The nucleotide sequence of the gene coding for the 16S rRNA from the archaebacterium Halobacterium halobium

The complete 1473-bp sequence of the 16S rRNA gene from the archaebacterium Halobacterium halobium has been determined. Alignment with the sequences of the 16S rRNA gene from the archaebacteria Halobacterium volcanii and Halococcus morrhua reveals similar degrees of homology, about 88%. Differences in the primary structures of H. halobium and eubacterial (Escherichia coli) 16S rRNA or eukaryotic (Dictyostelium discoideum) 18S rRNA are much higher, corresponding to 63% and 56% homology, respectively. A comparison of the nucleotide sequence of the H. halobium 16S rRNA with those of its archaebacterial counterparts generally confirms a secondary structure model of the RNA contained in the small subunit of the archaebacterial ribosome.     

Evidence for two different gas vesicle proteins and genes in Halobacterium halobium.

Most halobacteria produce gas vesicles (GV). The well-characterized species Halobacterium halobium and some GV+ revertants of GV- mutants of H. halobium produce large amounts of GV which have a spindlelike shape. Most other GV+ revertants of H. halobium GV- mutants and other recently characterized halobacterial wild-type strains possess GV with a cylindrical form. The number of intact particles in the latter isolates is only 10 to 30% of that of H. halobium. Analysis of GV envelope proteins (GVPs) by electrophoresis on phenol-acetic acid-urea gels showed that the GVP of the highly efficient GV-producing strains migrated faster than the GVP of the low-GV-producing strains. The relative molecular mass of the GVP was estimated to be 19 kilodaltons (kDa) for high-producing strains (GVP-A) and 20 kDa for low-producing strains (GVP-B). Amino acid sequence analysis of the first 40 amino acids of the N-terminal parts of GVP-A and GVP-B indicated that the two proteins differed in two defined positions. GVP-B, in relation to GVP-A, had Gly-7 and Val-28 always replaced by Ser-7 and Ile-28, respectively. These data suggest that at least two different gvp genes exist in H. halobium NRL. This was directly demonstrated by hybridization experiments with gvp-specific DNA probes. A fragment of plasmid pHH1 and a chromosomal fragment of H. halobium hybridized to the probes. Only a chromosomal fragment hybridized to the same gyp probes when both chromosomal and plasmid DNAs from the low-GV-producing halobacterial wild-type strains SB3 and GN101 were examined. These findings support the assumption that GVP-A is expressed by a pHH1-associated gvp gene and GVP-B by a chromosomal gvp gene.     

Molecular cloning and nucleotide sequence of the gene for the ribosomal protein S11 from the archaebacterium Halobacterium marismortui

The gene encoding ribosomal protein S11 (Escherichia coli S15 homologue) from Halobacterium marismortui was cloned employing two synthetic oligonucleotide mixtures, 23 and 32 bases in length, as hybridization probes. The nucleotide sequence of the gene and the adjacent 5'- and 3'-flanking regions (1300 base pairs) were then determined by the dideoxy chain termination method. Comparison of the nucleotide sequence of the H. marismortui S11 gene with that of the E. coli S15 gene (rpsO) showed that the 3'-end of the S11 gene can be aligned with the entire E. coli S15 gene, sharing 44% identical nucleotides. It has been found that the S11 gene has a higher G + C content (G + C = 65%) than that of the E. coli S15 gene (G + C = 53%). This increase in G + C content specifically shows up as a preference for G + C in the 3rd position of the codon. Upstream of the S11 gene, an archaebacterial promoter sequence (GGACTTTCA) and a putative ribosomal binding site (GCGGT) have been found, 88 and 15 (or 24) base pairs from the initiation codon of the gene. In addition, an open reading frame could be identified immediately after the stop codon for the S11 gene. Northern blotting analysis using the S11 coding region as probe has shown that the S11 gene is located on a 2.4-kilobase mRNA, suggesting that it is cotranscribed with other downstream gene(s).     

Extended secondary structure in 5S rRNAs from a sulphur metabolizing archaebacterium, Thermococcus celer

While this sequence shares a significant homology with the 5S RNAs of other archaebacteria and is consistent with current models for the secondary structure of 5S RNAs, it contains three unusual features. The G + C content (72-74%) is significantly higher than other 5S RNAs; the secondary structure is distinguished by unusually stable and extended helical structures and, most important, there is evidence for sequence heterogeneity in the form of complementary base substitutions and precursor processing. This supports recent evidence (Newmann, H., Gierl, A., Tu, J., Leibrock, J., Staiger, D. and Zillig, W. (1983) Mol. Gen. Genet. 192, 66-72) that, like many of the higher eukaryotes, this group of sulphur-metabolizing bacteria may contain multiple 5S RNA genes.     

Nucleotide sequence of Halobacterium cutirubrum ribosomal 5 S ribonucleic acid. An altered secondary structure in halophilic organisms

The nucleotide sequence of ribosomal 5 S RNA from a halophilic bacterium, Halobacterium cutirubrum, grown in 4 M sodium chloride is U-U-A-A-G-G-C-G-G-C-C-A-U-A-G-C-G-G-U-G-G-G-G-U-U-A-C-U-C-C-C-G-U-A-C-C-C-A-U-C-C-C-G-A-A-C-A-C-G-G-A-A-G-A-U-A-A-G-C-C-C-G-C-C-U-G-C-G-U-U-C-C-G-G-U-C-A-G-U-A-C-U-G-G-A-G-U-G-C-G-A-G-C-C-U-C-U-G-G-G-A-A-A-U-C-C-G-G-U-U-C-G-C-C-G-C-C-U-A-C-U. This nucleotide sequence is the longest prokaryotic 5 S rRNA to be reported and unlike other 5 S species does not contain a terminal mononucleoside diphosphate residue at its 5'-end. When compared to other 5 S rRNA's, the sequence homology is greatest (about 68%) with Bacillus subtilis; there is a lower but similar degree of homology (about 58%) with either Escherichia coli or human 5 S RNA. The comparisons further indicate that among 5 S RNA's, eleven of the nucleotide residues are unique to H. cutirubrum. Estimates of the secondary structure of the H. cutirubrum 5 S RNA molecule contain one additional stable hairpin loop which is not found in other 5 S rRNA species; this unusual structure is probably an adaptation to the high salt environment within H. cutirubrum cells.     

DNA sequence of the 16S rRNA/23S rRNA intercistronic spacer of two rDNA operons of the archaebacterium Methanococcus vannielii

The DNA sequence of the spacer (plus flanking) regions separating the 16S rRNA and 23S rRNA genes of two presumptive rDNA operons of the archaebacterium Methanococcus vannielii was determined. The spacers are 156 and 242 base pairs in size and they share a sequence homology of 49 base pairs following the 3' terminus of the 16S rRNA gene and of about 60 base pairs preceding the 5' end of the 23S rRNA gene. The 242 base pair spacer, in addition contains a sequence which can be transcribed into tRNAAla, whereas no tRNA-like secondary structure can be delineated from the 156 base pair spacer region. Almost complete sequence homology was detected between the end of the 16S rRNA gene and the 3' termini of either Escherichia coli or Halobacterium halobium 16S rRNA, whereas the putative 5' terminal 23S rRNA sequence shared partial homology with E. coli 23S rRNA and eukaryotic 5.8S rRNA.     

The primary structures of helices A to G of three new bacteriorhodopsin-like retinal proteins.

The primary structures of helices A to G of all bacteriorhodopsin (BR)-like retinal proteins identified in newly isolated halobacteria have been determined from the nucleotide sequence of the BR-like protein genes. Using PCR methods, gene fragments encoding the A- to G-helix region of BR-like proteins were directly amplified from the total genomic DNA of the seven new halobacterial strains. Oligonucleotide primers corresponding to highly conserved regions in the helices A to G were designed from the nucleotide sequences of bacterioopsin (bop) and archaeopsin-I (aop-I), and some primers were effective for the amplification of the gene encoding C- to G-helix region of all new BR-like proteins. The primer corresponding to A-helix region was designed either from the nucleotide sequence of bop and aop-I or from the N-terminus amino acid sequence of a BR-like protein. Three new BR-like proteins were identified from the amino acid sequence, which was deduced from the nucleotide sequence of the genes encoding A- to G-helix region of the BR-like proteins. It was found that not only the amino acid sequence, but also the nucleotide sequence of the gene encoding the C- and G-helix region, in which a number of important residues for proton translocation are located, is highly conserved in three new BR-like proteins. Analysis of the primary structures of the A- to G-helix region of new BR-like proteins revealed that one has about 85% homology with aR-I and aR-II, and the rest have about 55% homology with halobium BR, aR-I and aR-II.(ABSTRACT TRUNCATED AT 250 WORDS)     

The halo-opsin gene. I. Identification and isolation

Halorhodopsin (HR), the light-driven chloride pump in halobacteria, was purified in the denatured as well as in the native state and chemically cleaved into peptide fragments. Isolation of peptide and liquid phase sequencing yielded approximately 20% of the halo-opsin (HO) structure in non-overlapping peptides. Chemically synthesized oligodeoxynucleotides corresponding to a peptide sequence obtained from both HR preparations were used to screen a cosmid gene bank of Halobacterium halobium strain L-33. A positive clone contained cosmid pAB H47 which by subcloning and nucleotide sequencing was shown to encode at least part of the HO gene.     

The number, physical organization and transcription of ribosomal RNA cistrons in an archaebacterium: Halobacterium halobium.

Because it is now clear that archaebacteria may be as distinct from eubacteria as either group is from eukaryotic cells, and because a specifically archaebacterial ancestry has been proposed for the nuclear-cytoplasmic component of eukaryotic cells, we undertook to characterize, for the first time, the ribosomal RNA cistrons of an archaebacterium (Halobacterium halobium). We found these cistrons to be physically linked in the order 16S-23S-5S, and obtained evidence that they are also transcribed from a common promoter(s) in the order 5'-16S-23S-5S-3'. We showed that, although slightly larger immediate precursors of 16S and 23S are readily seen, no common precursor of both 16S and 23S can be easily detected in vivo. In all these respects the archaebacterium H. halobium is like a eubacterium and unlike the nuclear-cytoplasmic component of eukaryotic cells. We found, however, that it differs from eubacteria of comparable (large) genome size in having only one copy of the rRNA gene cluster per genome.     

The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8

Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.     

The nucleotide sequence of a cytoplasmic tRNAPhe from Scenedesmus obliquus and comparison with a tRNATyr species.

The nucleotide sequence of a cytoplasmic tRNAPhe from the eukaryotic green alga Scenedesmus obliquus was determined as: pG-G-C-U-U-G-A-U-A-m2G-C-U-C-A-G-C-D-Gm-G-G-A-G-A-G-C-m22G-p si-psi-A-G-A-Cm-U-G - A-A-m1G-A-psi-C-U-A-C-A-G-m7G-N-m5C-C-C-C-A-G-T-psi-C-G-m1A-U-m5C-Cm-U-G -G-G-U- C A-G-G-C-C-A-C-C-A-OH. The structure has some notable features. Unlike other tRNAPhe species from plant sources, it has an unmodified G as the first residue of the anticodon and m1G rather than a Y derivative as the residue following the anticodon. The sequence m5C(60)-Cm(61) is unique to this tRNA. The sequence of S. obliquus tRNAPhe shows close homology with S. obliquus tRNATyr.     

Nucleotide sequence and presumed secondary structure of the 28S rRNA of pea aphid implication for diversification of insect rRNA

Determination of the entire nucleotide sequence of the aphid 28S ribosomal RNA gene (28S rDNA) revealed that it is 4,147 by in length with a G + C content of 60.3%. Based on the nucleotide sequence, we constructed a presumed secondary-structure model of the aphid 28S rRNA which indicated that the aphid 28S rRNA is characterized by the length and high G + C content of its variable regions. The G + C content of the aphid's variable regions was much higher than that of the entire sequence of the 28S rRNA, which formed a striking contrast to those ofDrosophila with the G + C content much lower than the entire 28S molecule. In this respect, the aphid 28S rRNA somewhat resembled those of vertebrates. This is the third report of a complete large-subunit rRNA sequence from an arthropod, and the first 28S rRNA sequence for a nondipterous insect. Correspondence to: H. Ishikawa