Development of a qPCR assay for specific quantification of Botrytis cinerea on grapes

The aim of this study was to develop a system for rapid and accurate real-time quantitative PCR (qPCR) identification and quantification of Botrytis cinerea, one of the major pathogens present on grapes. The intergenic spacer (IGS) region of the nuclear ribosomal DNA was used to specifically detect and quantify B. cinerea. A standard curve was established to quantify this fungus. The qPCR reaction was based on the simultaneous detection of a specific IGS sequence and also contained an internal amplification control to compensate for variations in DNA extraction and the various compounds from grapes that inhibit PCR. In these conditions, the assay had high efficiency (97%), and the limit of detection was estimated to be 6.3 pg DNA (corresponding to 540 spores). Our method was applied to assess the effects of various treatment strategies against Botrytis in the vineyard. Our qPCR assay proved to be rapid, selective and sensitive and may be used to monitor Botrytis infection in vineyards.     

Quantitative real-time PCR assay for rapid detection of plant and human pathogenic Macrophomina phaseolina from field and environmental samples

A real-time qPCR assay was developed to detect and quantify Macrophomina phaseolina abundance in rhizosphere soil and plant tissue. Both TaqMan and SYBR green techniques were targeted on ~ 1 kb sequence characterized amplified region (SCAR) of M. phaseolina and two sets of specific primers were designed for SYBR green (MpSyK) and TaqMan (MpTqK) assays. No cross-hybridization and no fluorescent signal exceeding the baseline threshold was observed in TaqMan and SYBR green assays, respectively. The minimum detection limit or sensitivity of TaqMan assay was 30 fg/μL of M. phaseolina DNA and limit of quantification of M. phaseolina viable population was estimated as 0.66 × 10(5) CFU/g soil(-1) equivalent to 10 pg/μL of target DNA. This is the first report which demonstrated real-time qPCR assays with greater specificity and sensitivity to detect M. phaseolina population in soil and plant materials.     

A Plating‐PCR Technique for Detection and Quantification of the Biological Control Agent Agrobacterium vitis Strain E26 in Soil under Controlled Conditions

Agrobacterium vitis strain E26 is a promising biocontrol agent of grapevine crown gall, an economically important disease of grape worldwide. In this report, we developed a Plating‐PCR method that allows specific detection and quantification of E26 by combining classical microbiological techniques with molecular tools. Random amplified polymorphic DNA fingerprints were used to differentiate E26 from other A. vitis strains. A differentially amplified fragment from E26 was sequenced and characterized as a sequence characterized amplified region (SCAR) marker. Two primer pairs were then designed and evaluated for their specificity against E26. One of the two SCAR primer pairs, 740F/R, was further selected for specific detection of strain E26. A plating assay coupled to PCR with the SCAR primers 740F/R allowed the assessment of population dynamics of E26 in non‐sterile grape rhizosphere soil under controlled conditions.     

Development of a strain-specific genomic marker for monitoring a Bacillus subtilis biocontrol strain in the rhizosphere of tomato

A strain-specific molecular marker enabling the detection and tracking of the biological control agent Bacillus subtilis 101, when released into the environment, was developed. Random amplified polymorphic DNA (RAPD) technique was used to differentiate this from other B. subtilis strains. A differentially amplified fragment obtained from RAPD profiles was sequenced and characterized as sequence-characterized amplified region (SCAR) marker, and four primer pairs were designed and evaluated for their specificity towards this strain. The sensibility of the selected SCAR primer pair was evaluated by qualitative PCR and Southern blotting, and the detection limit was assessed around 10(2) CFU (g dry wt soil)(-1), thus providing a reliable tool for the traceability of this B. subtilis strain in greenhouse or field trials. A plating assay coupled to PCR with the SCAR primer pair was then used as a detection method in microcosm experiments for monitoring the population of B. subtilis 101 in the rhizosphere of tomato, grown under two different soil conditions, i.e. nonsterile peat-based substrate and sandy-loam agricultural soil, respectively. The data of rhizosphere colonization indicated that the soil conditions significantly affected the rhizosphere establishment of strain 101.     

Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat

Spot blotch of wheat caused by Bipolaris sorokiniana is an important disease of wheat, especially in slightly warm (25 ± 1 °C) and humid weather conditions. A quick and reliable PCR-based diagnostic assay has been developed to detect B. sorokiniana using a pathogen-specific marker derived from genomic DNA. A PCR-amplified band of 650 bp obtained in B. sorokiniana isolates using universal rice primer (URP 1F) was cloned in pGEMT easy vector and sequenced. Based on sequences, six primers were designed, out of which a primer pair RABSF1 (GGTCCGAGACAACCAACAA) and RABSR2 (AAAGAAAGCGGTCGACGTAA) amplified a sequence of 600 bp in B. sorokiniana isolates. The specificity of the marker when tested against 40 isolates of B. sorokiniana, seven isolates of other species of Bipolaris, and 27 isolates of other pathogens infecting wheat and other crops showed a specific band of 600 bp only in B. sorokiniana. The detection limit was 50 pg of genomic DNA. The marker could detect the pathogen in soil and wheat leaves at presymptomatic stage. This sequence characterized amplified region (SCAR) marker designated as SCRABS(600) could clearly distinguish B. sorokiniana from other fungal plant pathogens, including Bipolaris spp. The utilization of this diagnostic PCR assay in analysis of field soil and wheat leaves will play a key role in effective management of the disease.     

Identification of a universally primed-PCR-derived sequence-characterized amplified region marker for an antagonistic strain of Clonostachys rosea and development of a strain-specific PCR detection assay

We developed a PCR detection method that selectively recognizes a single biological control agent and demonstrated that universally primed PCR (UP-PCR) can identify strain-specific markers. Antagonistic strains of Clonostachys rosea (syn. Gliocladium roseum) were screened by UP-PCR, and a strain-specific marker was identified for strain GR5. No significant sequence homology was found between this marker and any other sequences in the databases. Southern blot analysis of the PCR product revealed that the marker represented a single-copy sequence specific for strain GR5. The marker was converted into a sequence-characterized amplified region (SCAR), and a specific PCR primer pair was designed. Eighty-two strains, isolated primarily from Danish soils, and 31 soil samples, originating from different localities, were tested, and this specificity was confirmed. Two strains responded to the SCAR primers under suboptimal PCR conditions, and the amplified sequences from these strains were similar, but not identical, to the GR5 marker. Soil assays in which total DNA was extracted from GR5-infested and noninoculated field soils showed that the SCAR primers could detect GR5 in a pool of mixed DNA and that no other soil microorganisms present contained sequences amplified by the primers. The assay developed will be useful for monitoring biological control agents released into natural field soil.     

Real-time PCR monitoring of fungal development in Arabidopsis thaliana infected by Alternaria brassicicola and Botrytis cinerea.

Reliable methods for disease severity assessment are of crucial importance in the study of plant pathogen interactions, either for disease diagnostic on the field or to assess phenotypical differences in plants or pathogen strains. Currently, most of the assays used in fungal disease diagnostic rely on visual assessment of the symptoms, lesion diameter measurement or spore counting. However, these tests are tedious and often cannot discriminate between slightly different levels of resistance. Besides, they are not well suited to assess fungal development in the early phases of the infection, before macroscopical symptoms are visible or before sporulation. We describe here a pathogenicity assay based on the relative quantification of fungal and plant DNA in infected Arabidopsis thaliana leaves by means of real-time quantitative PCR. We show that it allows to monitor quantitatively the growth of the fungi Alternaria brassicicola and Botrytis cinerea in a sensitive and reliable way. Although highly sensitive, this test also exhibits a high robustness, which is crucial to significantly discriminate between lines displaying slightly different levels of resistance. Therefore, it allows to assess fungal development from the very first stages of infection and provides a fast and very practical alternative to currently described assays for phenotyping either plant mutant lines or fungal strains.     

Identification of a Universally Primed-PCR-Derived Sequence-Characterized Amplified Region Marker for an Antagonistic Strain of Clonostachys rosea and Development of a Strain-Specific PCR Detection Assay

We developed a PCR detection method that selectively recognizes a single biological control agent and demonstrated that universally primed PCR (UP-PCR) can identify strain-specific markers. Antagonistic strains of Clonostachys rosea (syn. Gliocladium roseum) were screened by UP-PCR, and a strain-specific marker was identified for strain GR5. No significant sequence homology was found between this marker and any other sequences in the databases. Southern blot analysis of the PCR product revealed that the marker represented a single-copy sequence specific for strain GR5. The marker was converted into a sequence-characterized amplified region (SCAR), and a specific PCR primer pair was designed. Eighty-two strains, isolated primarily from Danish soils, and 31 soil samples, originating from different localities, were tested, and this specificity was confirmed. Two strains responded to the SCAR primers under suboptimal PCR conditions, and the amplified sequences from these strains were similar, but not identical, to the GR5 marker. Soil assays in which total DNA was extracted from GR5-infested and noninoculated field soils showed that the SCAR primers could detect GR5 in a pool of mixed DNA and that no other soil microorganisms present contained sequences amplified by the primers. The assay developed will be useful for monitoring biological control agents released into natural field soil.     

Development of a sequence-characterized amplified region marker-targeted quantitative PCR assay for strain-specific detection of Oenococcus oeni during wine malolactic fermentation

Control over malolactic fermentation (MLF) is a difficult goal in winemaking and needs rapid methods to monitor Oenococcus oeni malolactic starters (MLS) in a stressful environment such as wine. In this study, we describe a novel quantitative PCR (QPCR) assay enabling the detection of an O. oeni strain during MLF without culturing. O. oeni strain LB221 was used as a model to develop a strain-specific sequence-characterized amplified region (SCAR) marker derived from a discriminatory OPA20-based randomly amplified polymorphic DNA (RAPD) band. The 5' and 3' flanking regions and the copy number of the SCAR marker were characterized using inverse PCR and Southern blotting, respectively. Primer pairs targeting the SCAR sequence enabled strain-specific detection without cross amplification of other O. oeni strains or wine species of lactic acid bacteria (LAB), acetic acid bacteria (AAB), and yeasts. The SCAR-QPCR assay was linear over a range of cell concentrations (7 log units) and detected as few as 2.2 × 10(2) CFU per ml of red wine with good quantification effectiveness, as shown by the correlation of QPCR and plate counting results. Therefore, the cultivation-independent monitoring of a single O. oeni strain in wine based on a SCAR marker represents a rapid and effective strain-specific approach. This strategy can be adopted to develop easy and rapid detection techniques for monitoring the implantation of inoculated O. oeni MLS on the indigenous LAB population, reducing the risk of unsuccessful MLF.     

Development of silverleaf assay, protein and nucleic acid-based diagnostic techniques for the quick and reliable detection and monitoring of biotype B of the whitefly, Bemisia tabaci (Gennadius)

The aim of this study was to develop and optimize silverleaf bioassay, esterase analysis and PCR-based techniques to distinguish quickly and reliably biotype B of the whitefly, Bemisia tabaci (Gennadius), from Indian indigenous biotypes. Zucchini and squash readily develop silverleaf symptoms upon feeding by the B biotype, but they are not readily available in Indian markets. A local pumpkin variety 'Big' was, therefore, used in silverleaf assay, which developed symptoms similar to those on zucchini and squash and can be used reliably to detect B biotype. Analysis of non-specific esterases of B and the indigenous biotypes indicated both quantitative and qualitative differences in esterase patterns. Two high molecular weight bands were unique to B biotype and they occurred in abundance. These esterases were used to develop quick and field-based novel detection methods for differentiating B from the indigenous biotypes. Development of these simple and cost-effective protocols has wider application as they can be potentially used to identify other agricultural pests. Mitochondrial cytochrome oxidase I gene sequences and randomly amplified polymorphic DNA (RAPD) polymorphisms, generated using the primer OpB11, were also found useful for detecting B. tabaci biotypes. A B biotype-specific RAPD band of 800 bp was sequenced, which was used to a develop sequence characterized amplified region (SCAR) marker. The SCAR marker involved the development of B biotype-specific primers that amplified 550 bp PCR products only from B biotype genomic DNA. Silverleaf assay, esterases, RAPDs or a SCAR marker were used in combination to analyse whitefly samples collected from selected locations in India, and it was found that any of these techniques can be used singly or in combination to detect B biotype reliably. The B biotype was found in southern parts of India but not in the north in 2004-06.     

Development of a sequence-characterized amplified region marker for diagnosis of dwarf bunt of wheat and detection of Tilletia controversa Kühn

Aims:  Dwarf bunt of wheat, caused by Tilletia controversa Kühn, is a destructive disease on wheat as well as an important international quarantined disease in many countries. The objective of this investigation was to develop a diagnostic molecular marker generated from amplified fragment length polymorphism (AFLP) for rapid identification of T . controversa .
Methods and Results:  A total of 30 primer combinations were tested by AFLP to detect DNA polymorphisms between T. controversa and related species. The primer combination E08/M02 generated a polymorphic pattern displaying a 451-bp DNA fragment specific for T. controversa . The marker was converted into a sequence-characterized amplified region (SCAR), and specific primers (SC-01₄₉/SC-02₄₁₅), designed for use in PCR detection assays, amplified a unique DNA fragment in all isolates of T. controversa , but not in the related pathogens. The detection limit with the primer set SC-01₄₉/SC-02₄₁₅ was 10 ng of DNA which could be obtained from 11  μ g of teliospores in a 25- μ l PCR reaction.
Conclusions:  An approach to distinguish T. controversa from similar pathogenic fungi has been developed based on the use of a SCAR marker.
Significance and Impact of the Study:  Development of the simple, high throughput assay kit for the rapid diagnosis of dwarf bunt of wheat and detection of T. controversa is anticipated in further studies.     

DNA sequence analysis of herbarium specimens facilitates the revival of Botrytis mali, a postharvest pathogen of apple

The fungus Botrytis cinerea has been widely accepted as the species responsible for causing gray mold decay of apple, although a second species causing apple decay, B. mali, was reported in 1931. Botrytis mali was validly published in 1931, nevertheless it has always been considered a doubtful species. To study the relationship of Botrytis isolates causing gray mold on apple, DNA sequence analysis was employed. Twenty-eight Botrytis isolates consisting of 10 species were sampled, including two B. mali herbarium specimens from apple originally deposited in 1932. The DNA sequence analysis of the beta-tubulin and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) genes placed the isolates into groupings with defined species boundaries that generally reflected the morphologically based model for Botrytis classification. The B. cinerea isolates from apple and other host plants were placed in a single clade. The B. mali herbarium specimens however always fell well outside that clade. The DNA sequence analysis reported in this study support the initial work by Ruehle (1931) describing the apple pathogen B. mali as a unique species.     

Detection of the biocontrol agent Colletotrichum coccodes (183088) from the target weed velvetleaf and from soil by strain-specific PCR markers

Diagnostic molecular markers, generated from random amplified polymorphic DNA (RAPD) and used in polymerase chain reaction (PCR), were developed to selectively recognize and detect the presence of a single strain of the biocontrol fungus Colletotrichum coccodes (183088) on the target weed species Abutilon theophrasti and from soil samples. Several isolates of C. coccodes, 15 species of Colletotrichum, a variety of heterogeneous organisms and various plant species were first screened by RAPD-PCR, and a strain specific marker was identified for C. coccodes (183088). No significant sequence similarity was found between this marker and any other sequences in the databases. The marker was converted into a sequence-characterised amplified region (SCAR), and specific primer sets (N5F/N5R, N5Fi/N5Ri) were designed for use in PCR detection assays. The primer sets N5F/N5R and N5Fi/N5Ri each amplified a single product of 617 and 380 bp, respectively, with DNA isolated from strain 183088. The specificity of the primers was confirmed by the absence of amplified products with DNA from other C. coccodes isolates, other species representing 15 phylogenetic groups of the genus Colletotrichum and 11 other organisms. The SCAR primers (N5F/N5R) were successfully used to detect strain 183088 from infected velvetleaf plants but not from seeded greenhouse soil substrate or from soil samples originating from deliberate-released field experiments. The sensitivity of the assay was substantially increased 1000-fold when nested primers (N5Fi/N5Ri) were used in a second PCR run. N5Fi/N5Ri selectively detected strain 183088 from seeded greenhouse soils as well as from deliberate-released field soil samples without any cross-amplification with other soil microorganisms. This rapid PCR assay allows an accurate detection of C. coccodes strain 183088 among a background of soil microorganisms and will be useful for monitoring the biocontrol when released into natural field soils.     

Development of SRAP,SNP and Multiplexed SCAR molecular markers for the major seed coat color gene in <Emphasis Type="Italic">Brassica rapa L.</Emphasis>

Seed coat color inheritance in B. rapa was studied in F(1), F(2), F(3), and BC(1) progenies from a cross of a Canadian brown-seeded variety 'SPAN' and a Bangladeshi yellow sarson variety 'BARI-6'. A pollen effect was found when the yellow sarson line was used as the maternal parent. Seed coat color segregated into brown, yellow-brown and bright yellow classes. Segregation was under digenic control where the brown or yellow-brown color was dominant over bright yellow seed coat color. A sequence related amplified polymorphism (SRAP) marker linked closely to a major seed coat color gene (Br1/br1) was developed. This dominant SRAP molecular marker was successfully converted into single nucleotide polymorphism (SNP) markers and sequence characterized amplification region (SCAR) markers after the extended flanking sequence of the SRAP was obtained with chromosome walking. In total, 24 SNPs were identified with more than 2-kb sequence. A 12-bp deletion allowed the development of a SCAR marker linked closely to the Br1 gene. Using the five-fluorescence dye set supplied by ABI, four labeled M13 primers were integrated with different SCAR primers to increase the throughput of SCAR marker detection. Using multiplexed SCAR markers targeting insertions and deletions in a genome shows great potential for marker assisted selection in plant breeding.     

Development of a SCAR (sequence characterised amplified region) marker for molecular tagging of the dwarf BREIZH (Bzh) gene in Brassica napus L.

 A SCAR (sequence characterised amplified region) has been developed for optimal tagging of the dwarf Bzh gene in Brassica napus. A RAPD marker named OPMO7-730 was previously found closely linked to the dwarf locus at 0.8±0.7 cM. The DNA band corresponding to this marker was cloned and sequenced, and specific PCR primers were designed. The PCR test allowed us to amplify the locus corresponding to OPM07-730. With a restriction endonuclease digest and optimal electrophoresis conditions, three allelic forms of this marker have been recovered on the 40 B. napus accessions tested. The usefullness of this marker in breeding dwarf rapeseed lines is discussed. Received: 20 April 1998 / Accepted: 29 April 1998     

High throughput genome-specific and gene-specific molecular markers for erucic acid genes in <Emphasis Type="Italic">Brassica napus</Emphasis> (L.) for marker-assisted selection in plant breeding

A single base change in the Bn-FAE1.1 gene in the A genome and a two-base deletion in the Bn-FAE1.2 gene in the C genome produce the nearly zero content of erucic acid observed in canola. A BAC clone anchoring Bn-FAE1.1 from a B. rapa BAC library and a BAC clone anchoring Bn-FAE1.2 from a B. oleracea BAC library were used in this research. After sequencing the gene flanking regions, it was found that the dissimilarity of the flanking sequences of these two FAE1 homologs facilitated the design of genome-specific primers that could amplify the corresponding genome in allotetraploid B. napus. The two-base deletion in the C genome gene was detected as a sequence-characterized amplified region (SCAR) marker. To increase the throughput, one genome-specific primer was labeled with four fluorescence dyes and combined with 20 different primers to produce PCR products with different fragment sizes. Eventually, a super pool of 80 samples was detected simultaneously. This dramatically reduces the cost of marker detection. The single base change in the Bn-FAE1.1 gene was detected as single nucleotide polymorphic (SNP) marker with an ABI SNaPshot kit. A multiplexing primer set was designed by adding a polyT to the 5' primer end to increase SNP detection throughput through sample pooling. Furthermore, the Bn-FAE1.1 and Bn-FAE1.2 were integrated into the N8 and N13 linkage groups of our previously reported high-density sequence-related amplified polymorphism (SRAP) map, respectively. There were 124 SRAP markers in a N8 bin in which the Bn-FAE1.1 gene-specific SCAR marker was located and 46 SRAP markers in a N13 bin into which the Bn-FAE1.2 SNP marker was integrated. These three kinds of high throughput molecular markers have been successfully implemented in our canola/rapeseed breeding programs.     

An ISSR‐based Approach for the Molecular Detection and Diagnosis of Dwarf Bunt of Wheat,Caused by Tilletia controversa Kühn

Dwarf bunt of wheat, caused by Tilletia controversa Kühn, is an important international quarantine disease in many countries. The objective of this investigation was to develop a diagnostic molecular marker generated from intersimple sequence repeat (ISSR) for rapid identification of T. controversa. A total of 60 primers were tested by ISSR to detect DNA polymorphisms between T. controversa and related species. The primer ISSR818 generated a polymorphic pattern displaying a 952‐ bp DNA fragment specific for T. controversa. The marker was converted into a sequence characterized amplified region (SCAR), and specific primers (TCKSF2/TCKSR2) were designed for use in a PCR detection assay. Its detection limit was 1 ng of DNA, which could be yielded by 1.1 μg of teliospores in a 25‐ μl PCR. Conclusively, a method to distinguish T. controversa from similar pathogenic fungi has been successfully developed based on the use of a SCAR marker.     

Molecular detection of a bacterial contaminant Bacillus pumilus in symptomless potato plant tissue cultures

An aberrant random amplified polymorphic DNA (RAPD) marker in genomic DNA of tissue culture plantlets was frequently observed during a comparison of DNA fingerprints derived from potato germplasm grown in tissue culture and the field. The RAPD marker was cloned, sequenced and determined to be of bacterial origin. A bacterial contaminant was isolated from the tissue culture plants and identified as a Bacillus pumilus. A set of sequence characterised amplified region (SCAR) primers were designed from the sequence of the cloned fragment and tested for the specific detection of B. pumilus. Polymerase chain reaction-restriction fragment length polymorphisms (PCR-RFLPs) were also used to generate B. pumilus profiles specific to our isolate in order to test and confirm the sequence homology of amplified markers generated from a range of DNA samples isolated from tissue culture plants and pure isolates of B. pumilus-like bacteria.     

Development of a sequence‐characterized amplified region marker using inter‐simple sequence repeats for detection of Puccinia striiformis f. sp. tritici

Stripe rust, caused by Puccinia striiformis f. sp. tritici (Pst), is the most devastating wheat disease in China. Early and accurate detection of the pathogens would facilitate effective control of the diseases. DNA‐based methods now provide essential tools for accurate plant disease diagnosis. In this study, inter‐simple sequence repeats (ISSR) technique has been successfully applied to develop a sequence‐characterized amplified region (SCAR) marker for diagnosis of stripe rust of wheat and detection of Pst. In this study, one fragment unique to Pst was identified by ISSR and then sequenced. Based on the specific fragment, a pair of SCAR primers (616AF/616AR) was designed to amplify a 299‐bp DNA fragment within the sequenced region. The primers can amplify a unique DNA fragment for all tested isolates of Pst but not for the other pathogens of wheat leaves and the uninfected leaves. The polymerase chain reaction (PCR) assay could detect as low as 0.1 ng of genomic DNA in a 25.0 μl PCR reaction mixture and detect the pathogen from asymptomatic wheat leaves inoculated with Pst under glasshouse conditions.     

Development of a specific PCR assay for the detection of Rhizoctonia solani AG 1-IB using SCAR primers

AIMS: The aim of this study was to develop a specific and sensitive identification method for Rhizoctonia solani AG 1-IB isolates based on phylogenetic relationships of R. solani AG-1 subgroups using rDNA-internal transcribed spacer (rDNA-ITS) sequence analysis. METHODS AND RESULTS: A neighbour-joining tree analysis of 40 rDNA-ITS sequences demonstrated that R. solani AG-1 isolates cluster separately in six subgroups IA, IB, IC, ID, IE and IF. A molecular marker was generated from a random amplified polymorphic DNA fragment (RAPD). After conversion into a sequence-characterized amplified region (SCAR), a specific primer set for identification of subgroup AG 1-IB was designed for use in a polymerase chain reaction (PCR). The primer pair amplified a single DNA product of 324 bp. CONCLUSIONS: R. solani AG-1 subgroups were discriminated by sequence analysis of the ITS region. The designed SCAR primer pair allowed an unequivocal and rapid detection of R. solani AG 1-IB in plant and soil samples. SIGNIFICANCE AND IMPACT OF THE STUDY: Sequence analysis of the rDNA-ITS region can be used for differentiation of subgroups within AG-1. The use of the developed SCAR primer set allowed a reliable and fast identification of R. solani AG 1-IB and provides a powerful tool for disease diagnosis.