Thermodynamic molecular switch in macromolecular interactions

It is known that most living systems can live and operate optimally only at a sharply defined temperature, or over a limited temperature range, at best, which implies that many basic biochemical interactions exhibit a well-defined Gibbs free energy minimum as a function of temperature. The Gibbs free energy change, deltaG(o) (T), for biological systems shows a complicated behavior, in which deltaG(o)(T) changes from positive to negative, then reaches a negative value of maximum magnitude (favorable), and finally becomes positive as temperature increases. The critical factor in this complicated thermodynamic behavior is a temperature-dependent heat capacity change (deltaCp(o)(T) of reaction, which is positive at low temperature, but switches to a negative value at a temperature well below the ambient range. Thus, the thermodynamic molecular switch determines the behavior patterns of the Gibbs free energy change, and hence a change in the equilibrium constant, Keq, and/or spontaneity. The subsequent, mathematically predictable changes in deltaH(o)(T), deltaS(o)(T), deltaW(o)(T), and deltaG(o)(T) give rise to the classically observed behavior patterns in biological reactivity, as demonstrated in three interacting protein systems: the acid dimerization reaction of alpha-chymotrypsin at low pH, interaction of chromogranin A with the intraluminal loop peptide of the inositol 1,4,5-triphosphate receptor at pH 5.5, and the binding of L-arabinose and D-galactose to the L-arabinose binding protein of Escherichia coli. In cases of protein unfolding of four mutants of phage T4 lysozyme, no thermodynamic molecular switch is observed.     

Thermodynamic analysis of human retinal acetylcholinesterase inhibition using an anti-Alzheimer's drug, tacrine, through the development of a dual substrate and temperature model

The present study determines the energy parameters, such as the Gibb's free energy change (deltaG), enthalpy change (deltaH), heat of activation (deltaH*), entropy change (deltaS), temperature coefficient (Q10) and activation energy (Ea), of human retinal acetylcholinesterase (AChE, EC 3.1.1.7) inhibition by tacrine. The stereo-frequency collisions factor (PZ, the number of sterically and energetically favorable collisions occurring between tacrine and AChE) was also studied in this investigation. Tacrine significantly increased the value of deltaG, deltaH, deltaH*, Q10, Ea and PZ factor, and decreased the value of deltaS for AChE. Since there is no known report on the inhibition of human retinal AChE by tacrine, these results were compared with the reported values for the energy parameters of camel retinal and chicken brain AChE inhibition by an anti-cancer drug, cyclophosphamide. The uniqueness of this approach lies in the development of the 'dual substrate and dual temperature' model, which may open up a new, more efficient avenue for the study of various enzyme catalyzed reactions.     

Compensational phenomena in reactivation of dimethyl- and diethylphosphoryl butyrylcholinesterases.

The thermodynamic and kinetic parameters for spontaneous and oxime reactivation of dimethyl- and diethylphosphoryl butyrylcholinesterases (acylcholine acyl-hydrolase, EC 3.1.1.8) are reported. The enthalpy and entropy changes in both the binding (deltaH0 and deltaS0) and the dephosphorylation steps (deltaH* and deltaS*) were found to be coupled, resulting in a minor variation in free energy changes (deltaG0 and deltaG*). While neither enthalpies nor entropies alone bore any relationship with the kinetic parameters KD and kR, the changes of free energies (deltaG0 and deltaG*) correlated linearly with the logarithmic values of the dissociation constants (KD) and bimolecular rate constants (kR/KD), respectively. Compensation plots of entropies versus enthalpies gave straight lines with compensation temperatures of 275 K for the binding 260 K for the dephosphorylation. Spontaneous reactivation of dimethyl phosphoryl butyrylcholinesterase was investigated at various pH values and three temperatures. It implicated two catalytic sites with values of pKi of 9.4 and 7.5, and heats of ionisation of 5.3 and 9.6 kcal - mol-1, respectively. Possible conformational alteration of the inhibited enzyme arising from the binding of oximes is discussed.     

Binding of the antibacterial peptide magainin 2 amide to small and large unilamellar vesicles

The thermodynamics of binding of the antibacterial peptide magainin 2 amide (M2a) to negatively charged small (SUVs) and large (LUVs) unilamellar vesicles has been studied with isothermal titration calorimetry (ITC) and CD spectroscopy at 45 degrees C. The binding isotherms as well as the ability of the peptide to permeabilize membranes were found to be qualitatively and quantitatively similar for both model membranes. The binding isotherms could be described with a surface partition equilibrium where the surface concentration of the peptide immediately above the plane of binding was calculated with the Gouy-Chapman theory. The standard free energy of binding was deltaG0 approximately -22 kJ/mol and was almost identical for LUVs and SUVs. However, the standard enthalpy and entropy of binding were distinctly higher for LUVs (deltaH0 = -15.1 kJ/mol, deltaS0 = 24.7 J/molK) than for SUVs (deltaH0 = -38.5 kJ/mol, deltaS0 = -55.3 J/molK). This enthalpy-entropy compensation mechanism is explained by differences in the lipid packing. The cohesive forces between lipid molecules are larger in well-packed LUVs and incorporation of M2a leads to a stronger disruption of cohesive forces and to a larger increase in the lipid flexibility than peptide incorporation into the more disordered SUVs. At 45 degrees C the peptide easily translocates from the outer to the inner monolayer as judged from the simulation of the ITC curves.     

Interaction of an organic selenium compound with human serum albumin

The interaction between 4,4'-diselenadibenzoic acid and human serum albumin (HSA) was investigated by fluorescence and absorption spectroscopy. The quenching mechanism of fluorescence of HSA by 4,4'-diselenadibenzoic acid was discussed. It is proved that the fluorescence quenching of HSA by 4,4'-diselenadibenzoic acid is a result of the formation of the HSA-4,4'-diselenadibenzoic acid complex. The binding sites number n, apparent corporation constant K, and corresponding thermodynamic parameters, deltaH(theta), deltaG(theta), and deltaS(theta) were calculated. Results indicate that the electrostatic interactions forces played major role in the reaction.     

Kinetic analysis of enhanced thermal stability of an alkaline protease with engineered twin disulfide bridges and calcium-dependent stability

The thermal stability of a cysteine-free alkaline protease (Alp) secreted by the eukaryote Aspergillus oryzae was improved both by the introduction of engineered twin disulfide bridges (Cys-69/Cys-101 and Cys-169/Cys-200), newly constructed as part of this study, and by the addition of calcium ions. We performed an extensive kinetic analysis of the increased thermal stability of the mutants as well as the role of calcium dependence. The thermodynamic activation parameters for irreversible thermal inactivation, the activation free energy (deltaG), the activation enthalpy (deltaH), and the activation entropy (deltaS) were determined from absolute reaction rate theory. The values of deltaH and deltaS were significantly and concomitantly increased as a result of introducing the twin disulfide bridges, for which the increase in the value of deltaH outweighed that of deltaS, resulting in significant increases in the value of deltaG. The enhancement of the thermal stability obtained by introducing the twin disulfide bridges is an example of the so-called low-temperature stabilization of enzymes. The stabilizing effect of calcium ions on wild-type Alp is similar to the results we obtained by introducing the engineered twin disulfide bridges.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Interaction of epitope-related and -unrelated peptides with anti-p24 (HIV-1) monoclonal antibody CB4-1 and its Fab fragment

The binding of four epitope-related peptides and three library-derived, epitope-unrelated peptides of different lengths (10-14 amino acids) and sequence by anti-p24 (HIV-1) monoclonal antibody CB4-1 and its Fab fragment was studied by isothermal titration calorimetry. The binding constants K(A) at 25 degrees C vary between 5.1 x 10(7) M (-1) for the strongest and 1.4 x 10(5) M (-1) for the weakest binder. For each of the peptides complex formation is enthalpically driven and connected with unfavorable entropic contributions; however, the ratio of enthalpy and entropy contributions to deltaG(0) differs markedly for the individual peptides. A plot of -deltaH(0) vs -TdeltaS(0) shows a linear correlation of the data for a wide variety of experimental conditions as expected for a process with deltaC(p) much larger than deltaS(0). The dissimilarity of deltaC(p) and deltaS(0) also explains why deltaH(0) and TdeltaS(0) show similar temperature dependences resulting in relatively small changes of deltaG(0) with temperature. The heat capacity changes deltaC(p) upon antibody-peptide complex formation determined for three selected peptides vary only in a small range, indicating basic thermodynamic similarity despite different key residues interacting in the complexes. Furthermore, the comparison of van't Hoff and calorimetric enthalpies point to a non-two-state binding mechanism. Protonation effects were excluded by measurements in buffers of different ionization enthalpies. Differences in the solution conformation of the peptides as demonstrated by circular dichroic measurements do not explain different binding affinities of the peptides; specifically a high helix content in solution is not essential for high binding affinity despite the helical epitope conformation in the crystal structure of p24.     

The energetics of phosphate binding to a protein complex

The heat of binding the serine protease, porcine pancreatic elastase, by the inhibitor, turkey ovomucoid third domain, is dependent on the presence of inorganic phosphate. This dependence is saturable and can be accurately modeled as the phosphate binding to a single site on the protease-inhibitor complex; thus, the elastase-ovomucoid system provides a unique opportunity to study phosphate-protein interactions. We have used isothermal titration calorimetry to investigate this binding, thereby providing one of the few complete thermodynamic characterizations of phosphate interacting with proteins. The binding is characterized by a small favorable deltaG degrees, a large unfavorable deltaH degrees, and a positive deltaCp, thermodynamics consistent with the release of water being linked to phosphate binding. These measurements provide insight into the binding of phosphotyrosine containing peptides to SH2 domains by suggesting the energetic consequences of binding phosphate free from other interactions.     

Binding thermodynamics and intrinsic activity of adenosine A1 receptor ligands

A thermodynamic analysis of the binding to rat cortex adenosine A1 receptors of 5'-deoxyribose-N6-cyclopentyladenosine (full agonist) and several 8-alkylamino homologues of N6-cyclopentyladenosine (partial agonists) was performed. The intrinsic activity of the compounds was also evaluated by measuring the inhibition of forskolin-stimulated 3'-5'-cyclic adenosine monophosphate (c-AMP) levels in isolated epididymal rat adipocytes. Standard free energy (deltaG), enthalpy (deltaH ) and entropy (deltaS ) of the binding equilibrium were determined by affinity measurements carried out at different temperatures (0, 10, 20, 25, 30 degrees C). Affinity constants of drug-receptor interactions were obtained by displacement experiments in the presence of 1nM [3H]N6-cyclohexyladenosine. Levels of c-AMP were evaluated by performing competitive binding assays. As the affinity of the ligands was found to increase with temperature enhancement, the binding of full and partial agonists is therefore totally entropy-driven. Standard entropy values of a wide series of adenosine derivatives, including the compounds under examination, are strictly correlated to those of intrinsic activity. Similarly, deltaS values appear correlated to the in vivo ability of the adenosine derivatives to inhibit rat heart rate. Thermodymanic data of adenosine A1 receptor ligands are proposed as an indicator of their pharmacodynamics.     

Interaction of colchicine with human serum albumin investigated by spectroscopic methods

We investigated the interaction between colchicine and human serum albumin (HSA) by fluorescence and UV-vis absorption spectroscopy. In the mechanism discussion, it was proved that the fluorescence quenching of HSA by colchicine is a result of the formation of colchicines-HSA complex; van der Waals interactions and hydrogen bonds play a major role in stabilizing the complex. The modified Stern-Volmer quenching constant K(a) and corresponding thermodynamic parameters deltaH, deltaG, deltaS at different temperatures were calculated. The distance r between donor (Trp214) and acceptor (colchicine) was obtained according to fluorescence resonance energy transfer (FRET).     

Isothermal titration calorimetry of RNA

Isothermal titration calorimetry (ITC) is a fast and robust method to study the physical basis of molecular interactions. A single well-designed experiment can provide complete thermodynamic characterization of a binding reaction, including K(a), DeltaG, DeltaH, DeltaS and reaction stoichiometry (n). Repeating the experiment at different temperatures allows determination of the heat capacity change (DeltaC(P)) of the interaction. Modern calorimeters are sensitive enough to probe even weak biological interactions making ITC a very popular method among biochemists. Although ITC has been applied to protein studies for many years, it is becoming widely applicable in RNA biochemistry as well, especially in studies which involve RNA folding and RNA interactions with small molecules, proteins and with other RNAs. This review focuses on best practices for planning, designing and executing effective ITC experiments when one or more of the reactants is an RNA.     

The monovalent cation-induced association of formyltetrahydrofolate synthetase subunits. Kinetic and thermodynamic aspects.

Formyltetrahydrofolate synthetase monomers are converted to catalytically active tetramers in the presence of monovalent cations. The stoichiometry of the reaction is 4M + 2C+ in equilibrium M4C2(2+). A positive deltaS compensates for an unfavorable positive deltaH so that the overall reaction is exergonic. Both deltaH and deltaS become more positive as the temperature is increased. Association of subunits of the enzyme prepared from Clostridium cylindrosporum is second order with respect to monomer concentration, consistent with a rate-determining dimerization step. Activation parameters for this step at 20 degrees are: deltaG, 12.6 kcal mol-1; deltaH, 12.5 kcal mol-1; deltaS, -05 e.u. The rate-limiting step for the cation-dependent association of Clostridium acidi-urici monomers is believed to be a conformational alteration since first order kinetics is observed. The Eyring plot of the kinetic data obtained for the C. acidi-urici system has a sharp break at 15 degrees. Activation parameters for cation-induced association at 20 degrees are: deltaG, 21.5 kcal mol-1; deltaH, 14.0 kcal mol-1; deltaS, -26.6 e.u.     

Thermal and urea-induced unfolding of the marginally stable lac repressor DNA-binding domain: a model system for analysis of solute effects on protein processes

Thermodynamic and structural evidence indicates that the DNA binding domains of lac repressor (lacI) exhibit significant conformational adaptability in operator binding, and that the marginally stable helix-turn-helix (HTH) recognition element is greatly stabilized by operator binding. Here we use circular dichroism at 222 nm to quantify the thermodynamics of the urea- and thermally induced unfolding of the marginally stable lacI HTH. Van't Hoff analysis of the two-state unfolding data, highly accurate because of the large transition breadth and experimental access to the temperature of maximum stability (T(S); 6-10 degrees C), yields standard-state thermodynamic functions (deltaG(o)(obs), deltaH(o)(obs), deltaS(o)(obs), deltaC(o)(P,obs)) over the temperature range 4-40 degrees C and urea concentration range 0 相似文献   

Design, synthesis, and evaluation of linear and cyclic peptide ligands for PDZ10 of the multi-PDZ domain protein MUPP1

PDZ10 is the 10th of 13 PDZ domains found within MUPP1, a cytoplasmic scaffolding protein first identified as an endogenous binding partner of serotonin receptor type 2c (5HT2c). This association, as with those of several other interacting proteins that have subsequently been identified, is mediated through the C-terminal tail of the PDZ domain partner. Using isothermal titration calorimetry (ITC), we measured the thermodynamic binding parameters [changes in Gibbs free energy (DeltaG), enthalpy (DeltaH) and entropy (TDeltaS)] of the isolated PDZ10 domain for variable-length N-acetylated peptides from the 5HT2c serotonin receptor C-terminal sequence, as well as for octapeptides of eight other putative partner proteins of PDZ10 (5HT2a, hc-kit, hTapp1, mTapp2, TARP, NG2, claudin-1, and HPV-18 E6). In length dependence studies of the 5HT2c sequence, the maximal affinity of the peptides leveled off rapidly and further elongation did not significantly improve the dissociation constant (Kd) of 11 microM observed with the pentapeptide. Among the native partners of PDZ10, octapeptides derived from the hc-kit and 5HT2c proteins were the strongest binders, with Kd values of 5.2 and 8.5 microM, respectively. The heat capacity change (DeltaCp) for the 5HT2c octapeptide was determined to be -94 cal/mol, and a calculated estimate indicates burial of polar and apolar surface areas in equal measure upon ligand binding. Peptides with phosphoserine at either the P-1 or P-2 position experienced decreased affinity, which is in accord with the hypothesis that reversible phosphorylation is a possible mechanism for regulating PDZ domain-mediated interactions. Additionally, two conformationally constrained side chain-bridged cyclic peptide ligands were also designed, prepared, evaluated by ITC, and shown to bind PDZ10 primarily through a favorable change in entropy.     

Isothermal titration calorimetry of protein-protein interactions.

The interaction of biologicalmacromolecules, whether protein-DNA, antibody-antigen, hormone-receptor, etc., illustrates the complexity and diversity of molecular recognition. The importance of such interactions in the immune response, signal transduction cascades, and gene expression cannot be overstated. It is of great interest to determine the nature of the forces that stabilize the interaction. The thermodynamics of association are characterized by the stoichiometry of the interaction (n), the association constant (K(a)), the free energy (DeltaG(b)), enthalpy (DeltaH(b)), entropy (DeltaS(b)), and heat capacity of binding (DeltaC(p)). In combination with structural information, the energetics of binding can provide a complete dissection of the interaction and aid in identifying the most important regions of the interface and the energetic contributions. Various indirect methods (ELISA, RIA, surface plasmon resonance, etc.) are routinely used to characterize biologically important interactions. Here we describe the use of isothermal titration calorimetry (ITC) in the study of protein-protein interactions. ITC is the most quantitative means available for measuring the thermodynamic properties of a protein-protein interaction. ITC measures the binding equilibrium directly by determining the heat evolved on association of a ligand with its binding partner. In a single experiment, the values of the binding constant (K(a)), the stoichiometry (n), and the enthalpy of binding (DeltaH(b)) are determined. The free energy and entropy of binding are determined from the association constant. The temperature dependence of the DeltaH(b) parameter, measured by performing the titration at varying temperatures, describes the DeltaC(p) term. As a practical application of the method, we describe the use of ITC to study the interaction between cytochrome c and two monoclonal antibodies.     

A thermodynamic comparison of HPr proteins from extremophilic organisms

A thermodynamic stability study of five histidine-containing phosphocarrier protein (HPr) homologues derived from organisms inhabiting diverse environments is described. These HPr homologues are from Bacillus subtilis (Bs), Streptococcus thermophilus (St), Bacillus staerothermophilus (Bst), Bacillus halodurans (Bh), and Oceanobacillus iheyensis (Oi). Analyses of solvent and thermal denaturation experiments provide the cardinal thermodynamic parameters, like deltaG, deltaH, deltaS, T(m), and deltaC(p), that characterize the conformational stability for each homologue. The homologue from Bacillus staerothermophilus (BstHPr) was established as the most thermostable homologue and also the homologue with highest deltaG at all temperatures. A good correlation between habitat temperature of the organism and thermal stability of the protein is also seen. Stability curves (deltaG vs T) for every homologue are also reported; these reveal very similar deltaC(p) and temperature of maximum stability (T(S)) values for all HPr homologues. Stability curves show that the higher thermal stability of some homologues is not a result of change in curvature of the curve or a shift to higher temperature, but rather a displacement of the stability curves to higher deltaG values. Stability curves also allowed estimation of deltaG at habitat temperature of the organisms, and we find good agreement between homologues. Electrostatic contributions to stability of each homologue were investigated by measuring stability as a function of varying pH and NaCl concentration, and our results suggest that most HPr homologues share similar electrostatic contributions to stability.     

Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes.

To improve the previous DNA/DNA nearest-neighbor parameters, thermodynamic parameters (deltaH degrees, deltaS degrees and deltaG degrees) of 50 DNA/DNA duplexes were measured. Enthalpy change of a helix initiation factor is also considered though the parameters reported recently did not contain the factor. A helix initiation factor for DNA/DNA duplex determined here was the same as that of RNA/RNA duplex (deltaG degrees(37) = 3.4 kcal/mol). The improved nearest-neighbor parameters reproduced not only these 50 experimental values used here but also 15 other experimental values obtained in different studies. Comparing deltaG degrees(37) values of DNA/DNA nearest-neighbor parameters obtained here with those of RNA/RNA and RNA/DNA, RNA/RNA duplex was generally the most stable of the three kinds of duplexes with the same nearest-neighbor sequences. Which is more stable between DNA/DNA and RNA/DNA duplexes is sequence dependent.     

Survey of the year 2008: applications of isothermal titration calorimetry

Isothermal titration calorimetry (ITC) is a fast, accurate and label‐free method for measuring the thermodynamics and binding affinities of molecular associations in solution. Because the method will measure any reaction that results in a heat change, it is applicable to many different fields of research from biomolecular science, to drug design and materials engineering, and can be used to measure binding events between essentially any type of biological or chemical ligand. ITC is the only method that can directly measure binding energetics including Gibbs free energy, enthalpy, entropy and heat capacity changes. Not only binding thermodynamics but also catalytic reactions, conformational rearrangements, changes in protonation and molecular dissociations can be readily quantified by performing only a small number of ITC experiments. In this review, we highlight some of the particularly interesting reports from 2008 employing ITC, with a particular focus on protein interactions with other proteins, nucleic acids, lipids and drugs. As is tradition in these reviews we have not attempted a comprehensive analysis of all 500 papers using ITC, but emphasize those reports that particularly captured our interest and that included more thorough discussions we consider exemplify the power of the technique and might serve to inspire other users. Copyright © 2010 John Wiley & Sons, Ltd.     

Applications of isothermal titration calorimetry in protein science

During the past decade, isothermal titration calorimetry (ITC) has developed from a specialist method for understanding molecular interactions and other biological processes within cells to a more robust, widely used method. Nowadays, ITC is used to investigate all types of protein interactions, including protein-protein interactions, protein-DNA/RNA interactions, protein-small molecule interactions and enzyme kinetics; it provides a direct route to the complete thermodynamic characterization of protein interactions. This review concentrates on the new applications of ITC in protein folding and misfolding, its traditional application in protein interactions, and an overview of what can be achieved in the field of protein science using this method and what developments are likely to occur in the near future. Also, this review discusses some new developments of ITC method in protein science, such as the reverse titration of ITC and the displacement method of ITC.