Isolation and partial characterization of pyrenoids from the brown alga Pilayella littoralis (L.) Kjellm.

In order to isolate high yields of pyrenoids from the brown alga Pilayella littoralis it is necessary to pretreat them with 0.1% HgCl₂ in sea water for 3 h. Without this pretreatment there is a substantial loss of pyrenoid ground substance and yields are low. Pyrenoid fractions of high purity have been obtained using silica sol gradients. A partial characterization has shown the pyrenoid to be proteinaceous and lacking chlorophyll. SDS polyacrylamide gel electrophoresis has shown that the majority of protein present is accounted for by two polypeptides which resemble the large and small subunits of ribulose-1,5-bisphosphate carboxylase (EC 4.1.1.39).Abbreviations DTT dithiothreitol - HEPES N-2-hydroxyethylniperazine N¹-2-ethanesulfonic acid - PEG polyethylene glycol - PVPP polyvinylpolypyrrolidone - RuBP ribulose-1,5-bisphosphate - RuBPCase ribulose-1,5-bisphosphate carboxylase - SDS sodium dodecyl sulphate     

Protoplast isolation,development, and regeneration in different strains ofPilayella littoralis (L.) Kjellm. (Phaeophyceae)

Summary Using an antibody against tyrosinated tubulin and epifluorescence microscopy, mitosis was studied in three different microvessel endothelial cell types recently isolated from bovine corpus luteum. Dividing cells were flat and at certain stages individual microtubules could be followed for considerable lengths. The structure of the spindle apparatus and the course of mitosis were conventional. Microtubule asters were small from prophase until metaphase in all three cell types. However, whereas in two cell types telophase asters remained inconspicuous, prominent asters, of mostly straight microtubules, formed in telophase cells of a third cell type. Thus, aster size is heterogeneous between different endothelial cell types. Large microtubule asters are not regularly found in dividing cultured mammalian cells. The microendothelial cell types present themselves as appropriate systems for spindle research and especially for the study of aster microtubule dynamics and function.     

Evidence for a composite phylogenetic origin of the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm

The nucleotide sequence and the 5 flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase of Pylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and chemoautotrophic Eubacteria, of a red alga and of green plastids (Euglena gracilis, green algae and higher plants). Unlike the rbcL genes of green plastids which are more closely related to those of cyanobacteria the P. littoralis rbcL gene is more closely related to that of a -purple bacterium, as was found for the rbcS gene of another chromophytic alga [Boczar et al., Proc Natl Acad Sci USA 86: 4996–4999, 1989]. Matrix data of homology between the rbcL gene of P. littoralis and the same gene of other organisms are presented. Based on our previous report, the gene coding for the 16S rRNA from P. littoralis is closely related to that of E. gracilis (Markowicz et al., Curr Genet 14: 599–608, 1988). We suggest that the large plastid DNA molecule of P. littoralis is a phylogenetically composite genome which probably resulted from mixed endosymbiosis events, or from a horizontal transfer of DNA.     

Effects of harvesting onAscophyllum nodosum (L.) Le Jol. (Fucales,Phaeophyta): a demographic approach

Although populations ofAscophyllum nodosum are harvested commercially, little is known about the effects on demographic vital rates (growth, reproduction, survival). This study examines the effects of harvesting season and harvesting intensity on growth, reproduction and mortality of intact fronds in four size classes and in fronds truncated by the harvest. Knowledge of size-specific vital rates was used to evaluate the response of the population to harvesting.Harvesting season and harvesting intensity did not exert a significant effect on growth. Growth in plots not subject to harvesting was less than in harvested plots. No major differences in growth, reproduction and survival between intact and severed fronds emerged. The number of fronds attaining reproduction was enhanced by increased harvesting intensity and by cutting in summer. Harvesting did not seem to induce breakage, and breakage appeared higher in the uncut plots. Most harvesting treatments did not influence survivorship and survivorship was similar among all size classes. Growth rates were inversely related to sizes of fronds.Assessment of variation across size classes yielded more accurate estimates of growth rates than those of previously used methods. Accurate size class specific-growth rates will be a useful criterion when regulating intervals between harvests. Furthermore, assessment of size-specific vital rates allows identification of the frond size classes most relevant to the preservation of resources. Because of their fast growth rates and abundance, fronds in class 1, and, to a lesser extent, class 2, are responsible for most of the population regrowth after harvest. In contrast, classes 3 and 4 contribute little to recovery. This finding provides a strong basis for a harvesting strategy that targets the largest fronds.Author for correspondence     

Sequence of the plastid rDNA spacer region of the brown alga Pylaiella littoralis (L.) Kjellm. Evolutionary significance

The DNA segment situated between the 16S and 23S rRNA genes belonging to the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. has been sequenced. This small region (322 bp) contains two unsplit tRNA genes separated by 3 bp. A comparison with similar regions from different plants shows that this region has evolved in two different ways according to the place of plants in evolution. In the primitive group, this region is reduced in size when compared to prokaryotes. In the other groups, it is considerably enlarged by insertion of repetitive sequences, open reading frames and introns.     

Tortella bambergeri (Schimp.) Broth. in the British Isles

Abstract

The moss Tortella bambergeri (Schimp.) Broth. is added to the described British bryophyte flora. It differs from fragile-leaved forms of T. tortuosa (Hedw.) Limpr. in having the apical quarter of the costa with quadrate, papillose abaxial cells and in having the peristome teeth twisted by a half turn instead of one and a half turns. Other identification features are discussed, and the habitat and distribution of T. bambergeri in Britain are described. Most records are from sandstone boulders in western Britain.     

A Virus Infection in the Brown Alga Sorocarpus uvaeformis (Lyngbye) Pringsheim (Phaeophyta, Ectocarpales)

Virus-like particles were obsemed in zoospores and less frequentlyin vegetative cells of the filaments of mature plants of thebrown alga Sorocarpus uvaeformls. The particles, measuring approximately170 nm in diameter, are isometric in profile and show threedistinct zones. An electron dense rim (coat), 10 nm in thickness,is separated from a dense core, 110 nm in diameter, by an electronlight space 20 nm in width. When closely packed the particlesare usually separated from each other by a regular halo-likespace. Besides the isometric particles long flexuous structuresof variable length and measuring 75 nm in width were also found.The infection could be induced experimentally in healthy cellsby using either medium prevenient from infected cultures orcrude extracts obtained from infected plants.     

The existence of two races of Atlantic salmon (Salmo salar L.) in the British Isles

Sera from approximately 10 000 Atlantic salmon collected from rivers in the British Isles have been analysed. Polymorphism at the transferrin locus was observed and the distribution of the transferrin alleles provides further evidence supporting the presence of two races of salmon first postulated by Payne et al. (1971 a ).     

Notes on Thysanoptera found on flax (Linum usitatissimum L.) in the British Isles

The following eighteen species of Thysanoptera Terebrantia have been found on flax in the British Isles: Melanthrips fuscus (Sulzer), Aeolothrips fasciatus (L.), Anaphothrips obscurus (Müler), Aptinothrips rufus (Gmelin), Chirothrips manicatus Hal., Limothrips cerealium Hal., L. denticornis Hal., Stenothrips graminum Uzel, Taeniothrips atratus (Hal.), T. vulgatissimus (Hal.), Thrips angusticeps Uzel, T. discolor Hal., T. flavus Schrank, T. fuscipennis Hal., T. major Uzel, T. minutissimus L., T. physapus L., T. tabaci Lindeman. Each species is described briefly with notes on habits of adults and larvae, place of pupation, number of generations in the year, hibernation, time of occurrence on plants, plants and objects on which found, host plants of larvae and adults, importance to flax, record of locality and collector on flax, distribution, including altitudes, in the British Isles. More species occur in the south than in the north of Great Britain, and species common to both regions usually occur in greater numbers in the south. The insects breed on certain species of crop plants, weeds or trees of arable land. No damage of economic importance to flax by Thysanoptera has been proven in the British Isles, and the flax thrips, Thrips lini Ladureau, has not been found. Taeniothrips vulgatissimus (Hal.) may breed on flax and its adults, and those of T. atratus (Hal.) may cause superficial damage to petals of flowers. Thrips angusticeps Uzel and T. tabaci Lindeman will probably breed on flax.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Athalamia hyalina (Sommerf.) S.Hatt. in Scotland,new to the British Isles

Abstract

The liverwort Athalamia hyalina (Sommerf.) S.Hatt. and the family Cleveaceae are reported as new to the British Isles from the eastern Scottish Highlands. The Scottish plants are described and illustrated and the significance of the discovery is assessed. In Scotland, Athalamia hyalina occurs on thin soil on eroding limestone ledges in a montane habitat with a continental climate. It is in active growth in the winter months, producing spores in spring. Its range is restricted but it occurs within a protected area and is not threatened at present. The species is widespread in the northern hemisphere.     

Circadian rhythm and fast responses to blue light of photosynthesis in Ectocarpus (Phaeophyta,Ectocarpales)

Photosynthesis of Ectocarpus siliculosus (Dillwyn) Lyngb. under continuous saturating red irradiation follows a circadian rhythm. Blue-light pulses rapidly stimulate photosynthesis with high effectiveness in the troughs of this rhythm but the effectiveness of such pulses is much lower at its peaks. In an attempt to understand how blue light and the rhythm affected photosynthesis, the effects of inorganic carbon on photosynthetic light saturation curves were studied under different irradiation conditions. The circadian rhythm of photosynthesis was apparent only at irradiances which were not limiting for photosynthesis. The same was found for blue-light-stimulated photosynthesis, although stimulation was observed also under very low red-light irradiances after a period of adaptation, provided that the inorganic-carbon concentration was not in excess. Double-reciprocal plots of light-saturated photosynthetic rates versus the concentration of total inorganic carbon (up to 10 mM total inorganic carbon) were linear and had a common constant for half-saturation (3.6 mM at pH 8) at both the troughs and the peaks of the rhythm and before and after blue-light pulses. Only at very low carbon concentrations was a clear deviation found from these lines for photosynthesis at the rhythm maxima (red and blue light), which indicated that the strong carbon limitation specifically affected photosynthesis at the peak phases of the rhythm. Very high inorganic carbon concentrations (20 mM) in the medium diminished the responses to blue light, although they did not fully abolish them. The kinetics of the stimulation indicate that the rate of photosynthesis is affected by two blue-light-dependent components with different time courses of induction and decay. The faster component seemed to be at least partially suppressed at red-light irradiances which were not saturating for photosynthesis. Lowering the pH of the medium had the same effects as an increase of the carbon concentration to levels of approx. 10 mM. This indicates that Ectocarpus takes up free CO₂ only and not bicarbonate, although additional physiological mechanisms may enhance the availability of CO₂.Abbreviation TIC total inorganic carbon