Structural conservation of the transposon Tam3 family in Antirrhinum majus and estimation of the number of copies able to transpose

We have investigated the organization of the transposon Tam3 family in Antirrhinum majus. Genomic hybridization experiments and characterization of 40 independent Tam3 clones isolated from an A. majus plant revealed that the Tam3 family is quite conserved and the copy sizes are uniform. We did not find any copy with a deleted internal sequence, unlike what is usually observed in other transposons. This exceptionally conserved structure of the Tam3 family was confirmed by PCR and sequencing analyses. Sequencing analysis identified eight copies with sequences completely identical to that of the Tam3 transposase gene. These results suggested that a considerable number of autonomous Tam3 copies are present in the genome of A. majus. Among 24 copies which are surrounded by single copy regions of the genome, 14 copies are present as specific insertions in the line which we used, but absent in other lines. These copies are therefore predicted to be movable. If this ratio is the same for all Tam3 copies in a genome, then a maximum of 60% of the copies are estimated to be movable in the genome. The relatively high frequency of gene tagged by Tam3 might reflect the large number of movable copies in the genome.     

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.     

Menin links the stress response to genome stability in Drosophila melanogaster

Background

The multiple endocrine neoplasia type I gene functions as a tumor suppressor gene in humans and mouse models. In Drosophila melanogaster, mutants of the menin gene (Mnn1) are hypersensitive to mutagens or gamma irradiation and have profound defects in the response to several stresses including heat shock, hypoxia, hyperosmolarity and oxidative stress. However, it is not known if the function of menin in the stress response contributes to genome stability. The objective of this study was to examine the role of menin in the control of the stress response and genome stability.

Methodology/Principal Findings

Using a test of loss-of-heterozygosity, we show that Drosophila strains lacking a functional Mnn1 gene or expressing a Mnn1 dsRNA display increased genome instability in response to non-lethal heat shock or hypoxia treatments. This is also true for strains lacking all Hsp70 genes, implying that a precise control of the stress response is required for genome stability. While menin is required for Hsp70 expression, the results of epistatic studies indicate that the increase in genome instability observed in Mnn1 lack-of-function mutants cannot be accounted for by mis-expression of Hsp70. Therefore, menin may promote genome stability by controlling the expression of other stress-responsive genes. In agreement with this notion, gene profiling reveals that Mnn1 is required for sustained expression of all heat shock protein genes but is dispensable for early induction of the heat shock response.

Conclusions/Significance

Mutants of the Mnn1 gene are hypersensitive to several stresses and display increased genome instability when subjected to conditions, such as heat shock, generally regarded as non-genotoxic. In this report, we describe a role for menin as a global regulator of heat shock gene expression and critical factor in the maintenance of genome integrity. Therefore, menin links the stress response to the control of genome stability in Drosophila melanogaster.     

Biological consequences of ancient gene acquisition and duplication in the large genome of Candidatus Solibacter usitatus Ellin6076

Members of the bacterial phylum Acidobacteria are widespread in soils and sediments worldwide, and are abundant in many soils. Acidobacteria are challenging to culture in vitro, and many basic features of their biology and functional roles in the soil have not been determined. Candidatus Solibacter usitatus strain Ellin6076 has a 9.9 Mb genome that is approximately 2-5 times as large as the other sequenced Acidobacteria genomes. Bacterial genome sizes typically range from 0.5 to 10 Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Our comparative genome analyses indicate that the Ellin6076 large genome has arisen by horizontal gene transfer via ancient bacteriophage and/or plasmid-mediated transduction, and widespread small-scale gene duplications, resulting in an increased number of paralogs. Low amino acid sequence identities among functional group members, and lack of conserved gene order and orientation in regions containing similar groups of paralogs, suggest that most of the paralogs are not the result of recent duplication events. The genome sizes of additional cultured Acidobacteria strains were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 3 had larger genomes than those of subdivision 1, but none were as large as the Ellin6076 genome. The large genome of Ellin6076 may not be typical of the phylum, and encodes traits that could provide a selective metabolic, defensive and regulatory advantage in the soil environment.     

The process of genome shrinkage in the obligate symbiont Buchnera aphidicola

Background  

Very small genomes have evolved repeatedly in eubacterial lineages that have adopted obligate associations with eukaryotic hosts. Complete genome sequences have revealed that small genomes retain very different gene sets, raising the question of how final genome content is determined. To examine the process of genome reduction, the tiny genome of the endosymbiont Buchnera aphidicola was compared to the larger ancestral genome, reconstructed on the basis of the phylogenetic distribution of gene orthologs among fully sequenced relatives of Escherichia coli and Buchnera.     

Genetic relationship between the Mus cervicolor M432 retrovirus and the Mus Musculus intracisternal type A particle

The genetic relationship between the retrovirus-like intracisternal type A particle (IAP) from Mus musculus and the novel retrovirus (M432) from M. cervicolor has been determined by heteroduplex and restriction endonuclease analyses of molecular clones of the respective genomes. We have found a major homology region (3.7 kilobase pairs) which probably begins near the 3' end of the M432 gag gene, spans the pol gene, and ends in the env gene. A second region (0.6 kilobase pairs) of weak homology was also observed adjacent to the 3' long terminal repeats of the respective genomes. The IAP genome is well conserved in the cellular DNA of all species of the genus Mus. In contrast, cellular DNA sequences related to the 5' end of the M432 genome, which shares no homology with the IAP genome, are found only in M. cervicolor and the closely related species M. cookii. These results suggest that the infectious M432 retroviral genome arose as a result of a recombinational event(s) between the IAP genome and another, as yet unidentified, class of retrovirus-related sequences or other cellular sequences.     

Comparative human-mouse-rat sequence analysis of the ICAM gene cluster on HSA 19p13.2 and a 185-kb porcine region from SSC 2q

The human intercellular adhesion molecule gene (ICAM) cluster is located in a GC-rich and gene-rich region on HSA 19p13.2. We determined the complete DNA sequence of a 185-kb porcine bacterial artificial chromosome (BAC) clone containing parts of the ICAM gene cluster. We used the porcine sequence for a detailed comparative analysis between human, pig, mouse and rat. The 185 kb of porcine sequence covered 220 kb of homologous sequence in the human genome, which adds to the growing evidence that the porcine genome is somewhat smaller than the human genome. The genomic sequences of the four species showed a high level of conserved synteny and no rearrangements in gene order were observed. During evolution, the ICAM3 gene was inactivated by mutation in the mouse and rat genome, whereas it is still present in the human and pig genome. The loss of Icam3 in rodent genomes might be relevant for rodent-specific properties of the T-cell-mediated immune response. All the other investigated genes are conserved across all four investigated sequences.     

Sequence of 3,687 nucleotides from the 3' end of Sendai virus genome RNA and the predicted amino acid sequences of viral NP, P and C proteins.

The sequence of 3,687 nucleotides from the 3' end of the Sendai virus genome (Z strain) was determined by a molecular cloning technique followed by rapid sequence analysis. Two large open reading frames, one consisting of 1,572 nucleotides and the other of 1,704 nucleotides, were observed in the region, that is OP-1 and OP-2 from the 3' end of the genome. The amino acid sequences of the gene products were predicted from the observed sequence. Determination of amino acid compositions of viral proteins, P, HN, Fo, NP and M, led us to conclude that NP and P are the gene products of OP-1 and OP-2, respectively. An additional open reading frame consisting of 612 nucleotides (OP-3) was discovered in the 3' most proximal region of OP-2. The predicted product of OP-3 was considered to be viral non-structural protein C. The leader sequence of 51 nucleotides at the 3' terminal of the genome and consensus sequences at 3' and 5' ends of each gene for proteins NP and P were identified.     

CTCF mediates the cell-type specific spatial organization of the Kcnq5 locus and the local gene regulation

Chromatin loops play important roles in the dynamic spatial organization of genes in the nucleus. Growing evidence has revealed that the multivalent functional zinc finger protein CCCTC-binding factor (CTCF) is a master regulator of genome spatial organization, and mediates the ubiquitous chromatin loops within the genome. Using circular chromosome conformation capture (4C) methodology, we discovered that CTCF may be a master organizer in mediating the spatial organization of the kcnq5 gene locus. We characterized the cell-type specific spatial organization of the kcnq5 gene locus mediated by CTCF in detail using chromosome conformation capture (3C) and 3C-derived techniques. Cohesion also participated in mediating the organization of this locus. RNAi-mediated knockdown of CTCF sharply diminished the interaction frequencies between the chromatin loops of the kcnq5 gene locus and down-regulated local gene expression. Functional analysis showed that the interacting chromatin loops of the kcnq5 gene locus can repress the gene expression in a luciferase reporter assay. These interacting chromatin fragments were a series of repressing elements whose contacts were mediated by CTCF. Therefore, these findings suggested that the dynamical spatial organization of the kcnq5 locus regulates local gene expression.     

The plastid-encoded psbA gene in the dinoflagellate Gonyaulax is not encoded on a minicircle

In all dinoflagellate species studied to date, the plastid genome is highly reduced, with many genes normally found in the plastid genome found instead encoded by the nucleus. Furthermore, those genes still remaining in the plastid are found as primarily single gene minicircles whose size is typically only 2-3 kb. We show here that the plastid genome architecture in the dinoflagellate Gonyaulax polyedra is unusual for this class of organism. In particular, the psbA gene is associated with DNA of roughly 50-150 kb and appears to have an unusually high complexity.     

The distribution of genes in the Drosophila genome

In the present work we show that in the Drosophila genome (which covers a 37-51% GC range at a DNA size of approx.50kb) a linear correlation holds between GC (or GC(3)50kb) genomic sequences embedding them. This correlation allows us to position the two compositional distributions of (a) coding sequences, and (b) of long DNA segments relative to each other and to calculate gene concentration across the compositional range of the Drosophila genome. Using this approach, we show that gene concentration increases with increasing GC of the regions embedding the genes, reaching a 7-fold higher level in the GC-richest regions compared with the GC-poorest regions. The gene distribution of the Drosophila genome is, therefore, similar to (although less striking than) that of the human genome, whereas it is very different from those of the Arabidopsis genome, which has about the same size as the Drosophila genome.     

Evolution of the Alx homeobox gene family: parallel retention and independent loss of the vertebrate Alx3 gene

The Alx gene family is implicated in craniofacial development and comprises two to four homeobox genes in each vertebrate genome analyzed. Using phylogenetics and comparative genomics, we show that the common ancestor of jawed vertebrates had three Alx genes descendent from the two-round genome duplications (Alx1, Alx3, Alx4), compared with a single amphioxus gene. Later in evolution one of the paralogues, Alx3, was lost independently from at least three different vertebrate lineages, whereas Alx1 and Alx4 were consistently retained. Comparison of spatial gene expression patterns reveals that the three mouse genes have equivalent craniofacial expression to the two chick and frog genes, suggesting that redundancy compensated for gene loss. We suggest that multiple independent loss of one Alx gene was predisposed by extensive and persistent overlap in gene expression between Alx paralogues. Even so, it is unclear whether it was coincidence or evolutionary bias that resulted in the same Alx gene being lost on each occasion, rather than different members of the gene family.