci, respectively) in European spelt wheat were detected by SDS-PAGE, which were confirmed further by employing A-PAGE and CE methods. Particularly, two HMW-GS alleles, Glu-B1d* coding the subunits 6.1 and 22.1, and Glu-B1f* coding the subunits 13 and 22*, were found to occur in European spelt with frequencies of 32.34% and 5.11%, respectively. These two alleles were present in cultivated emmer (Triticum dicoccum), but they were not observed in bread wheat (Triticum aestivum L.). The allele Glu-B1g* coding for 13* and 19* subunits found in spelt wheat was also detected in club wheat (Triticum compactum L.). Additionally, two alleles coding for LMW-GS, Glu-A3h and Glu-B3d, occurred with high frequencies in spelt, club and cultivated emmer wheat, whereas these were not found or present with very low frequencies in bread wheat. Our results strongly support the secondary origin hypothesis, namely European spelt wheat originated from hybridization between cultivated emmer and club wheat. This is also confirmed experimentally by the artificial synthesis of spelt through crossing between old European emmer wheat, T. dicoccum and club wheat, T. compactum.Communicated by H.F. Linskens     

Evidence of intralocus recombination at the <Emphasis Type="Italic">Glu-3</Emphasis> loci in bread wheat (<Emphasis Type="Italic">Triticum aestivum</Emphasis> L.)

Key message

Recombination at the Glu-3 loci was identified, and strong genetic linkage was observed only between the amplicons representing i-type and s-type genes located, respectively, at the Glu-A3 and Glu-B3 loci.

Abstract

The low-molecular weight glutenin subunits (LMW-GSs) are one of the major components of wheat seed storage proteins and play a critical role in the determination of wheat end-use quality. The genes encoding this class of proteins are located at the orthologous Glu-3 loci (Glu-A3, Glu-B3, and Glu-D3). Due to the complexity of these chromosomal regions and the high sequence similarity between different LMW-GS genes, their organization and recombination characteristics are still incompletely understood. This study examined intralocus recombination at the Glu-3 loci in two recombinant inbred line (RIL) and one doubled haploid (DH) population, all segregating for the Glu-A3, Glu-B3, and Glu-D3 loci. The analysis was conducted using a gene marker system that consists of the amplification of the complete set of the LMW-GS genes and their visualization by capillary electrophoresis. Recombinant marker haplotypes were detected in all three populations with different recombination rates depending on the locus and the population. No recombination was observed between the amplicons representing i-type and s-type LMW-GS genes located, respectively, at the Glu-A3 and Glu-B3 loci, indicating tight linkage between these genes. Results of this study contribute to better understanding the genetic linkage and recombination between different LMW-GS genes, the structure of the Glu-3 loci, and the development of more specific molecular markers that better represent the genetic diversity of these loci. In this way, a more precise analysis of the contribution of various LMW-GSs to end-use quality of wheat may be achieved.

     

Recombination mapping of some chromosome 1A-, 1B-, 1D- and 6B-controlled gliadins and low-molecular-weight glutenin subunits in common wheat

 Inheritance of low-molecular-weight glutenin subunits (LMW GS) and gliadins was studied in the segregating progeny from several crosses between common wheat genotypes. The occurrence of a few recombinants in the F₂ grains of the cross Skorospelka Uluchshennaya×Kharkovskaya 6 could be accounted for by assuming that the short arm of chromosome 1D contains two tightly linked loci each coding for at least one gliadin plus one C-type LMW GS. These loci were found to recombine at a frequency of about 2%, and to be linked to the Glu-D3 locus coding for B-type LMW GS. Some proteins showing biochemical characteristics of D-type or C-type LMW GS were found to be encoded by the Gli-B1 and Gli-B2 loci, respectively. Strongly stained B-type LMW GS in cvs Skorospelka Uluchshennaya and Richelle were assigned to the Glu-B3 locus, but recombination between this locus and Gli-B1 was not found. Analogously, in the cross Bezostaya 1×Anda, no recombination was found between Gli-A1 and Glu-A3, suggesting the maximum genetic distance between these loci to be 0.97% (P=0.05). A B-type LMW GS in cv Kharkovskaya 6 was assigned to the Glu-B2 locus, with about 25% recombination from the Gli-B1 locus. The present results suggested that alleles at Gli loci may relate to dough quality and serve as genetic markers of certain LMW GS affecting breadmaking quality. Received: 9 July 1996/Accepted: 15 November 1996     

Comprehensive identification of LMW-GS genes and their protein products in a common wheat variety

Although it is well known that low-molecular-weight glutenin subunits (LMW-GS) from wheat affect bread and noodle processing quality, the function of specific LMW-GS proteins remains unclear. It is important to find the genes that correspond to individual LMW-GS proteins in order to understand the functions of specific proteins. The objective of this study was to link LMW-GS genes and haplotypes characterized using well known Glu-A3, Glu-B3, and Glu-D3 gene-specific primers to their protein products in a single wheat variety. A total of 36 LMW-GS genes and pseudogenes were amplified from the Korean cultivar Keumkang. These include 11 Glu-3 gene haplotypes, two from the Glu-A3 locus, two from the Glu-B3 locus, and seven from the Glu-D3 locus. To establish relationships between gene haplotypes and their protein products, a glutenin protein fraction was separated by two-dimensional gel electrophoresis (2-DGE) and 17 protein spots were analyzed by N-terminal amino acid sequencing and tandem mass spectrometry (MS/MS). LMW-GS proteins were identified that corresponded to all Glu-3 gene haplotypes except the pseudogenes. This is the first report of the comprehensive characterization of LMW-GS genes and their corresponding proteins in a single wheat cultivar. Our approach will be useful to understand the contributions of individual LMW-GS to the end-use quality of flour.     

Characterization of low-molecular-weight glutenin subunit Glu-B3 genes and development of STS markers in common wheat (Triticum aestivum L.)

Low-molecular-weight glutenin subunit (LMW-GS) Glu-B3 has a significant influence on the processing quality of the end-use products of common wheat. To characterize the LMW-GS genes at the Glu-B3 locus, gene-specific PCR primers were designed to amplify eight near-isogenic lines and Cheyenne with different Glu-B3 alleles (a, b, c, d, e, f, g, h and i) defined by protein electrophoretic mobility. The complete coding regions of four Glu-B3 genes with complete coding sequence were obtained and designated as GluB3-1, GluB3-2, GluB3-3 and GluB3-4. Ten allele-specific PCR markers designed from the SNPs present in the sequenced variants discriminated the Glu-B3 proteins of electrophoretic mobility alleles a, b, c, d, e, f, g, h and i. These markers were validated on 161 wheat varieties and advanced lines with different Glu-B3 alleles, thus confirming that the markers can be used in marker-assisted breeding for wheat grain processing quality. Electronic supplementary material  The online version of this article (doi:) contains supplementary material, which is available to authorized users. L. H. Wang and X. L. Zhao contributed equally to this study.     

Intrachromosomal mapping of the nucleolar organiser region relative to three marker loci on chromosome 1B of wheat (Triticum aestivum)

Summary Restriction enzyme digestion of the ribosomal RNA genes of the nucleolar organisers of wheat has revealed fragment length polymorphisms for the nucleolar organiser on chromosome 1B and the nucleolar organiser on 6B. Variation between genotypes for these regions has also been demonstrated. This variation has been exploited to determine the recombination frequency between the physically defined nucleolar organiser on 1B (designatedNor1) and other markers; two loci,Glu-B1 andGli-B1 which code for endosperm storage proteins andRf3, a locus restoring fertility to male sterility conditioned byT. timopheevi cytoplasm.Gli-B1 andRf3 were located on the short-arm satellite but recombine with the nucleolar organiser giving a gene order ofNor1 — Rf3 — Gli-B1. Glu-B1 is located on the long arm of 1B but shows relatively little recombination withNor1, which is, in physical distance, distal on the short arm. This illustrates the discrepancy between map distance and physical distance on wheat chromosomes due to the distal localisation of chiasmata. The recombination betweenNor1 andRf3 indicates that, contrary to previous suggestions, fertility restoration is not a property of the nucleolar organiser but of a separate locus.     

Identification of LMW Glutenin-Like Genes from <Emphasis Type="Italic">Secale sylvestre</Emphasis> Host

Three low-molecular-weight (LMW) glutenin-like genes (designated as Ssy1, Ssy2, and Ssy3) from Secale sylvestre Host were isolated and characterized. The three genes consist of a predicted highly conservative signal peptide with 20 amino acids, a short N-terminal region with 13 amino acids, a highly variable repetitive domain and a less variable C-terminal domain. The deduced amino acid sequences of the three genes were the LMW-m type due to a methionine residue at the N-terminus. The phylogenetic analysis indicated that the prolamin genes could be perfectly clustered into five groups, including HMW-GS, LMW-GS, α/β-, γ-, and κ-prolamin. The LMW glutenin-like genes of S. sylvestre were more orthologous with the LMW-GS genes of wheat and B hordein genes of barley, which also had been confirmed by the homology analysis with the LMW-GS of wheat at Glu-A3, Glu-B3, and Glu-D3 loci. These results indicated that a chromosome locus (designated as Glu-R3) might be located on the R genome of S. sylvestre with the functions similar to the Glu-3 locus in wheat and its related species.     

Mapping of the quantitative trait loci (QTL) associated with grain quality characteristics of the bread wheat grown under different environmental conditions

The quantitative trait loci (QTL) associated with individual characteristics of grain and flour quality in wheat lines grown under contrasting environmental conditions were mapped. Overall, 22 QTL that manifested under contrasting environmental conditions with various significances were detected on 10 chromosomes. Grain hardness and vitreousness were associated with three loci on chromosomes 5D, 6A, and 3A, while the gluten content, with two loci on chromosomes 5B and 7A. Dough extensibility was associated with only one QTL localized in the region of Glu-A1 locus. One of the loci determining flour and dough strengths is located in the region of Gli-B1 and Glu-B3 loci and the rest, in various regions of chromosomes 1B, 5D, and 4B, where no particular genes associated with grain quality have been yet found. The detected QTL can be used in further experiments on genetic control of gluten formation and quality in wheat.     

Storage-protein variation in wild emmer wheat (Triticum turgidum ssp.dicoccoides) from Jordan and Turkey. I. Electrophoretic characterization of genotypes

Seed storage-protein variation at theGlu-A1,Glu-B1 andGli-B1/Glu-B3 loci in the tetraploid wild progenitor of wheat,T. dicoccoides, was studied electrophoretically in 315 individuals representing nine populations from Jordan and three from Turkey. A total of 44 different HMW-glutenin patterns were identified, resulting from the combination of 15 alleles in the A genome and 19 in the B genome. Twenty-seven new allelic variants, 12 at theGlu-A1 locus and 15 at theGlu-B1 locus, were identified by comparing the mobilities of their subunits to those previously found in bread and durum wheats. The novel variants include six alleles at theGlu-A1 locus showing both x and y subunits. The genes coding for the 1Bx and 1By subunits showed no or very little (3%) inactivity, the 1Ax gene showed a moderate degree (6.3%) of inactivity whereas the gene coding for lAy showed the highest degree of inactivity (84.8%). A high level of polymorphism was also present for the omega- and gamma-gliadins and LMW-glutenin subunits encoded by genes at the linkedGli-B1 andGlu-B3 loci (19 alleles). Some Jordanian accessions were found to contain omega-gliadin 35, gamma-gliadin 45, and LMW-2 also present in cultivated durum wheats and related to good gluten viscoelasticity. The newly-discovered alleles enhance the genetic variability available for improving the technological quality of wheats. Additionally some of them may facilitate basic research on the relationship between industrial properties and the number and functionality of HMW- and LMW-glutenin subunits.     

Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat

Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.     

Allelic variations in <Emphasis Type="Italic">Glu-1</Emphasis> and <Emphasis Type="Italic">Glu-3</Emphasis> loci of historical and modern Iranian bread wheat (<Emphasis Type="Italic">Triticum aestivum</Emphasis> L.) cultivars

Proline and glutamine-rich wheat seed endosperm proteins are collectively referred to as prolamins. They are comprised of HMW-GSs, LMW-GSs and gliadins. HMW-GSs are major determinants of gluten elasticity and LMW-GSs considerably affect dough extensibility and maximum dough resistance. The inheritance of glutenin subunits follows Mendelian genetics with multiple alleles in each locus. Identification of the banding patterns of glutenin subunits could be used as an estimate for screening high quality wheat germplasm. Here, by means of a two-step 1D-SDS-PAGE procedure, we identified the allelic variations in high and low-molecular-weight glutenin subunits in 65 hexaploid wheat (Triticum aestivum L.) cultivars representing a historical trend in the cultivars introduced or released in Iran from the years 1940 to 1990. Distinct alleles 17 and 19 were detected for Glu-1 and Glu-3 loci, respectively. The allelic frequencies at the Glu-1 loci demonstrated unimodal distributions. At Glu-A1, Glu-B1 and Glu-D1, we found that the most frequent alleles were the null, 7 + 8, 2 + 12 alleles, respectively, in Iranian wheat cultivars. In contrast, Glu-3 loci showed bimodal or trimodal distributions. At Glu-A3, themost frequent alleles were c and e. At Glu-B3 the most frequent alleles were a, b and c. At Glu-D3 locus, the alleles b and a, were the most and the second most frequent alleles in Iranian wheat cultivars. This led to a significantly higher Nei coefficient of genetic variations in Glu-3 loci (0.756) as compared to Glu-1 loci (0.547). At Glu-3 loci, we observed relatively high quality alleles in Glu-A3 and Glu-D3 loci and low quality alleles at Glu-B3 locus.