Analysis of the genomic organisation of a small chromosome of Leishmania braziliensis M2903 reveals two genes encoding GTP-binding proteins, one of which belongs to a new G-protein family and is an antigen

Leishmania braziliensis M2903 contains a highly amplified small chromosome. This work is aimed at resolving its structural organization and determining whether this unusual chromosome contains specific genes encoding proteins with important functions in disease pathology or drug resistance. Our results show that the M2903 250-kb small chromosome contains LD1 sequences and has an inverted repeat structure. The LD1 sequences and two cDNAs (cDNA2 and cDNA53) were mapped on a cosmid contig, and the two cDNAs and the corresponding genomic fragments from the small chromosome were sequenced. The gene encoding cDNA2 predicts a putative GTP-binding protein with homology to other GTP-binding proteins only in the G-1 domain region; however, four other conserved motifs can be recognized. Sequence similarity to cDNA53 is located in at least five chromosomes, and its small chromosome copy is a pseudogene. An open reading frame downstream of the cDNA53 pseudogene predicts another GTP-binding protein that belongs to a new G-protein family with an unusual conserved GTP-binding domain and a newly characterized conserved sequence motif. A portion of this GTP-binding protein gene was studied previously in L. aethiopica as a recombinant antigen that reacts with human antibodies.     

The human phosphoglycerate kinase multigene family. HLA-associated sequences and an X-linked locus containing a processed pseudogene and its functional counterpart

Several phosphoglycerate kinase genes were previously detected in the human genome by blot hybridization with a phosphoglycerate kinase cDNA probe. Using subcloned fragments of the cDNA we estimate the presence of four independent phosphoglycerate kinase genes. These genes have been mapped to both the human X chromosome (band q13) and chromosome 6 (p12-21.1) using a panel of human-rodent somatic cell hybrids and by chromosomal in situ hybridization. The genomic distribution of phosphoglycerate kinase sequences is conserved in man and mouse, not only for the X chromosome, but also for linkage to the respective major histocompatibility complexes. Molecular cloning of X-linked phosphoglycerate kinase sequences led to the identification of a novel intronless phosphoglycerate kinase pseudogene which is localized proximal to the active gene on the X chromosome.     

Analysis of the tissue-specific expression, developmental regulation, and linkage relationships of a rodent gene encoding heart fatty acid binding protein

The rat contains at least three homologous cytosolic proteins that bind long chain fatty acids, termed liver (L-), intestinal (I-), and heart (H-) fatty acid binding protein (FABP). I-FABP mRNA is confined to the gastrointestinal tract while L-FABP mRNA is abundantly represented in hepatocytes as well as enterocytes. We have isolated a rat heart FABP cDNA clone and determined the pattern of H-FABP mRNA accumulation in a wide variety of tissues harvested from late fetal, suckling, weaning, and adult rats. RNA blot hybridizations and primer extension analysis disclosed that the distribution of H-FABP mRNA in adult rat tissues is different from that of I- or L-FABP mRNA. H-FABP mRNA is most abundant in adult heart. This mRNA was also present in an adult slow twitch (type I) skeletal muscle (soleus, 63% of the concentration in heart), testes (28%), a fast twitch skeletal muscle (psoas, 17%), brain (10%), kidney (5%), and adrenal gland (5%). H-FABP mRNA was not detected in adult small intestine, colon, spleen, lung, or liver RNA. Distinct patterns of developmental change in H-FABP mRNA accumulation were documented in heart, placenta, brain, kidney, and testes. Myocardial H-FABP mRNA levels rise rapidly during the 48 h prior to and after birth, reaching peak levels by the early weaning period. The postnatal increase in myocardial H-FABP mRNA concentration and its relative distribution in adult fast and slow twitch skeletal muscle are consistent with its previously proposed function in facilitating mitochondrial beta-oxidation of fatty acids. However, the presence of H-FABP mRNA in brain, a tissue which does not normally significantly oxidize fatty acids in late postnatal life, suggests that H-FABP may play a wider role in fatty acid metabolism than previously realized. Mouse-hamster somatic cell hybrids were utilized to map H-FABP. Using stringencies which did not produce cross-hybridization between L-, I-, and H-FABP DNA sequences, we found at least three loci in the mouse genome, each located on different chromosomes, which reacted with our cloned H-FABP cDNA. None of these H-FABP-related loci were linked to the gene which specifies a highly homologous adipocyte-specific protein termed aP2 or to genes encoding two other members of this protein family, cellular retinol binding protein and cellular retinol binding protein II.(ABSTRACT TRUNCATED AT 400 WORDS)     

Histochemical localization of heart-type fatty-acid binding protein in human and murine tissues

Cellular fatty acid-binding proteins (FABP) are a highly conserved family of proteins consisting of several subtypes, among them the mammary-derived growth inhibitor (MDGI) which is quite homologous to or even identical with the heart-type FABP (H-FABP). The FABPs and MDGI have been suggested to be involved in intracellular fatty acid metabolism and trafficking. Recently, evidence for growth and differentiation regulating properties of MDGI and H-FABP was provided. Using four affinity-purified polyclonal antibodies against bovine and human antigen preparations, the cellular localization of MDGI/H-FABP in human and mouse tissues and organs was studied. The antibodies were weakly cross-reactive with adipose tissue extracts known to lack H-FABP, but failed to react by Western blot analysis with liver-type FABP (L-FABP) and intestinal-type FABP (I-FABP). MDGI/H-FABP protein was mainly detected in myocardium, skeletal and smooth muscle fibres, lipid and/or steroid synthesising cells (adrenals, Leydig cells, sebaceous glands, lactating mammary gland) and terminally differentiated epithelia of the respiratory, intestinal and urogenital tracts. The results provide evidence that expression of H-FABP is associated with an irreversibly postmitotic and terminally differentiated status of cells. Since all the antisera employed showed spatially identical and qualitatively equal immunostaining, it is suggested that human, bovine and mouse MDGI/H-FABP proteins share highly homologous epitopes.     

Chromosomal localization of human Na+, K+-ATPase alpha- and beta-subunit genes

Na+, K+-ATPase is a heterodimeric enzyme responsible for the active maintenance of sodium and potassium gradients across the plasma membrane. Recently, cDNAs for several tissue-specific isoforms of the larger catalytic alpha-subunit and the smaller beta-subunit have been cloned. We have hybridized rat brain and human kidney cDNA probes, as well as human genomic isoform-specific DNA fragments, to Southern filters containing panels of rodent X human somatic cell hybrid lines. The results obtained have allowed us to assign the loci for the ubiquitously expressed alpha-chain (ATP1A1) to human chromosome 1, region 1p21----cen, and for the alpha 2 isoform that predominates in neural and muscle tissues (ATP1A2) to chromosome 1, region cen----q32. A common PstI RFLP was detected with the ATP1A2 probe. The alpha 3 gene, which is expressed primarily in neural tissues (ATP1A3), was assigned to human chromosome 19. A fourth alpha gene of unknown function (alpha D) that was isolated by molecular cloning (ATP1AL1) was mapped to chromosome 13. Although evidence to date had suggested a single gene for the beta-subunit, we found hybridizing restriction fragments derived from two different human chromosomes. On the basis of knowledge of conserved linkage groups on human and murine chromosomes, we propose that the coding gene ATP 1B is located on the long arm of human chromosome 1 and that the sequence on human chromosome 4 (ATP 1BL1) is either a related gene or a pseudogene.     

Evidence for the presence of HABP1 pseudogene in multiple locations of mammalian genome

The gene encoding hyaluronan-binding protein 1 (HABP1) is expressed ubiquitously in different rat tissues, and is present in eukaryotic species from yeast to humans. Fluorescence in situ hybridization indicates that this is localized in human chromosome 17p13.3. Here, we report the presence of homologous sequences of HABP1 cDNA, termed processed HABP1 pseudogene in humans. This is concluded from an additional PCR product of ~0.5 kb, along with the expected band at approximately 5 kb as observed by PCR amplification of human genomic DNA with HABP1-specific primers. Partial sequencing of the 5-kb PCR product and comparison of the HABP1 cDNA with the sequence obtained from Genbank accession number AC004148 indicated that the HABP1 gene is comprised of six exons and five introns. The 0.5-kb additional PCR product was confirmed to be homologous to HABP1 cDNA by southern hybridization, sequencing, and by a sequence homology search. Search analysis with HABP1 cDNA sequence further revealed the presence of similar sequence in chromosomes 21 and 11, which could generate ~0.5 kb with the primers used. In this report, we describe the presence of several copies of the pseudogene of HABP1 spread over different chromosomes that vary in length and similarity to the HABP1 cDNA sequence. These are 1013 bp in chromosome 21 with 85.4% similarity, 1071 bp in chromosome 11 with 87.2% similarity, 818 bp in chromosome 15 with 82.3% similarity, and 323 bp in chromosome 4 with 84% similarity to HABP1 cDNA. We have also identified similar HABP1 pseudogenes in the rat and mouse genome. The human pseudogene sequence of HABP1 possesses a 10 base pair direct repeat of "AGAAAAATAA" in chromosome 21, a 12-bp direct repeat of "AG/CAAATTA/CAA/TTA" in chromosome 4, a 8-bp direct repeat of "ACAAAG/TCT" in chromosome 15. In the case of chromosome 11, there is an inverted repeat of "AGCCTGGGCGACAGAGCGAGA" ~50 bp upstream of the HABP1 pseudogene sequence. All of the HABP1 pseudogene sequences lack 5' promoter sequence and possess multiple mutations leading to the insertion of premature stop codons in all three reading frames. Rat and mouse homologs of the HABP1 pseudogene also contain multiple mutations, leading to the insertion of premature stop codons confirming the identity of a processed pseudogene.     

The human thyroglobulin gene: A polymorphic marker localized distal to C-MYC on chromosome 8 band q24

Summary We have used a cDNA clone for human phosphoglycerate kinase (PGK) to examine the chromosomal localization of three members of the human PGK gene family. Using somatic cell hybrids segregating portions of several X-autosome translocations as well as a clone panel of hybrids segregating radiation-induced fragments of the human X chromosome, we assign a PGK pseudogene to the region Xq11–Xq13, proximal to the functional X-linked PGK gene located in Xq13. In addition, using a panel of 24 somatic cell hybrids, we assign an autosomal PGK-related DNA sequence to human chromosome 19.     

A comparison of heart and liver fatty acid-binding proteins: interactions with fatty acids and possible functional differences studied with fluorescent fatty acid analogues

Summary Fatty acid-binding proteins (FABP) are distinct but related gene products which are found in many mammalian cell types. They are generally present in high abundance, and are found in those tissues where free fatty acid (ffa) flux is high. The function(s) of FABP is unknown. Also not known is whether all FABP function similarly in their respective cell types, or whether different FABP have unique functions. The purpose of these studies was to assess whether different members of the FABP family exhibit different structural and functional properties. Two fluorescent analogues of ffa were used to compare the liver (L-FABP) and heart (H-FABP) binding proteins. The propionic acid derivative of diphenylhexatriene (PADPH) was used to examine the physical properties of the ffa binding site on L- and H-FABP, as well as the relative distribution of ffa between FABP and membranes. An anthroyloxy-derivative of palmitic acid, 2AP, was used to monitor the transfer kinetics of ffa from liver or heart FABP to acceptor membranes, using a resonance energy transfer assay. The results demonstrate that the ffa binding sites of both FABP are hydrophobic in nature, although the L-FABP site is more nonpolar than the H-FABP site. Equilibration of PADPH between L-FABP and phosphatidylcholine (PC) bilayers resulted in a molar partition preference of > 20: 1, L-FABP : PC. Similar studies with H-FABP resulted in a PADPH partition preference of only 3:1, H-FABP : PC. Finally, the transfer of 2AP from H-FABP to acceptor membranes was found to be 50-fold faster than transfer from L-FABP. These studies demonstrate that important structural and functional differences exist between different members of the FABP family, and therefore imply that the roles of different FABP may be unique.Abbreviations FABP Fatty Acid-Binding Protein - L-FABP Liver FABP - H-FABP Heart FABP - SUV Small Unilamellar Vesicle - PADPH 3-[p-(6-Phenyl)-1,3,5-Hexatrienyl]-phenylpropionic acid - 2AP 2-(9-Anthroyloxy)Palmitic acid - Q Quantum yield - _F Fluorescence lifetime     

Linkage map of two HLA-SB beta and two HLA-SB alpha-related genes: an intron in one of the SB beta genes contains a processed pseudogene

Three overlapping cosmid clones contain coding sequences for four HLA Class II genes, provisionally identified as two HLA-SB alpha and two HLA-SB beta genes. The genes are in the order beta, alpha, beta, alpha, inverted with respect to each other. One of the SB beta genes contains a 513 bp sequence that appears to be a processed pseudogene, flanked by direct 17 bp repeat sequences, in the intron upstream of the beta 1 exon. The pseudogene is homologous to a family of sequences of approximately 25-40 members, most of which are not on chromosome 6. A cDNA clone, highly homologous to the pseudogene, except for its 5' end, contains a normal poly(A) addition site and a poly(A) tail. The cDNA clone is homologous to a single-copy gene in both man and mouse, encoded on human chromosome 15. A search of published DNA sequences identified a mouse sequence, with about 77% similarity to the pseudogene sequence, in the negative strand of an intron in a mouse dihydrofolate reductase gene. The second SB beta gene does not contain the pseudogene sequence.     

Cloning,expression and genomic structure of a novel human GNB2L1 gene,which encodes a receptor of activated protein kinase C (RACK)*

During a large-scale screen of a human fetal brain cDNA library, a novel human gene GNB2L1 encoding a novel RACK (receptor of activated protein kinase C) protein was isolated and sequenced. The cDNA is 1142 bp long and has a predicted open reading frame encoding 316 aa. The predicted protein shows higher similarity to rat RACK1 and many RACK proteins of different organisms including Drosophila, C. elegans, mouse, rat, human, C. fasciculata, zebrafish, A. thaliana, S. cerevisiae and so on, suggesting it is conserved during evolution. The gene was mapped to human chromosome 5q35.3, the telomer position of chromosome 5q, in which the disease gene for early-onset primary congenital lymphedema was mapped. Also, 5q35.3 is a frequently reported location for cytogenetic and molecular abnormalities in renal cell carcinomas. The gene has 8 exons and 7 introns. It is expressed ubiquitously in many human tissues detected by northern blot analysis and RT-PCR.     

The 239AB gene on chromosome 22: a novel member of an ancient gene family

A novel family of genes expressed in human brain has recently been identified. Gene 239FB, transcribed extensively in fetal brain, was isolated from the chromosome 11p13 region associated with mental retardation component of the WAGR (Wilms tumor, aniridia, genitourinary anomalies, mental retardation) syndrome. This report presents a cDNA sequence and expression profile of a related gene, 239AB, isolated from adult brain library, that was mapped to chromosome 22. While similar in structure, the two genes differ in their expression pattern and may have different roles in central nervous system development and function. In contrast to the 239FB, which is expressed predominantly in fetal brain, the 239AB gene is transcribed in adult tissues. Both human genes encode novel proteins of unknown function that are highly conserved from Caenorhabditis elegans to birds and mammals. Phylogenetic analysis suggested that the two lineages of the ancient gene family represented by 239FB and 239AB have been in existence prior to the emergence of modern animals.     

Polymorphism of Heart Fatty Acid-Binding Protein Gene Associatied with Fatness Traits in the Chicken

Fatty acid-binding proteins (FABP) belong to a superfamily of lipid binding proteins that exhibit a high affinity for long chain fatty acids and appear to function in metabolism and intracellular transportation of lipids. The current study was designed to investigate the effects of heart (H)-FABP gene on chicken growth and body composition traits. The Northeast Agricultural University divergent broiler lines for abdominal fat and a broiler X silkie F₂ population were used in this study. Body weight and body composition traits were measured in the populations. Primers were designed according to the chicken H-FABP gene sequence. Polymorphisms between parental lines were detected by DNA sequencing. PCR-RFLP and PCR-fragment length polymorphism methods were developed to genotype the populations. The results showed that the H-FABP gene polymorphisms in the two populations were associated with abdominal fat percentage. It implied that H-FABP gene can be a candidate locus or linked to a major gene(s) that affects abdominal fat content in the chicken.     

Chromosomal mapping,tissue distribution and cDNA sequence of Four-and-a-half LIM domain protein 1 (FHL1)

We have isolated and sequenced a human heart cDNA clone encoding a novel LIM-only protein. This full-length cDNA clone has a predicted open reading frame (ORF) encoding 280 amino acids. The ORF of this cDNA codes for a LIM-only protein that possesses four repeats of LIM domain and an extra zinc finger and this putative protein is named four-and-a-half LIM domain protein 1 (FHL1). FHL1 is unique when compared with other LIM-only proteins because it possesses an odd number of zinc fingers. When the FHL1 cDNA probe was used to hybridize with poly-(A) RNA of various human tissues, a very strong signal was detected in skeletal muscle, a moderate one in the heart; only weak signals were associated with the placenta, ovary, prostate, testis, small intestine, colon and spleen, and virtually no signal could be detected in brain, lung, liver, kidney, pancreas, thymus and peripheral blood leukocytes. The FHL1 gene was located to human chromosome at Xq27.2 by somatic cell hybrid mapping, fluorescent in situ hybridization (FISH) and radiation hybrid mapping.     

Genomic Organization,Fine-Mapping,and Expression of the HumanIslet-Brain 1 (IB1)/C-Jun-Amino-Terminal Kinase Interacting Protein-1 (JIP-1)Gene

Islet-brain 1 (IB1), a regulator of the pancreatic β-cell function in the rat, is homologous to JIP-1, a murine inhibitor of c-Jun amino-terminal kinase (JNK). Whether IB1 and JIP-1 are present in humans was not known. We report the sequence of the 2133-bp human IB1 cDNA, the expression, structure, and fine-mapping of the humanIB1gene, and the characterization of anIB1pseudogene. Human IB1 is 94% identical to rat IB1. The tissue-specific expression of IB1 in human is similar to that observed in rodent. TheIB1gene contains 12 exons and maps to chromosome 11 (11p11.2–p12), a region that is deleted in DEFECT-11 syndrome. Apart from anIB1pseudogene on chromosome 17 (17q21), no additionalIB1-related gene was found in the human genome. Our data indicate that the sequence and expression pattern of IB1 are highly conserved between rodent and human and provide the necessary tools to investigate whether IB1 is involved in human diseases.