Rep-Mediated Nicking of the Adeno-Associated Virus Origin Requires Two Biochemical Activities, DNA Helicase Activity and Transesterification

The single-stranded adeno-associated virus (AAV) genome is flanked by terminal hairpinned origins of DNA replication (terminal repeats [TRs]) that are nicked at the terminal resolution site (trs) by the AAV Rep protein in an ATP-dependent, site-specific manner. Here we determine the minimal trs sequence necessary for Rep cleavage, 3'-CCGGT/TG-5', and show that this 7-base core sequence is required only on the nicked strand. We also identify a potential stem-loop structure at the trs. Interestingly, Rep nicking on a TR substrate that fixes this trs stem-loop in the extruded form no longer requires ATP. This suggests that ATP-dependent Rep helicase activity is necessary to unwind the duplex trs and extrude the stem-loop structure, prior to the ATP-independent Rep transesterification reaction. The extrusion of origin stem-loop structures prior to nicking appears to be a general mechanism shared by plant and animal viruses and bacterial plasmids. In the case of AAV, this mechanism of TR nicking would provide a possible regulatory function.     

Partial purification of adeno-associated virus Rep78, Rep52, and Rep40 and their biochemical characterization.

We have used differential cell extraction and conventional chromatography to separate and partially purify the four adeno-associated virus (AAV) nonstructural proteins Rep78, Rep68, Rep52, and Rep40. In the cytoplasmic extracts Rep52 and Rep40 were present in greater abundance than Rep68 and Rep78, with Rep78 being the least abundant. In nuclear extracts the four Rep proteins were approximately equal in abundance. Regardless of the subcellular fraction examined, three of the Rep proteins (Rep78, Rep68, and Rep40) consisted of two protein species with slightly different mobilities during polyacrylamide gel electrophoresis. In contrast, Rep52 consisted of only one protein species. Both Rep78 and Rep68 were capable of binding efficiently to AAV terminal hairpin DNA substrates, but we could not detect site-specific DNA binding by Rep52 and Rep40. Like Rep68, Rep78 had both an ATP-dependent trs endonuclease and a DNA helicase activity. Both Rep78 and Rep68 cut the terminal AAV sequence at the same site (nucleotide 124). The binding, trs endonuclease, and DNA helicase activities comigrated during sucrose density gradient centrifugation with a mobility expected for a monomer of the protein, suggesting that the three biochemical activities were intrinsic properties of the larger Rep proteins. The chromatographic behavior and the DNA-binding properties of the four Rep proteins identified at least two domains within the rep coding region, an exposed hydrophobic domain within the C-terminal end (amino acids 578 to 621) and a region within the N terminus (amino acids 1 to 214) which was necessary for binding to the terminal repeat sequence. No site-specific nuclease activity was seen in the presence of nucleotide analogs ATP-gamma-S or AMP-PNP, suggesting that ATP hydrolysis was required for the endonuclease reaction. Furthermore, although ATP was the only cofactor which would support the trs endonuclease activity of Rep78, Rep68 nuclease activity was seen in the presence of several other nucleotide cofactors, including CTP, GTP, and UTP.     

Charged-to-alanine scanning mutagenesis of the N-terminal half of adeno-associated virus type 2 Rep78 protein

The adeno-associated virus (AAV) Rep78 and Rep68 proteins are required for site-specific integration of the AAV genome into the AAVS1 locus (19q13.3-qter) as well as for viral DNA replication. Rep78 and Rep68 bind to the GAGC motif on the inverted terminal repeat (ITR) and cut at the trs (terminal resolution site). A similar reaction is believed to occur in AAVS1 harboring an analogous GAGC motif and a trs homolog, followed by integration of the AAV genome. To elucidate the functional domains of Rep proteins at the amino acid level, we performed charged-to-alanine scanning mutagenesis of the N terminus (residues 1 to 240) of Rep78, where DNA binding and nicking domains are thought to exist. Mutants were analyzed for their abilities to bind the GAGC motif, nick at the trs homolog, and integrate an ITR-containing plasmid into AAVS1 by electrophoretic mobility shift assay, trs endonuclease assay, and PCR-based integration assay. We identified the residues responsible for DNA binding: R107A, K136A, and R138A mutations completely abolished the binding activity. The H90A or H92A mutant, carrying a mutation in a putative metal binding site, lost nicking activity while retaining binding activity. Mutations affecting DNA binding or trs nicking also impaired the site-specific integration, except for E66A and E239A. These results provide important information on the structure-function relationship of Rep proteins. We also describe an aberrant nicking of Rep78. We found that Rep78 cuts predominantly at the trs homolog not only between the T residues (GGT/TGG), but also between the G and T residues (GG/TTGG), which may be influenced by the sequence surrounding the GAGC motif.     

Interaction of wild-type and mutant adeno-associated virus (AAV) Rep proteins on AAV hairpin DNA.

Both the Rep68 and Rep78 proteins of adeno-associated virus type 2 (AAV) bind to AAV terminal repeat hairpin DNA and can mediate site-specific nicking in vitro at the terminal resolution site (trs) within the terminal repeats. To define the regions of the Rep proteins required for these functions, a series of truncated Rep78 derivatives was created. Wild-type and mutant proteins were synthesized by in vitro translation and analyzed for AAV hairpin DNA binding, trs endonuclease activity, and interaction on hairpin DNA. Amino-terminal deletion mutants which lacked the first 29 or 79 amino acid residues of Rep78 did not bind hairpin DNA, which is consistent with our previous identification of a DNA-binding domain in this region. Progressive truncation of the carboxyl-terminal region of Rep78 did not eliminate hairpin DNA binding until the deletion reached amino acid 443. The electrophoretic mobility of the Rep-specific protein-DNA complexes was inversely related to the molecular weight of the Rep derivative. Analysis of the C-terminal deletion mutants by the trs endonuclease assay identified a region (amino acids 467 to 476) that is essential for nicking but is not necessary for DNA binding. When endonuclease-positive, truncated Rep proteins that bound hairpin DNA were mixed with full-length Rep78 or Rep68 protein in electrophoretic mobility shift assays, a smear of protein-DNA complexes was observed. This smear migrated at an intermediate position with respect to the bands generated by the proteins individually. An antibody recognizing only the full-length protein produced a novel supershift band when included in a mixed binding assay containing Rep68 and a truncated Rep mutant. These experiments suggest that the Rep proteins can form hetero-oligomers on the AAV hairpin DNA.     

Features of the adeno-associated virus origin involved in substrate recognition by the viral Rep protein.

We previously demonstrated that the adeno-associated virus (AAV) Rep68 and Rep78 proteins are able to nick the AAV origin of DNA replication at the terminal resolution site (trs) in an ATP-dependent manner. Using four types of modified or mutant substrates, we now have investigated the substrate requirements of Rep68 in the trs endonuclease reaction. In the first kind of substrate, portions of the hairpinned AAV terminal repeat were deleted. Only deletions that retained virtually all of the small internal palindromes of the AAV terminal repeat were active in the endonuclease reaction. This result confirmed previous genetic and biochemical evidence that the secondary structure of the terminal repeat was an important feature for substrate recognition. In the second type of substrate, the trs was moved eight bases further away from the end of the genome. The mutant was nicked at a 50-fold-lower frequency relative to a wild-type origin, and the nick occurred at the correct trs sequence despite its new position. This finding indicated that the endonuclease reaction required a specific sequence at the trs in addition to the correct secondary structure. It also suggested that the minimum trs recognition sequence extended three bases from the cut site in the 3' direction. The third type of substrate harbored mismatched base pairs at the trs. The mismatch substrates contained a wild-type sequence on the strand normally cut but an incorrect sequence on the complementary strand. All of the mismatch mutants were capable of being nicked in the presence of ATP. However, there was substantial variation in the level of activity, suggesting that the sequence on the opposite strand may also be recognized during nicking. Analysis of the mismatch mutants also suggested that a single-stranded trs was a viable substrate for the enzyme. This interpretation was confirmed by analysis of the fourth type of substrate tested, which contained a single-stranded trs. This substrate was also cleaved efficiently by the enzyme provided that the correct strand was present in the substrate. In addition, the single-stranded substrate no longer required ATP as a cofactor for nicking. Finally, all of the substrates with mutant trss bound the Rep protein as efficiently as the wild-type did. This finding indicated that the sequence at the cut site was not involved in recognition of the terminal repeat for specific binding by the enzyme. We concluded that substrate recognition by the AAV Rep protein involves at least two and possibly as many as four features of the AAV terminal repeat.(ABSTRACT TRUNCATED AT 400 WORDS)     

Sequence requirements for binding of Rep68 to the adeno-associated virus terminal repeats.

We have used reciprocal competition binding experiments with mutant substrates and chemical modification interference assays to precisely define the sequences within the adeno-associated virus (AAV) terminal repeat (TR) that are involved in site-specific binding to the AAV Rep protein. Mutagenesis experiments were done with a 43-bp oligonucleotide which contained the Rep binding element (RBE) within the A stem of the TR. Experiments in which two adjacent base pairs of the RBE were substituted simultaneously with nucleotides that produced transversions identified a 22-bp sequence (CAGTGAGCGAGCGAGCGCGCAG) in which substitutions measurably affected the binding affinity. Although the 22-bp RBE contains the GAGC motifs that have been found in all known Rep binding sites, our results suggest that the GAGC motifs alone are not the only sequences specifically recognized by Rep. The effects of substitutions within the 22-bp sequence were relatively symmetrical, with nucleotides at the periphery of the RBE having the least effect on binding affinity and those in the middle having the greatest effect. Dinucleotide mutations within 18 (GTGAGCGAGCGAGC) of the 22 bp were found to decrease the binding affinity by at least threefold. Dinucleotide mutations within a 10-bp core sequence (GCGAGCGAGC) were found to decrease binding affinity by more than 10-fold. Single-base substitutions within the 10-bp core sequence lowered the binding affinity by variable amounts (up to fivefold). The results of the mutagenesis analysis suggested that the A-stem RBE contains only a single Rep binding site rather than two or more independent sites. To confirm the results of the mutant analysis and to determine the relative contribution of each base to binding, chemical modification experiments using dimethyl sulfate and hydrazine were performed on both the linear A-stem sequence and the entire AAV TR in both the flip and flop hairpinned configurations. Interference assays on the linear A stem identified the 18-bp sequence described above as essential for binding. G, C, and T residues on both strands contributed to binding, and the interference pattern correlated well with the results of the mutagenesis experiments. Interference assays with complete hairpinned TR substrates also identified the 18-bp sequence as important for binding. However, the interference patterns on the two strands within the RBE and the relative contributions of the individual bases to binding were clearly different between the hairpinned substrates and the linear A-stem binding element. Interference assays also allowed us to search for residues within the small internal palindromes of the TR (B and C) that contribute to binding. The largest effect was seen by modification of two T residues within the sequence CTTTG. This sequence was present in the same position relative to the terminal resolution site (trs) in both the flip and flop orientations of the TR. In addition, the interference pattern suggested that the remaining bases within the CTTTG motif as well as other bases within the B and C palindromes make contacts with the Rep protein, albeit with lower affinities. Regardless of whether the TR was in the flip or flop orientation, most of the contact points were clustered in the small internal palindrome furthest away from the trs. We also determined the relative binding affinity of linear substrates containing a complete RBE with hairpinned substrates and found that linear substrates bound Rep less efficiently. Our results were consistent with our previous model that there are three distinct elements within the hairpinned AAV TR that contribute to binding affinity or to efficient nicking at the trs: the A-stem RBE, the secondary structure element which consists of the B and C palindromes, and the trs.     

Selective cleavage of AAVS1 substrates by the adeno-associated virus type 2 rep68 protein is dependent on topological and sequence constraints

The adeno-associated virus type 2 (AAV-2) Rep78 and Rep68 proteins are required for replication of the virus as well as its site-specific integration into a unique site, called AAVS1, of human chromosome 19. Rep78 and Rep68 initiate replication by binding to a Rep binding site (RBS) contained in the AAV-2 inverted terminal repeats (ITRs) and then specifically nicking at a nearby site called the terminal resolution site (trs). Similarly, Rep78 and Rep68 are postulated to trigger the integration process by binding and nicking RBS and trs homologues present in AAVS1. However, Rep78 and Rep68 cleave in vitro AAVS1 duplex-linear substrates much less efficiently than hairpinned ITRs. In this study, we show that the AAV-2 Rep68 endonuclease activity is affected by the topology of the substrates in that it efficiently cleaves in vitro in a site- and strand-specific manner the AAVS1 trs only if this sequence is in a supercoiled (SC) conformation. DNA sequence mutagenesis in the context of SC templates allowed us to elucidate for the first time the AAVS1 trs sequence and position requirements for Rep68-mediated cleavage. Interestingly, Rep68 did not cleave SC templates containing RBS from other sites of the human genome. These findings have intriguing implications for AAV-2 site-specific integration in vivo.     

Mutational analysis of adeno-associated virus type 2 Rep68 protein endonuclease activity on partially single-stranded substrates

The endonuclease activity of the Rep68 and Rep78 proteins (Rep68/78) of adeno-associated virus type 2 (AAV) cuts at the terminal resolution site (trs) within the hairpin structure formed by the AAV inverted terminal repeats. Recent studies suggest that a DNA unwinding function of Rep68/78 may be required for endonuclease activity. We demonstrate that several mutant proteins which are endonuclease negative on a fully duplex hairpin substrate are endonuclease positive on a partially single-stranded hairpin substrate. Truncation analysis revealed that the endonuclease function is contained within the first 200 amino acids of Rep68/78. This endonucleolytic cleavage is believed to involve the covalent attachment of Rep68/78 to the trs via a phosphate-tyrosine linkage. A previous report (S. L. Walker, R. S. Wonderling, and R. A. Owens, J. Virol. 71:2722-2730, 1997) suggested that tyrosine 152 was part of the active site. We individually mutated each tyrosine within the first 200 amino acids of the Rep68 moiety of a maltose binding protein-Rep68/78 fusion protein to phenylalanine. Only mutation of tyrosine 156 resulted in a protein incapable of covalent attachment to a partially single-stranded hairpin substrate, suggesting that tyrosine 156 is part of the endonuclease active site.     

Factors Affecting the Terminal Resolution Site Endonuclease, Helicase, and ATPase Activities of Adeno-Associated Virus Type 2 Rep Proteins

The Rep68 and Rep78 proteins (Rep68/78) of adeno-associated virus type 2 (AAV) are critical for AAV replication and site-specific integration. They bind specifically to the AAV inverted terminal repeats (ITRs) and possess ATPase, helicase, and strand-specific/site-specific endonuclease activities. In the present study, we further characterized the AAV Rep68/78 helicase, ATPase, and endonuclease activities by using a maltose binding protein-Rep68 fusion (MBP-Rep68Delta) produced in Escherichia coli cells and Rep78 produced in vitro in a rabbit reticulocyte lysate system. We found that the minimal length of single-stranded DNA capable of stimulating the ATPase activity of MBP-Rep68Delta is 100 to 200 bases. The degree of stimulation correlated positively with the length of single-stranded DNA added to the reaction mixture. We then determined the ATP concentration needed for optimal MBP-Rep68Delta helicase activity and showed that the helicase is active over a wide range of ATP concentrations. We determined the directionality of MBP-Rep68Delta helicase activity and found that it appears to move in a 3' to 5' direction, which is consistent with a model in which AAV Rep68/78 participates in AAV DNA replication by unwinding DNA ahead of a cellular DNA polymerase. In this report, we also demonstrate that single-stranded DNA is capable of inhibiting the MBP-Rep68Delta or Rep78 endonuclease activity greater than 10-fold. In addition, we show that removal of the secondary Rep68/78 binding site, which is found only in the hairpin form of the AAV ITR, causes a three- to eightfold reduction in the ability of the ITR to be used as a substrate for the Rep78 or MBP-Rep68Delta endonuclease activity. This suggests that contact between Rep68/78 and this secondary element may play an important role in the Rep-mediated endonuclease activity.     

The AAV origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity

Genetic studies of adeno-associated virus (AAV) indicate that two AAV genes are required for viral DNA replication: the palindromic terminal repeat, which is the origin for DNA replication, and the rep gene, which codes for a family of at least four viral nonstructural proteins. To determine the biochemical function of the Rep proteins, we have purified the AAV Rep68 protein to apparent homogeneity. We find that it contains a site-specific and strand-specific endonuclease activity that specifically cuts the AAV origin at the terminal resolution site (TRS). The TRS endonuclease requires the presence of ATP for activity and becomes covalently attached to the 5' end at the cut site. In addition to the specific endonuclease activity, Rep68 also contains a DNA helicase activity. These results demonstrate that the large AAV Rep proteins have a direct role in AAV DNA replication; namely, they provide the activities required for the resolution of covalently joined AAV termini.     

Biochemical Characterization of Adeno-Associated Virus Rep68 DNA Helicase and ATPase Activities

The adeno-associated virus (AAV) nonstructural proteins Rep68 and Rep78 are site-specific DNA binding proteins, ATP-dependent site-specific endonucleases, helicases, and ATPases. These biochemical activities are required for viral DNA replication and control of viral gene expression. In this study, we characterized the biochemical properties of the helicase and ATPase activities of homogeneously pure Rep68. The enzyme exists as a monomer in solution at the concentrations used in this study (<380 nM), as judged by its mobility in sucrose density gradients. Using a primed single-stranded (ss) circular M13 substrate, the helicase activity had an optimum pH of 7 to 7.5, an optimum temperature of 45°C, and an optimal divalent-cation concentration of 5 mM MgCl₂. Several nucleoside triphosphates could serve as cofactors for Rep68 helicase activity, and the order of preference was ATP = GTP > CTP = dATP > UTP > dGTP. The K_m values for ATP in both the DNA helicase reaction and the site-specific trs endonuclease reaction were essentially the same, approximately 180 μM. Both reactions were sigmoidal with respect to ATP concentration, suggesting that a dimer or higher-order multimer of Rep68 is necessary for both DNA helicase activity and terminal resolution site (trs) nicking activity. Furthermore, when the enzyme itself was titrated in the trs endonuclease and ATPase reactions, both activities were second order with respect to enzyme concentration. This suggests that a dimer of Rep68 is the active form for both the ATPase and nicking activities. In contrast, DNA helicase activity was linear with respect to enzyme concentration. When bound to ssDNA, the enzyme unwound the DNA in the 3′-to-5′ direction. DNA unwinding occurred at a rate of approximately 345 bp per min per monomeric enzyme molecule. The ATP turnover rate was approximately 30 to 50 ATP molecules per min per enzyme molecule. Surprisingly, the presence of DNA was not required for ATPase activity. We estimated that Rep translocates processively for more than 1,300 bases before dissociating from its substrate in the absence of any accessory proteins. DNA helicase activity was not significantly stimulated by substrates that have the structure of a replication fork and contain either a 5′ or 3′ tail. Rep68 binds only to ssDNA, as judged by inhibition of the DNA helicase reaction with ss or double-stranded (ds) DNA. Consistent with this observation, no helicase activity was detected on blunt-ended ds oligonucleotide substrates unless they also contained an ss 3′ tail. However, if a blunt-ended ds oligonucleotide contained the 22-bp Rep binding element sequence, Rep68 was capable of unwinding the substrate. This means that Rep68 can function both as a conventional helicase for strand displacement synthesis and as a terminal-repeat-unwinding protein which catalyzes the conversion of a duplex end to a hairpin primer. Thus, the properties of the Rep DNA helicase activity suggest that Rep is involved in all three of the key steps in AAV DNA replication: terminal resolution, reinitiation, and strand displacement.     

Mutational analysis of the adeno-associated virus Rep68 protein: identification of critical residues necessary for site-specific endonuclease activity.

The Rep68 and Rep78 proteins of adeno-associated virus type 2 (AAV) are multifunctional proteins which contain overlapping amino acid sequences. They are required for viral replication and preferential integration of the AAV genome into a region of human chromosome 19. During the terminal resolution process of AAV DNA replication, these proteins make a site-specific and strand-specific endonuclease cut within the AAV inverted terminal repeat DNA. The Rep68 and Rep78 proteins also have helicase and DNA-binding activities. The endonuclease activity is believed to involve the covalent attachment of Rep68 or Rep78 at the cut site via a phosphotyrosine linkage. In an attempt to identify the active-site tyrosine residue of Rep78 and Rep68, tyrosine residues were site specifically mutated to phenylalanines by overlap extension PCR, and the resulting PCR fragments were cloned into a maltose binding protein-Rep68 fusion (MBP-Rep68delta) expression vector. The mutant MBP-Rep68delta proteins were expressed in Escherichia coli cells, purified with amylose resin, and assayed in vitro for Rep68-specific activities. Although several of the mutations disrupted the endonuclease activity, only the mutation of tyrosine 152 abrogated the endonuclease activity with no discernible effect on the helicase or DNA-binding activities. Our data therefore suggest that there are distinct active sites for the helicase and endonuclease activities.     

A Rep recognition sequence is necessary but not sufficient for nicking of DNA by adeno-associated virus type-2 Rep proteins

The strand-specific, site-specific endonuclease (nicking) activity of the Rep68 and Rep78 (Rep68/78) proteins of adeno-associated virus type 2 (AAV) is involved in AAV replication, and appears to be involved in AAV site-specific integration. Rep68/78 cuts within the inverted terminal repeats (ITRs) of the AAV genome and in the AAV preferred integration locus on human chromosome 19 (AAVS1). The known endonuclease cut sites are 11-16 bases away from the primary binding sites, known as Rep recognition sequences (RRSs). A linear, double-stranded segment of DNA, containing an RRS and a cut site, has previously been shown to function as a substrate for the Rep68/78 endonuclease activity. We show here that mutation of the Rep recognition sequence, within such a DNA segment derived from the AAV ITRs, eliminates the ability of this substrate to be cleaved detectably by Rep78. Rep78 nicks the RRS-containing site from AAVS1 about half as well as the linear ITR sequence. Eighteen other RRS-containing sequences found in the human genome, but outside AAVS1, are not cleaved by Rep78. These results may help to explain the specificity of AAV integration.     

Analysis of the Effects of Charge Cluster Mutations in Adeno-Associated Virus Rep68 Protein In Vitro

The Rep78 and Rep68 proteins of adeno-associated virus type 2 (AAV) are multifunctional proteins which are required for viral replication, regulation of AAV promoters, and preferential integration of the AAV genome into a region of human chromosome 19. These proteins bind the hairpin structures formed by the AAV inverted terminal repeat (ITR) origins of replication, make site- and strand-specific endonuclease cuts within the AAV ITRs, and display nucleoside triphosphate-dependent helicase activities. Additionally, several mutant Rep proteins display negative dominance in helicase and/or endonuclease assays when they are mixed with wild-type Rep78 or Rep68, suggesting that multimerization may be required for the helicase and endonuclease functions. Using overlap extension PCR mutagenesis, we introduced mutations within clusters of charged residues throughout the Rep68 moiety of a maltose binding protein-Rep68 fusion protein (MBP-Rep68Δ) expressed in Escherichia coli cells. Several mutations disrupted the endonuclease and helicase activities; however, only one amino-terminal-charge cluster mutant protein (D40A-D42A-D44A) completely lost AAV hairpin DNA binding activity. Charge cluster mutations within two other regions abolished both endonuclease and helicase activities. One region contains a predicted alpha-helical structure (amino acids 371 to 393), and the other contains a putative 3,4 heptad repeat (coiled-coil) structure (amino acids 441 to 483). The defects displayed by these mutant proteins correlated with a weaker association with wild-type Rep68 protein, as measured in coimmunoprecipitation assays. These experiments suggest that these regions of the Rep molecule are involved in Rep oligomerization events critical for both helicase and endonuclease activities.     

Charge-to-Alanine Mutagenesis of the Adeno-Associated Virus Type 2 Rep78/68 Proteins Yields Temperature-Sensitive and Magnesium-Dependent Variants

The adeno-associated virus type 2 (AAV) replication (Rep) proteins Rep78 and 68 (Rep78/68) exhibit a number of biochemical activities required for AAV replication, including specific binding to a 22-bp region of the terminal repeat, site-specific endonuclease activity, and helicase activity. Individual and clusters of charged amino acids were converted to alanines in an effort to generate a collection of conditionally defective Rep78/68 proteins. Rep78 variants were expressed in human 293 cells and analyzed for their ability to mediate replication of recombinant AAV vectors at various temperatures. The biochemical activities of Rep variants were further characterized in vitro by using Rep68 His-tagged proteins purified from bacteria. The results of these analyses identified a temperature-sensitive (ts) Rep protein (D40,42,44A-78) that exhibited a delayed replication phenotype at 32 degrees C, which exceeded wild-type activity by 48 h. Replication activity was reduced by more than threefold at 37 degrees C and was undetectable at 39 degrees C. Stability of the Rep78 protein paralleled replication levels at each temperature, further supporting a ts phenotype. Replication differences resulted in a 3-log-unit difference in virus yields between the permissive and nonpermissive temperatures (2.2 x 10(6) and 3 x 10(3), respectively), demonstrating that this is a relatively tight mutant. In addition to the ts Rep mutant, we identified a nonconditional mutant with a reduced ability to support viral replication in vivo. Additional characterization of this mutant demonstrated an Mg(2+)-dependent phenotype that was specific to Rep endonuclease activity and did not affect helicase activity. The two mutants described here are unique, in that Rep ts mutants have not previously been described and the D412A Rep mutant represents the first mutant in which the helicase and endonuclease functions can be distinguished biochemically. Further understanding of these mutants should facilitate our understanding of AAV replication and integration, as well as provide novel strategies for production of viral vectors.     

The amino acid linker between the endonuclease and helicase domains of adeno-associated virus type 5 Rep plays a critical role in DNA-dependent oligomerization

The adeno-associated virus (AAV) genome encodes four Rep proteins, all of which contain an SF3 helicase domain. The larger Rep proteins, Rep78 and Rep68, are required for viral replication, whereas Rep40 and Rep52 are needed to package AAV genomes into preformed capsids; these smaller proteins are missing the site-specific DNA-binding and endonuclease domain found in Rep68/78. Other viral SF3 helicases, such as the simian virus 40 large T antigen and the papillomavirus E1 protein, are active as hexameric assemblies. However, Rep40 and Rep52 have not been observed to form stable oligomers on their own or with DNA, suggesting that important determinants of helicase multimerization lie outside the helicase domain. Here, we report that when the 23-residue linker that connects the endonuclease and helicase domains is appended to the adeno-associated virus type 5 (AAV5) helicase domain, the resulting protein forms discrete complexes on DNA consistent with single or double hexamers. The formation of these complexes does not require the Rep binding site sequence, nor is it nucleotide dependent. These complexes have stimulated ATPase and helicase activities relative to the helicase domain alone, indicating that they are catalytically relevant, a result supported by negative-stain electron microscopy images of hexameric rings. Similarly, the addition of the linker region to the AAV5 Rep endonuclease domain also confers on it the ability to bind and multimerize on nonspecific double-stranded DNA. We conclude that the linker is likely a key contributor to Rep68/78 DNA-dependent oligomerization and may play an important role in mediating Rep68/78's conversion from site-specific DNA binding to nonspecific DNA unwinding.     

Identification and characterization of an adeno-associated virus integration site in CV-1 cells from the African green monkey

Adeno-associated virus (AAV) is a classification given to a group of nonpathogenic, single-stranded DNA viruses known to reside latently in primates. During latency in humans, AAV type 2 (AAV2) preferentially integrates at a site on chromosome 19q13.3ter by targeting a sequence composed of an AAV Rep binding element (RBE), a spacer, and a nicking site. Here, we report the DNA sequence of an African green monkey AAV integration site isolated from CV-1 cells. Overall, it has 98% homology to the analogous human site, including identical spacer and nicking sequences. However, the simian RBE is expanded, having five perfect directly repeated GAGC tetramers. We carried out a number of in vitro and in vivo assays to determine the effect of this expanded RBE sequence on the Rep-RBE interaction and AAV targeted integration. Using electromobility shift assays it was demonstrated that AAV4 Rep68 bound the expanded RBE with a sixfold-greater affinity than the human RBE. To determine the basis for the affinity increase, DNase I protection and methylation interference (MI) assays were performed. Comparison of footprints on both the human and simian RBEs revealed nearly identical protection; however, MI analysis suggested greater interaction with the guanine nucleotides of the expanded RBE, thus providing a biochemical basis for the increased binding activity. In vivo, integration targeted to the simian RBE was demonstrated by PCR analysis of latently infected Cos-7 cells. Interestingly, the frequency of site-specific integration was twofold greater in Cos-7 cells than in HeLa cells. Overall, these experiments establish that the simian RBE, identified in CV-1 cells, functions analogously to the human RBE and provide further evidence for a developing model that proposes individual roles for the RBE and the spacer and nicking site elements.     

Biologically active Rep proteins of adeno-associated virus type 2 produced as fusion proteins in Escherichia coli.

Four Rep proteins are encoded by the human parvovirus adeno-associated virus type 2 (AAV). The two largest proteins, Rep68 and Rep78, have been shown in vitro to perform several activities related to AAV DNA replication. The Rep78 and Rep68 proteins are likely to be involved in the targeted integration of the AAV DNA into human chromosome 19, and the full characterization of these proteins is important for exploiting this phenomenon for the use of AAV as a vector for gene therapy. To obtain sufficient quantities for facilitating the characterization of the biochemical properties of the Rep proteins, the AAV rep open reading frame was cloned and expressed in Escherichia coli as a fusion protein with maltose-binding protein (MBP). Recombinant MBP-Rep68 and MBP-Rep78 proteins displayed the following activities reported for wild-type Rep proteins when assayed in vitro: (i) binding to the AAV inverted terminal repeat (ITR), (ii) helicase activity, (iii) site-specific (terminal resolution site) endonuclease activity, (iv) binding to a sequence within the integration locus for AAV DNA on human chromosome 19, and (v) stimulation of radiolabeling of DNA containing the AAV ITR in a cell extract. These five activities have been described for wild-type Rep produced from mammalian cell extracts. Furthermore, we recharacterized the sequence requirements for Rep binding to the ITR and found that only the A and A' regions are necessary, not the hairpin form of the ITR.     

Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.

Replication of the palindromic inverted terminal repeats (ITRs) of adeno-associated virus type 2 requires several functions of the viral nonstructural Rep proteins. These include binding to the ITR, nicking of the double-stranded replication intermediate at the terminal resolution site (trs), and then strand displacement and synthesis from the nick. This report demonstrates the ability of both recombinant fusion maltose-binding protein (MBP)-Rep68 delta produced in Escherichia coli and wild-type (wt) Rep68 to bind to a linear truncated form of the ITR, delta 57 ITR, with similar affinity as to the wt hairpin ITR. A dissociation constant for MBP-Rep68 delta of approximately 8 x 10(-10) M was determined for the wt ITR and delta 57 ITR probes. Truncation of delta 57 ITR to generate delta 28 ITR, which retains the GCTC repeat motif but not the trs, bound at least 10 times less efficiently than delta 57 ITR. Extension of delta 28 ITR with nonspecific sequence restored the ability of MBP-Rep68 delta to bind to delta 28 ITR. Thus, high-affinity binding would appear to require stabilization by flanking sequence as well as the intact GCTC repeat motif. Cleavage of the delta 57 ITR probe with DdeI, which truncates the flanking sequence and was previously shown to inhibit binding by Rep68, also inhibited the binding of MBP-Rep68 delta. The requirements for stable binding were further defined with a series of oligonucleotide probes which spanned the region protected by MBP-Rep78 in DNase I footprinting. The binding activity of either MBP-Rep68 delta or wt Rep68 to hairpin ITR or delta 57 ITR was indistinguishable. However, the binding activity of MBP-Rep68 delta to DNA does not appear to correlate with trs endonuclease activity. The nicking and covalent linkage of MBP-Rep68 delta to the nonhairpin delta 57 ITR was approximately 100-fold less efficient than its linkage to a hairpin-containing ITR. Therefore, although the hairpin portion of the ITR does not appear to play a role in recognition and stabilization of MBP-Rep68 delta binding, its presence does affect the trs cleavage activity of the protein.