Influence of an arbuscular mycorrhizal fungus on Pseudomonas fluorescens DF57 in rhizosphere and hyphosphere soil

The influence of Glomus intraradices (BEG87) on Pseudomonas fluorescens DF57 in hyphosphere and rhizosphere soil was examined. Cucumis sativus (Aminex, F₁ hybrid) was grown in symbiosis with the arbuscular mycorrhizal fungus G. intraradices in PVC tubes, consisting of a central root compartment and two lateral root-free compartments. Two Tn 5 - lux AB-marked strains of P. fluorescens DF57 were used. Strain DF57-P2, which has an insertion of Tn 5::lux AB in a phosphate starvation-inducible locus, was used as a phosphate starvation reporter. Another lux -tagged strain DF57-40E7, which carries a constitutively expressed lux AB fusion, was used as control for strain DF57-P2 and for measuring the metabolic activity of P. fluorescens DF57. A strain of P. fluorescens DF57, which carries a constitutively expressed gfp gene, was used in studies of attachment between the bacteria and the hyphae. G. intraradices decreased the culturability of P. fluorescens DF57 significantly, both in rhizosphere and hyphosphere soil, whereas the total number of P. fluorescens DF57 measured by immunofluorescence microscopy was decreased in hyphosphere soil only. G. intraradices did not induce a phosphorus starvation response in P. fluorescens DF57, and the metabolic activity of the bacteria was not affected by the fungus after 48 h. P. fluorescens DF57 did not attach to G. intraradices hyphae and was not able to use the hyphae as carbon substrate. The negative effect of G. intraradices on culturability and on number of P. fluorescens DF57 in hyphosphere soil is discussed.     

Effect of cell density and attachment on resuscitation in soil of starved Pseudomonas fluorescens MON787

The effect of cell density and attachment on starvation survival and recovery was determined using luminometry to measure activity of a lux -marked strain of Pseudomonas fluorescens MON787. Bioluminescence was found to be a sensitive indicator of in situ activity of P. fluorescens MON787 in soil. The activity of a bacterial inoculum could be monitored during growth in soil, and was found to correlate with an increase in cell numbers. Luminescence could detect decreasing activity of P. fluorescens during starvation in soil, and recovery of activity and cell numbers following exposure to starvation and matric potential stress. The effect of localised cell density and attachment in soil on recovery from lag phase after nutrient addition was investigated and compared to recovery of starved liquid cultures. Nutrient addition to starved P. fluorescens in soil or liquid medium resulted in an immediate recovery of activity, followed by a second increase in luminescence after 5 h. Cells exposed to both starvation and matric potential stress in soil did not show a detectable immediate increase of activity, but required a 5-h lag phase before recovery of both activity and cell growth. The lag phase values were not significantly different over a range of localised cell densities. This suggests that cell density of P. fluorescens in the range tested is not a factor which affects recovery of soil bacteria from starvation.     

Quantification of Target Molecules Needed To Detect Microorganisms by Fluorescence In Situ Hybridization (FISH) and Catalyzed Reporter Deposition-FISH

Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes is a method that is widely used to detect and quantify microorganisms in environmental samples and medical specimens by fluorescence microscopy. Difficulties with FISH arise if the rRNA content of the probe target organisms is low, causing dim fluorescence signals that are not detectable against the background fluorescence. This limitation is ameliorated by technical modifications such as catalyzed reporter deposition (CARD)-FISH, but the minimal numbers of rRNA copies needed to obtain a visible signal of a microbial cell after FISH or CARD-FISH have not been determined previously. In this study, a novel competitive FISH approach was developed and used to determine, based on a thermodynamic model of probe competition, the numbers of 16S rRNA copies per cell required to detect bacteria by FISH and CARD-FISH with oligonucleotide probes in mixed pure cultures and in activated sludge. The detection limits of conventional FISH with Cy3-labeled probe EUB338-I were found to be 370 ± 45 16S rRNA molecules per cell for Escherichia coli hybridized on glass microscope slides and 1,400 ± 170 16S rRNA copies per E. coli cell in activated sludge. For CARD-FISH the values ranged from 8.9 ± 1.5 to 14 ± 2 and from 36 ± 6 to 54 ± 7 16S rRNA molecules per cell, respectively, indicating that the sensitivity of CARD-FISH was 26- to 41-fold higher than that of conventional FISH. These results suggest that optimized FISH protocols using oligonucleotide probes could be suitable for more recent applications of FISH (for example, to detect mRNA in situ in microbial cells).     

Monitoring of Bacillus thermodenitrificans OHT-1 in compost by whole cell hybridization

Thermophilic aerobic composting is a widely practiced method for the disposal of exhaust materials. We isolated a thermophilic bacteria strain from a compost sample under aerobic conditions at 60 degrees C. On the basis of its 16S rRNA sequence and physiological characteristics, this strain was identified as Bacillus thermodenitrificans OHT-1. An 18-subunit oligonucleotide probe for 16S rRNA, labeled with fluorescein isothiocyanate, was developed for the detection of B. thermodenitrificans. Spores and vegetative cells of B. thermodenitrificans OHT-1 were detected in liquid culture and laboratory compost by whole cell hybridization using this oligonucleotide probe. The results obtained by whole cell hybridization were evaluated in growth experiments of B. thermodenitrificans OHT-1 in laboratory compost and were used to enumerate spores and vegetative cells.     

Cyanide production by Pseudomonas fluorescens and Pseudomonas aeruginosa.

Of 200 water isolates screened, five strains of Pseudomonas fluorescens and one strain of Pseudomonas aeruginosa were cyanogenic. Maximum cyanogenesis by two strains of P. fluorescens in a defined growth medium occurred at 25 to 30 degrees C over a pH range of 6.6 to 8.9. Cyanide production per cell was optimum at 300 mM phosphate. A linear relationship was observed between cyanogenesis and the log of iron concentration over a range of 3 to 300 microM. The maximum rate of cyanide production occurred during the transition from exponential to stationary growth phase. Radioactive tracer experiments with [1-14C]glycine and [2-14C]glycine demonstrated that the cyanide carbon originates from the number 2 carbon of glycine for both P. fluorescens and P. aeruginosa. Cyanide production was not observed in raw industrial wastewater or in sterile wastewater inoculated with pure cultures of cyanogenic Pseudomonas strains. Cyanide was produced when wastewater was amended by the addition of components of the defined growth medium.     

DETECTION OF THE TOXIC DINOFLAGELLATE ALEXANDRIUM FUNDYENSE (DINOPHYCEAE) WITH OLIGONUCLEOTIDE AND ANTIBODY PROBES: VARIABILITY IN LABELING INTENSITY WITH PHYSIOLOGICAL CONDITION

The toxic dinoflagellate Alexandrium fundyense Balech was grown under temperature- and nutrient-limited conditions, and changes in labeling intensity on intact cells were determined for two probe types: an oligonucleotide probe targeting rRNA and a monoclonal antibody (MAb) targeting a cell surface protein. In nutrient-replete batch culture, labeling with the rRNA probe was up to 400% brighter during exponential phase than during stationary phase, whereas MAb labeling did not change significantly with growth stage at the optimal growth temperature. In cultures grown at suboptimal, low temperatures, there was a significant difference between labeling intensity in stationary versus exponential phase for both probe types, with exponential cells labeling brighter with the rRNA probe and slightly weaker with the MAb. The decrease in rRNA probe labeling with increasing culture age was likely due to lower abundance of the target nucleic acid, as extracted RNA varied in a similar manner. With the MAb and the rRNA probes, slower growing cultures at low, nonoptimal temperature labeled 35% and 50% brighter than cells growing faster at warmer temperatures. Some differences in labeling intensity per cell disappeared when the data were normalized to surface area or volume, which indicated that the number of target antigens or rRNA molecules was relatively constant per unit area or volume, respectively. Slow growth accompanying phosphorus and nitrogen limitation resulted in up to a 400% decrease in labeling intensity with the rRNA probe compared to nutrient-replete levels, whereas the MAb labeling intensity increased by a maximum of 60%. With both probes, labeling was more intense under phosphorus limitation than under nitrogen limitation, and for all conditions tested, labeling intensity was from 600% to 3600% brighter with the MAb than with the rRNA probe. Thus, it is clear that significant levels of variability in labeling intensity can be expected with both probe types because of the influence of environmental conditions and growth stage on cellular biochemistry, cell size,rRNA levels, and the number or accessibility of cell surface proteins. Of the two probes tested, the rRNA probe was the most variable, suggesting that in automated, whole-cell assays, it can be used only in a semiquantitative manner. For manual counts, the human eye will likely accommodate the labeling differences. The MAb probe was less variable, and thus should be amenable to both manual and automated counts.     

Detection of recombinant Pseudomonas putida in the wheat rhizosphere by fluorescence in situ hybridization targeting mRNA and rRNA

A method was developed to detect a specific strain of bacteria in wheat root rhizoplane using fluorescence in situ hybridization and confocal microscopy. Probes targeting both 23S rRNA and messenger RNA were used simultaneously to achieve detection of recombinant Pseudomonas putida (TOM20) expressing toluene o-monooxygenase (tom) genes and synthetic phytochelatin (EC20). The probe specific to P. putida 23S rRNA sequences was labeled with Cy3 fluor, and the probe specific to the tom genes was labeled with Alexa647 fluor. Probe specificity was first determined, and hybridization temperature was optimized using three rhizosphere bacteria pure cultures as controls, along with the P. putida TOM20 strain. The probes were highly specific to the respective targets, with minimal non-specific binding. The recombinant strain was inoculated into wheat seedling rhizosphere. Colonization of P. putida TOM20 was confirmed by extraction of root biofilm and growth of colonies on selective agar medium. Confocal microscopy of hybridized root biofilm detected P. putida TOM20 cells emitting both Cy3 and Alexa647 fluorescence signals.     

Optimising single cell activity assessment of Lactobacillus plantarum by fluorescent in situ hybridisation as affected by growth

Fluorescent in situ hybridisation (FISH) with a 16S ribosomal RNA (rRNA)-targeted oligonucleotide probe, Eub338, could be used to estimate the in situ activity of Lactobacillus plantarum WCFS1 in exponentially growing cells. However, L. plantarum is capable of growth to very high cell densities, and the properties of the L. plantarum cell envelope prevented effective entry of the fluorescent oligonucleotide probe into the cells at later stages of growth at high cell densities. Total rRNA measurements of cells isolated at different growth stages showed maximal amounts of RNA (8.77+/-0.8 fg) per cell at the early stationary phase and confirmed the effectiveness of FISH for accurate activity measurement in exponentially growing cells.     

High survival efficiency and ribosomal RNA decaying pattern of Desulfobacter latus, a highly specific acetate-utilizing organism, during starvation

Abstract: Exponentially grown Desulfobacter latus cells were transferred to anaerobically prepared minimum medium without a carbon or energy substrate and incubated under anaerobic conditions. Changes in 16S ribosomal RNA (rRNA) of individual cells and the viable fraction in a population were monitored. The cell preparation was stained with a phylogenetic DNA probe labelled with fluorescent dye and the fluorescence of each cell was determined with confocal scanning laser microscope. Viable cells were defined as those capable of reducing a tetrazolium salt (the INT method [1]). The viability of a Desulfobacter starvation culture decreased to 85% in 48 h, but further decrease was not observed during prolonged starvation. The mean amount of 16S rRNA in individual cells decreased exponentially for 48 h to 30% the mean value obtained for exponentially growing cells, but did not decrease by prolonged starvation. About 30% of the mean content of 16S rRNA in growing cells was found in the starved cell population, suggesting that most individual cells in the starved population were not metabolically active. The difference between gross pixel intensity of cells having <8% of 16S rRNA in growing cells and those with a negative control probe was not significant. Thus, non-viable cells may not show positive signals by phylogenetic staining.     

Activity and three-dimensional distribution of toluene-degrading Pseudomonas putida in a multispecies biofilm assessed by quantitative in situ hybridization and scanning confocal laser microscopy.

As a representative member of the toluene-degrading population in a biofilter for waste gas treatment, Pseudomonas putida was investigated with a 16S rRNA targeting probe. The three-dimensional distribution of P. putida was visualized in the biofilm matrix by scanning confocal laser microscopy, demonstrating that P. putida was present throughout the biofilm. Acridine orange staining revealed a very heterogeneous structure of the fully hydrated biofilm, with cell-free channels extending from the surface into the biofilm. This indicated that toluene may penetrate to deeper layers of the biofilm, and consequently P. putida may be actively degrading toluene in all regions of the biofilm. Furthermore, measurements of growth rate-related parameters for P. putida showed reduced rRNA content and cell size (relative to that in a batch culture), indicating that the P. putida population was not degrading toluene at a maximal rate in the biofilm environment. Assuming that the rRNA content reflected the cellular activity, a lower toluene degradation rate for P. putida present in the biofilm could be estimated. This calculation indicated that P. putida was responsible for a significant part (65%) of the toluene degraded by the entire community.     

Soil bacterial DNA and biovolume profiles measured by flow-cytometry

Abstract Flow-cytometry was used to measure cell volumes and DNA contents of single cells in cultures of soil bacteria during exponential growth and starvation conditions. DNA was measured after staining with mitramycin/ethidium bromide. The measurement of DNA was calibrated with rifampicin-treated cells of E. coli containing even numbers of genomes per cell. Cell volumes were assessed by scatter light measurements. Constant DNA to biovolume relations over a range of cell sizes were found for each of the bacteria at exponential growth, and DNA contents per cell varied over a range equivalent to 1–4 genomes per cell. At generation times of 1.0–1.5 h, two genomes were registered as a mean. After starvation of washed cells in a salt solution (24 hrs), a fraction of the cells in each culture had DNA contents equivalent to 1 genome, but significant fractions retained DNA contents equivalent to 2–4 genomes. Attempts to create cells with even numbers of genomes per cell by treatment with rifampicin was successful on an Acinetobacter sp. In contrast, the response to rifampicin was less clear for Pseudomonas fluorescens and P. chlororaphis , and unclear for the gram positive bacteria isolated from soil. The mean decrease in biovolume upon starvation was 4.1 times (range 1.3–8.1 times) and larger than the mean decrease in DNA content of 1.8 (range 1.3–2.7 times). Cell volume determinations by measurements of scatter light was compared with volume determinations by fluorescence microscopy. The amounts of scatter light per volumes was variable, not only did we find large differences between bacterial types, but also between starving and exponentially growing cells of the same isolate. In order to use light scatter as a measure of biovolume, internal standards has to be chosen of comparable size and surface properties as to soil bacteria.     

Viscosinamide, a new cyclic depsipeptide with surfactant and antifungal properties produced by Pseudomonas fluorescens DR54

Pseudomonas fluorescens DR54 showed antagonistic properties against plant pathogenic Pythium ultimum and Rhizoctonia solani both in vitro and in planta. Antifungal activity was extractable from spent growth media, and fractionation by semi-preparative HPLC resulted in isolation of an active compound, which was identified as a new bacterial cyclic lipodepsipeptide, viscosinamide, using 1D and 2D 1H-, 13C-NMR and mass spectrometry. The new antibiotic has biosurfactant properties but differs from the known biosurfactant, viscosin, by containing glutamine rather than glutamate at the amino acid position 2 (AA2). No viscosin production was observed, however, when Ps. fluorescens DR54 was cultured in media enriched with glutamate. In vitro tests showed that purified viscosinamide also reduced fungal growth and aerial mycelium development of both P. ultimum and R. solani. Viscosinamide production by Ps. fluorescens DR54 was tightly coupled to cell proliferation in the batch cultures, as the viscosinamide produced per cell mass unit approached a constant value. In batch cultures with variable initial C, N or P nutrient levels, there were no indications of elevated viscosinamide production during starvation or maintenance of the cultures in stationary phase. Analysis of cellular fractions and spent growth media showed that a major fraction of the viscosinamide produced remained bound to the cell membrane of Ps. fluorescens DR54. The isolation, determination of structure and production characteristics of the new compound with both biosurfactant and antibiotic properties have promising perspectives for the application of Ps. fluorescens DR54 in biological control.     

Growth Rate Regulation of rRNA Content of a Marine Synechococcus (Cyanobacterium) Strain

The relationship between growth rate and rRNA content in a marine Synechococcus strain was examined. A combination of flow cytometry and whole-cell hybridization with fluorescently labeled 16S rRNA-targeted oligonucleotide probes was used to measure the rRNA content of Synechococcus strain WH8101 cells grown at a range of light-limited growth rates. The sensitivity of this approach was sufficient for the analysis of rRNA even in very slowly growing Synechococcus cells (μ = 0.15 day⁻¹). The relationship between growth rate and cellular rRNA content comprised three phases: (i) at low growth rates (<~0.7 day⁻¹), rRNA cell⁻¹ remained approximately constant; (ii) at intermediate rates (~0.7 − 1.6 day⁻¹), rRNA cell⁻¹ increased proportionally with growth rate; and (iii) at the highest, light-saturated rates (>~1.6 day⁻¹), rRNA cell⁻¹ dropped abruptly. Total cellular RNA (as measured with the nucleic acid stain SYBR Green II) was well correlated with the probe-based measure of rRNA and varied in a similar manner with growth rate. Mean cell volume and rRNA concentration (amount of rRNA per cubic micrometer) were related to growth rate in a manner similar to rRNA cell⁻¹, although the overall magnitude of change in both cases was reduced. These patterns are hypothesized to reflect an approximately linear increase in ribosome efficiency with increasing growth rate, which is consistent with the prevailing prokaryotic model at low growth rates. Taken together, these results support the notion that measurements of cellular rRNA content might be useful for estimating in situ growth rates in natural Synechococcus populations.     

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.     

Rapid detection of rRNA group I pseudomonads in contaminated metalworking fluids and biofilm formation by fluorescent in situ hybridization

Metalworking fluids (MWFs), used in different machining operations, are highly prone to microbial degradation. Microbial communities present in MWFs lead to biofilm formation in the MWF systems, which act as a continuous source of contamination. Species of rRNA group I Pseudomonas dominate in contaminated MWFs. However, their actual distribution is typically underestimated when using standard culturing techniques as most fail to grow on the commonly used Pseudomonas Isolation Agar. To overcome this, fluorescent in situ hybridization (FISH) was used to study their abundance along with biofilm formation by two species recovered from MWFs, Pseudomonas fluorescens MWF-1 and the newly described Pseudomonas oleovorans subsp. lubricantis. Based on 16S rRNA sequences, a unique fluorescent molecular probe (Pseudo120) was designed targeting a conserved signature sequence common to all rRNA group I Pseudomonas. The specificity of the probe was evaluated using hybridization experiments with whole cells of different Pseudomonas species. The probe's sensitivity was determined to be 10(3) cells/ml. It successfully detected and enumerated the abundance and distribution of Pseudomonas indicating levels between 3.2 (± 1.1) × 10(6) and 5.0 (± 2.3) × 10(6) cells/ml in four different industrial MWF samples collected from three different locations. Biofilm formation was visualized under stagnant conditions using high and low concentrations of cells for both P. fluorescens MWF-1 and P. oleovorans subsp. lubricantis stained with methylene blue and Pseudo120. On the basis of these observations, this molecular probe can be successfully be used in the management of MWF systems to monitor the levels and biofilm formation of rRNA group I pseudomonads.     

Phylogenetic relationships between environmental and clinical isolates of Pseudomonas fluorescens and related species deduced from 16S rRNA gene and OprF protein sequences

The major surface protein of the genus Pseudomonas, OprF, is a non-specific porin that plays an important role in maintenance of cell shape, in growth in a low osmolarity environment, and in adhesion to various supports. The objectives of our study were (i) to carry out a comparative analysis of phylogenies obtained from the OprF protein and from the 16S rRNA gene in 41 isolates from various sources (water, soil, milk and the hospital) and (ii) to investigate the physiological characteristics correlated with the phylogeny of OprF. We report here an important incongruence between the phylogenies of the 16S rRNA gene and the OprF protein. Phylogenetic analysis of 16S rRNA genes grouped Pseudomonas fluorescens isolates into one cluster (termed fluorescens r-cluster) whilst the phylogeny of the OprF protein divided Pseudomonas fluorescens isolates into two quite distinct clusters (termed fluorescens 1 o-cluster and fluorescens 2 o-cluster) that may be related to the original habitat of the strain. The fluorescens 1 o-cluster contained the majority of non-rhizospheric soil isolates, while the fluorescens 2 o-cluster contained all our clinical isolates and most of the rhizospheric isolates (which are fixed to the roots). In order to check this correlation, we studied two physiological characteristics: the range of growth temperature and the capacity for non-specific adhesion to polystyrene. The temperature range study for strains did not explain the existence of the two o-clusters but it did confirm the capacity of certain P. fluorescens strains to grow at 37 degrees C. The adhesion capacities of the isolates in the two o-clusters seems to be correlated with ecological niche.     

Adenylylation state of glutamine synthetase and permeability properties of Pseudomonas fluorescens

The state of adenylylation, n, of glutamine synthetase (GS) in Pseudomonas fluorescens has been determined as a function of growth conditions. Compared to the behavior of Escherichia coli, atypical responses to either carbon or nitrogen starvation were observed when P. fluorescens was grown with either succinate, malate, or fumarate as the sole source of carbon and energy. Under conditions of carbon starvation (high NH4+, low dicarboxylic acid substrate), the value of n falls rapidly from 10 to 1.0 during prolonged incubation in the stationary phase, whereas the value of n is unexpectedly high (ca. 10) in extracts of nitrogen-starved cells. These abnormal responses are attributable to particular permeability properties of P. fluorescens cells compared to E. coli. The unusual changes in nitrogen-starved cells are related to the release of alpha-ketoglutarate by such cells during incubation or washing procedures. These changes can be prevented by the addition of cetyltrimethylammonium bromide (CTAB) to the cultures 5 min prior to harvesting the cells, or by freezing the cell pellets just after centrifugation and sonication within 3 min of suspension in buffer, or by suspending freshly harvested cells in buffer containing alpha-ketoglutarate and orthophosphate (i.e., effectors that favor deadenylylation of glutamine synthetase). The abnormal changes which occur during carbon starvation in the presence of excess NH4+ can be prevented by addition of ATP and glutamine to the buffer in which the freshly harvested cells are suspended prior to sonication. The results suggest that during the stationary phase of growth on succinate, fumarate, or malate (but not on glucose), the cellular membrane becomes permeable to small molecules that regulate the adenylylation cascade, and indeed, it was observed that such whole cells expressed, without any chemical or physical treatment, more than 50% of the glutamine synthetase activity they contained. Such cells may be useful in studies to examine the effects of multiple metabolites on the regulation of glutamine synthetase adenylylation in situ.     

Effects of growth phase,diel cycle and macronutrient stress on the quantification of Heterosigma akashiwo using qPCR and SHA

The development of molecular probe technologies over the last several decades has enabled more rapid and specific identification and enumeration of phytoplankton species compared to traditional technologies, such as light microscopy. Direct comparisons of these methods with respect to physiological status, however, are sparse. Here we directly compare quantitative real-time PCR (qPCR) and sandwich hybridization assay (SHA) for enumerating the raphidophyte Heterosigma akashiwo at several points during its growth phase, over a diel cycle and with macronutrient stress in laboratory cultures. To ensure consistency between comparisons, a single cellular homogenate was generated from each culture and split for analysis by qPCR and SHA. Since the homogenate was generated from the same number of cells during each experiment, results reflect changes in nucleic acid content (rRNA and DNA) at each time point or in response to environmental conditions relative to a reference sample. Results show a greater level of precision in SHA results which contributed to significant (2–3 fold) differences in rRNA content per cell in several of these analyses. There was significantly greater rRNA content during lag and exponential phases compared to stationary phase cultures, and a significant decrease in rRNA content during the light cycle compared to cells harvested in the dark. In contrast, there were no significant differences in DNA content per cell as determined by qPCR over a diel cycle or during different growth phases. There was also no decrease in either rRNA or DNA content for cultures under low P conditions compared to nutrient replete conditions. However, both rRNA and DNA content were significantly lower under N stress when compared to nutrient replete conditions. Results of this study suggest that growth stage, nutrient stress and cell cycle may impact molecular analyses, and that physiological status should be taken into account when using these methods for HAB monitoring.     

Involvement of a rhamnolipid-producing strain of Pseudomonas aeruginosa in the degradation of polycyclic aromatic hydrocarbons by a bacterial community

A rhamnolipid-producing strain of Pseudomonas aeruginosa GL1 was isolated from a bacterial community growing on a mixture of polycyclic aromatic hydrocarbons (PAH) as sole carbon source. Strain GL1 did not grow on PAH but grew on known degradation metabolites of phenanthrene ( o -phthalic acid) and of naphthalene (salicylic acid). In co-culture with a phenanthrene-degrading strain, Ps. aeruginosa GL1 accelerated the degradation of phenanthrene. Strain GL1 was resistant to toxic amphiphilic compounds such as cationic and anionic detergents. Rhamnolipid production took place in a late stage growth in cultures of strain GL1 on glycerol or n -hexadecane. It coincided with a substantial decrease in cell hydrophobicity and with morphological changes of the outer membrane as observed by transmission electronic microscopy. The rhamnolipids produced inhibited the growth of bacteria such as Rhodococcus erythropolis , Bacillus cereus and Ps. fluorescens . The overall results suggested an outer membrane origin for the rhamnolipids. They also indicate that the utilization of PAH metabolites by strain GL1 is important for the stability of the PAH-degrading community.