N.m.r. imaging of intact biological systems

Internal images of structured objects may be obtained with n.m.r. by labelling component parts with different magnetic field strengths and therefore recognizably different n.m.r. frequencies. A linear field gradient generates a one-dimensional projection of nuclear density and a variety of techniques are employed to manipulate this one-dimensional probe to yield internal images in two and three dimensions. In the past few years, n.m.r. imaging, sometimes also called zeugmatography or spin mapping, has been applied progressively to provide proton images of small phantoms, fruit, vegetables and small animals, and finally to in vivo imaging of the human body; it promises to provide a valuable means of interior investigation of intact biological systems generally. For medical imaging the method is non-invasive, does not use ionizing radiations, appears to be without hazard and penetrates bony cavities without attenuation. Furthermore, other n.m.r. parameters, for example, relaxation times and fluid flow, may also be mapped; there is evidence that the relaxation times from tumours are significantly longer than those from corresponding normal tissue. Effort to date has mostly been concentrated on proton n.m.r., but some work has been done with other nuclei. Three examples are shown of n.m.r. images of intact biological systems: a fruit, an animal and a human system. The discussion includes the quantitative nature of the images, tissue discrimination, the relation between the resolution in the image and image acquisition time, attenuation and phase shift of the r.f. field in the biological tissue, and magnets suitable for n.m.r. imaging. In principle, all conventional n.m.r. techniques can be combined with n.m.r. methods in order to investigate heterogeneous systems. Overhauser imaging is briefly discussed.     

N.m.r. studies of metabolism in perfused organs

Several metabolites and intracellular pH in intact organs can be studied in a non-destructive manner by phorphorus nuclear magnetic resonance (31P n.m.r.). This possibility was demonstrated by us nearly five years ago. Since then we have developed the appropriate physiological techniques and improved the n.m.r. method for the study of animal hearts and kidneys. Here we described measurements aimed at clarifying three problesm. (1) Having measured the enzyme-catalysed fluxes between phosphocreatine and ATP by the method of saturation transfer n.m.r., we examine the relations between energy supply and heart rate in the isolated perfused rat heart. (2) We describe experiments to establish the validity of the perfusion model. For the first time, we report 31P n.m.r. measurements of an in vivo rat heart and compare the results with those obtained for the perfused rat heart. (3) Ischaemia and metabolism in rabbit kidneys is investigated to establish the relation between functional and metabolic recovery after a renal transplant operation.     

N.m.r. relaxation and images of human breast tumours in vitro

It is found that fat and non-fatty tissue in dissected samples of the mamma differ in their T1/T2 ratios. This opens the possibility of locating tumours by n.m.r. imaging, because they have a lower fat content than their surroundings. By means of a sensitive point method, samples were scanned with a resolution of about 0.4 mm X 0.4 mm. The similarity between the shape of a tumour in an n.m.r. and in an X-ray image of a thin section of mamma tissue is quite convincing.     

N.m.r studies of internal mobility in a cyclic tetrapeptide

The conformation of cyclo(D-Phe-D-Pro-Ala-Pro) is reported. Measurements of spin-lattice relaxation in the rotating frame indicate that this peptide is conformationally less mobile on the microsecond time scale than larger cyclic peptides previously studied. Libration of the Pro-Ala and Pro-Phe peptide bond planes is suggested as the source of the small exchange contributions to 1/T1p.     

N.m.r. studies of cycloamylose inclusion-complexes with p-substituted phenols

Aqueous solutions of inclusion complexes of host cyclomaltohexa- and cyclomaltohepta-ose (cyclohexa- and cyclohepta-amylose) with guest phenols p-substituted with Br, Cl, CN, NO₂, CH₃, CHO, and COOH have been studied by ¹H- and ¹³C-n.m.r. spectroscopy. The stability of the complexes depends on the guests, the cycloamyloses, and the ionisation states of the host hydroxyl groups. The ¹H data for the host protons in the complexes show that the guests are more deeply inserted into the cavity of cyclomaltoheptaose than into that of cyclomaltohexaose.     

N.m.r. spectroscopy: A non-invasive tool for studying intracellular processes

The development of nuclear magnetic resonance (n.m.r.) spectroscopy as a non-invasive, non-destructive tool for the study of metabolic processes in cells and tissues is reviewed. Although n.m.r. measurements are subject to some limitations, e.g. low sensitivity and the need for special probes for in vivo work, the quality of n.m.r. instruments is steadily improving and wide bore spectrometers have been introduced. The article reviews in vivo n.m.r. studies of suspended and immobilized cells and also gives examples of the use of solid state n.m.r. Plant cell suspensions and tissues are good systems for study by n.m.r. as the P_i resonances from different compartments in the cell can be easily identified, and are important indicators of cellular metabolism. The literature on the use of magnetization transfer and on techniques for the study of enzyme catalysed reactions is also reviewed. Future applications of n.m.r. in examining biotechnological processes are discussed.     

N.m.r. and e.p.r. characterization of [4-carboxy-2,6-dinitrophenyl-lysine]cytochromes c.

Monosubstituted [4-carboxy-2,6-dinitrophenyl-lysine]cytochromes c were investigated by n.m.r. and e.p.r. Modification of Lys-13 or Lys-72 in ferricytochrome c by 4-chloro-3,5-dinitrobenzoate yields either of two different conformers that are rapidly exchanging in the native form. The equilibrium involves small local changes in the conformation of Met-80 (the sixth ligand) and Phe-82, as a result of whether Lys-13 is the 'on' or 'off' position in the Lys-13--Glu-90 salt bridge.     

N.m.r. investigation of hapten binding to the myeloma protein M460

The binding of the haptens DnpOH, Dnp-lysine and Dnp-aspartate to the mouse myeloma IgA protein was studied using ¹H 270 MHz nuclear magnetic resonance spectroscopy. The n.m.r. difference spectra showed fewer resonance perturbed than expected. This is explained in terms of chemical exchange between the T and R states of the protein as described by the kinetic scheme of Lancet and Pecht (Lancet, D. and Pecht, I. Proc. Natl Acad. Sci. USA 1976, 73 3549 53). Large upfield chemical shifts were observed on the resonances of the hapten DnpOH on binding to M460. These are interpreted as indicating an aromatic environment for the Dnp ring. In contrast, the Dnp-aspartate resonances were not shifted at all, as would be expected from the observed rate constants using the kinetic scheme. The shifts observed on the hapten Dnp-lysine were much smaller than those observed for DnpOH. A range of possible values of the shifts were calculated for the T and R states, for Dnp-lysine and DnpOH. For both haptens the combining site environment differed between the T and R conformational states of M460, suggesting that the conformational change involves the combining site.     

N.m.r. studies of synergistic kappa carrageenan—carob galactomannan gels

¹³C-n.m.r. spectroscopy has been used to investigate the carob galactomannan—kappa carrageenan binary gels. Starting from partially depolymerized carob samples, evidence for interaction and intermolecular binding was found by analysis of the spectra obtained in quantitative conditions and in the absolute intensity mode. From these, a reconstitution of the signals corresponding to C-1, C-4, C-5 and C-6 showed the existence of three kinds of galactomannan chains: the first ones with a low galactose content were strongly connected and as much had completely lost their mobility; but the chains with a high galactose content were still detected and could be divided in two groups according to their mobility.     

Glucosamine oligomers: 2. N.m.r. studies on a DP3.

This paper concerns the characterization of the chemical structure of a DP3 glucosamine oligomer. The assignments of nearly all protons are reported. Variations of 1H chemical shifts with pD and temperature are correlated to the pKa of amino groups, and not with substantial conformational changes.     

N.m.r. study of interaction between sugar and peptide moieties in mucin-type model glycopeptides.

In order to investigate the structural properties of the sugar and peptide linkage region in glycoprotein, some glycopeptides were synthesized as a model for AFGP (antifreeze glycoprotein), which is one of the mucin-type glycoproteins. The results from n.m.r. measurements in DMSO and aqueous conditions revealed that the glycopeptides form an intramolecular hydrogen bond between the amide proton of N-acetylgalactosamine (GalNAc) and the carbonyl oxygen of threonine (Thr) to which the GalNAc is covalently linked. This intramolecular hydrogen bond may play an important role in determining the orientation of the sugar moiety relative to the protein backbone. The roles for the activity of the proline (Pro) residue in AFGP were also discussed.     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.     

N.m.r. study of conformational changes in lysozyme around the thermal transition point

Natural abundance carbon-13 n.m.r. at 50.3 MHz has been used to further document the thermal transition that hen egg-white lysozyme undergoes in solution between 20 degrees and 30 degrees. The study focuses on the temperature sensitivity of more than 50 carboxylic, aromatic and aliphatic single carbon resonances for which unambiguous assignments to specific residues are known. The analysis of selective perturbations in chemical shifts indicates that residues located on both edges of the active site cleft and in the hydrophobic box are primarily involved in the temperature-induced conformational transition. N.m.r. results are compared with crystallographic data on low temperature (form A) and high temperature (form B) interconverting lysozyme crystals, taking advantage of the recent availability of quality high resolution maps for B form orthorhombic crystals. In most cases, a good correlation is found at the atomic level between residues involved in the thermal transition in solution and in the crystalline state. Discrete discrepancies are noted for some residues such as Trp-62 and His-15.     

N.m.r. analyses of the histidine microenvironments in a human salivary proline-rich glycoprotein

The pKa's of the three histidine residues in a proline-rich glycoprotein from human parotid saliva (PRG) were determined by 360 MHz proton n.m.r. spectroscopy. The addition of calcium (0.64 mM) caused drops in the pKa's of all three histidines by approximately 0.25 units. When imidazole and cyclo)L-histidine-L-proline) were used as model compounds, corresponding concentrations of calcium had no effect on their pKa's. Also, the model compounds gave absolute pKa values in good agreement with similar chemical species reported in the literature. Exchange lifetime data and previously reported hydrogen----deuterium exchange experiments suggest that the PRG histidine N tau H protons are not involved in hydrogen-bonds. Collectively, these data imply that changes in PRG conformation occur upon the addition of calcium.