Impact of phosphorothioate substitutions on the thermodynamic stability of an RNA GAAA tetraloop: an unexpected stabilization

This study analyzes the impact of phosphorothioate substitutions on the thermodynamic stability of a 12-nt RNA hairpin containing a (5')GAAA(3') tetraloop. The thermodynamic consequences of stereospecific phosphorothioate substitutions 5' to each adenosine in the loop region are measured using optical melting and calorimetry experiments. Surprisingly, a single stereospecific phosphorothioate substitution 5' to the second adenosine of the tetraloop, R(p)-A7, results in a stabilization corresponding to a Delta(DeltaG(37)(degrees)(C)) of approximately -2.9 kcal mol(-1) (0.1 M NaCl) when compared with that of an unmodified sample. Five other phosphorothioate-substituted samples did not show significant thermodynamic differences in comparison with the unsubstituted samples. Addition of Mg(2+) to all of the hairpins studied results in increased t(m's) that are fit with a general electrostatic model to a dissociation constant of K(d)(Mg(2+)) approximately 2-3 mM (0.1 M NaCl). The R(p)-A7 phosphorothioate-substituted hairpin showed an unusual decrease in t(m) and apparent increase in enthalpy of unfolding upon addition of Cd(2+). These results may impact the interpretation of interference mapping experiments that use phosphorothioate substitutions to characterize RNAs in solution.     

Antisense recognition of the HER-2 mRNA: effects of phosphorothioate substitution and polyamines on DNA.RNA, RNA.RNA, and DNA.DNA duplex stability

The HER-2 gene is overexpressed in a subset of breast, ovarian, lung, and pancreatic cancers. Antisense oligonucleotides suppress gene expression depending on the stability of the DNA.RNA hybrids formed at the target site. Polyamines, the cellular cations that interact with DNA and RNA, may influence hybrid stability in the cell. Therefore, we studied the ability of natural polyamines (putrescine, spermidine, and spermine) and a series of their structural analogues to stabilize DNA.RNA and RNA.RNA duplexes using melting temperature (T(m)) measurements and circular dichroism (CD) spectroscopy. Phosphodiester (PO) and phosphorothioate (PS) oligonucleotides (ODNs) (15 nucleotides, 5'-CTCCATGGTGCTCAC-3') targeted to the initiation codon region of the HER-2 mRNA, and complementary RNA and DNA ODNs, were used in this study. The relative order of thermal stability was as follows: RNA.RNA > PO-DNA.RNA > PO-DNA.PO-DNA > PS-DNA.RNA > PS-DNA.PO-DNA > PS-DNA.PS-DNA. The ability of polyamines to stabilize the duplexes improved with the cationicity of the polyamine, with hexamines being more effective than pentamines, which in turn were more effective than tetramines and triamines. However, chemical structural effects were clearly evident with isovalent homologues of spermidine and spermine. CD spectra showed B and A conformations, respectively, for the DNA and RNA helices. DNA.RNA hybrids adopted an intermediate structure between the B and A forms. These data help us to understand the role of endogenous polyamines in DNA.RNA hybrid stabilization, and provide information for designing novel polyamines to facilitate the use of antisense ODNs for controlling HER-2 gene expression.     

DNA and RNA sequencing utilizing phosphorothioate chemistry

A method for nucleic acid sequencing has been developed based on the observation that phosphorothioate diesters are hydrolysed by treatment with 2-iodoethanol in a solution of aqueous ethanol. For DNA sequencing, primed single-stranded M13 DNA is polymerised with the Klenow fragment of DNA polymerase I in the presence of the three normal deoxyribonucleotide triphosphates and one alpha-phosphorothioate derivative. This is followed by treatment with 2-iodoethanol, precipitation of the DNA fragments and analysis by polyacrylamide electrophoresis. RNA transcribed from plasmids containing the SP6 RNA polymerase promoter is sequenced by including the alpha-phosphorothioate derivative of the ribonucleotide triphosphates in the polymerisation and treating the product with iodoethane. The cleavage reaction involves alkylation of the sulfur atom to form the phosphorothioate triester and hydrolysis catalysed by an adjacent hydroxyl group.     

Effect of base stacking on the relative thermodynamic stability of oligonucleotide complexes: a spectroscopic study

Three-strand oligonucleotide complexes are employed to assess the effect of base stacking and base pair mismatch on the relative thermodynamic stabilities of oligonucleotide duplexes. The melting behavior of three-strand oligonucleotide complexes incorporating nicks and gaps as well as internal single base mismatches is monitored using temperature-dependent optical absorption spectroscopy. A sequential three-state equilibrium model is used to analyze the measured melting profiles and evaluate thermodynamic parameters associated with dissociation of the complexes. The free-energy of stabilization of a nick complex compared to a gap complex due to base stacking is determined to be -1.9 kcal/mol. The influence of a mispaired base in these systems is shown to destabilize a nick complex by 3.1 kcal/mol and a gap complex by 2.8 kcal/mol, respectively.     

NMR investigations of duplex stability of phosphorothioate and phosphorodithioate DNA analogues modified in both strands.

Duplex formation from the self-complementary 12mer d(CGCGAATTCGCG) (Dickerson dodecamer) in which all phosphodiester linkages were replaced by phosphorothioate or phosphorodithioate linkages was studied using variable-temperature 1H and 31P NMR spectroscopy. Melting temperatures of the dodecamer, measured spectrophotometrically, showed significant decrease upon sulfur substitution (Tm 49 degrees C for the phosphorothioate and 21 degrees C for the phosphorodithioate, compared with 68 degrees C for the unmodified oligomer, in 1 M salt). Hyperchromicity observed upon melting of the dithioate was surprisingly low. NOESY spectra of the monothioate showed a cross-peak pattern characteristic for a right-handed duplex. Imino proton resonances of the duplex, shown by the mono- and the dithioate, were similar to those of the parent compound. In spite of monophasic melting curves, temperature dependence of the imino proton resonances and phosphorus resonances of the phosphorodithioate indicated heterogeneity with respect to base-pairing, compatible with the presence of a hairpin loop. Relaxation times (T1) of the imino protons in the phosphorothioate, determined by the saturation recovery method, were considerably shorter than in the unmodified oligomer. Base-pair lifetimes in the unmodified Dickerson dodecamer, determined by catalyst-dependent changes in relaxation rates of imino protons, were in the range of 2-30 ms at 20 degrees C. Strongly reduced base-pair lifetimes were found in the phosphorothioate analogue.     

Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation.

A clear difference in the enthalpy changes derived from spectroscopic and calorimetric measurements has recently been shown. The exact interpretation of this deviation varied from study to study, but it was generally attributed to the non-two-state transition and heat capacity change. Although the temperature-dependent thermodynamics of the duplex formation was often implied, systemic and extensive studies have been lacking in universally assigning the appropriate thermodynamic parameter sets. In the present study, the 24 DNA/DNA and 41 RNA/DNA oligonucleotide duplexes, designed to avoid the formation of hairpin or slipped duplex structures and to limit the base pair length less than 12 bp, were selected to evaluate the heat capacity changes and temperature-dependent thermodynamic properties of duplex formation. Direct comparison reveals that the temperature-independent thermodynamic parameters could provide a reasonable approximation only when the temperature of interest has a small deviation from the mean melting temperature over the experimental range. The heat capacity changes depend on the base composition and sequences and are generally limited in the range of -160 to approximately -40 cal.mol-1.K-1 per base pair. In contrast to the enthalpy and entropy changes, the free energy change and melting temperature are relatively insensitive to the heat capacity change. Finally, the 16 NN-model free energy parameters and one helix initiation at physiological temperature were extracted from the temperature-dependent thermodynamic data of the 41 RNA/DNA hybrids.     

Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex

The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.     

Phosphoramidate analogues of DNA: synthesis and thermal stability of heteroduplexes

The deoxyoligonucleotide 5' AATCGGGCATGGATT (15-mer) was synthesized containing 12 phosphoramidate linkages derived from 2 primary and 2 secondary amines. The oligonucleotides were purified by reverse phase HPLC and characterized by PAGE. The thermal stability of the duplexes derived from these compounds, when hybridized to the complementary diester linked oligomer, were determined and compared to the diester and methanephosphonate oligomer. The results indicated that all analogue oligomers form less stable duplexes then the diester oligomer. A large difference was observed between primary and secondary amine derived phosphoramidates.     

Understanding the thermodynamic stability of an RNA hairpin and its mutant.

The thermodynamic stability of RNA hairpin loops has been a subject of considerable interest in the recent past (Wimberly et al., 1991). There have been experimental reports indicating that the hairpins with a C(UUCG)G loop sequence are thermodynamically very stable (Wimberly et al., 1991). We used the solution structure of GGAC(UUCG)GUCC (Cheong et al., 1990; Varani et al., 1991) as the starting conformation in our attempt to understand its thermodynamic stability. We carried out molecular dynamics/free energy simulations to understand the basis for the destabilization of the C(UUCG)G loop by mutating cytosine (C7)-->uracil. Because of the limited length of simulation and the presence of kinetic barriers (solvent intervention) to the uracil-->cytosine mutation, all of our computed free energy differences are based on multiple forward simulations. Based on these calculations we find that the cytosine-->uracil mutation in the loop destabilizes it by approximately 1.5kcal/mol relative to that of the reference state, an A-form RNA but with cytosine (C7) looped out. This is the same sign and magnitude as that observed in the thermodynamic studies carried out by Varani et al.(1991). We have carried out free energy component analysis to understand the effect of mutating the cytosine residue to uracil on the thermodynamic stability of the C(UUCG)G hairpin loops. Our calculations show that the most significant contribution to the stability is from the phosphate group linking U5 and U6, which favors the cytosine residue over uracil by about 6.0 kcal/mol. The residues U5, U6, and G8 in the loop region also contribute significantly to the stability. The contributions from the salt and solvent compensate each other, indicating the dynamic nature of interactions of the environment with the nucleic acid system and the coupling between these two components.     

Synthesis and immunostimulatory properties of the phosphorothioate analogues of cdiGMP

The synthesis of mono- and bisphosphorothioate analogues of 3',5'-cyclic diguanylic acid (cdiGMP) via the modified H-phosphonate chemistry is reported. The immunostimulatory properties of these analogues were compared with those of cdiGMP.     

Effects of monofunctional adducts of platinum(II) complexes on thermodynamic stability and energetics of DNA duplexes

Effects of adducts of [PtCl(NH3)3]Cl or chlorodiethylenetriamineplatinum(II) on DNA stability were studied with emphasis on thermodynamic origins of that stability. Oligodeoxyribonucleotide duplexes (15-bp) containing the single, site-specific monofunctional adduct at G-residues of the central sequences TGT/ACA or 5'-AGT/5'-ACT were prepared and analyzed by differential scanning calorimetry, temperature-dependent ultraviolet absorption and circular dichroism. The unfolding of the platinated duplexes was accompanied by relatively small unfavorable free energy terms. This destabilization was enthalpic in origin. On the other hand, a relatively large reduction of melting temperature (T(m)) was observed as a consequence of the monofunctional adduct in the TGT sequence, whereas T(m) due to the adduct in the AGT sequence was reduced only slightly. We also examined the efficiency of the mammalian nucleotide excision repair system to remove from DNA the monofunctional adducts and found that these lesions were not recognized by this repair system. Thus, rather thermodynamic than thermal characterization of DNA adducts of monofunctional platinum compounds is a property implicated in the modulation of downstream effects such as protein recognition and repair.     

Biologically active antisense phosphorothioate oligodeoxyribonucleotides: synthesis, characterization, and studies of 3'-terminal phosphorothioate monoester analogues

Multiple phosphorothioate oligonucleotides containing a 3'-terminal negative charge were synthesized and characterized. Influence of the added negative charge on activation of duplexes by RNase H was investigated. No additional help in recruitment of RNase H was observed.     

Structural studies of heterochiral DNA/DNA, RNA/RNA, and DNA/RNA duplexes

Using DNA and RNA heptanucleotides containing an unnatural L-nucleotides as well as the complementary strands, effects of the introduction of an L-nucleotide on the structure of DNA/DNA, RNA/RNA, and DNA/RNA duplexes were investigated by circular dichroism experiments and RNase H-mediated RNA strand cleavage reaction. The results suggested that the substitution of the central D-nucleotide with an L-nucleotide in the duplexes causes the significant structural alterations as the duplex structures change to conformations with more B-form similarities.     

Factors affecting the thermodynamic stability of small asymmetric internal loops in RNA

Optical melting experiments were used to determine the thermodynamic parameters for oligoribonucleotides containing small asymmetric internal loops. The results show a broad range of thermodynamic stabilities, which depend on loop size, asymmetry, sequence, closing base pairs, and length of helix stems. Imino proton NMR experiments provide evidence for possible hydrogen bonding in GA and UU mismatches in some asymmetric loops. The stabilizing effects of GA, GG, and UU mismatches on the thermodynamic stability of internal loops vary depending on the size and asymmetry of the loop. The dependence of loop stability on Watson-Crick closing base pairs may be explained by an account of hydrogen bonds. Models are presented for approximating the free energy increments of 2 x 3 and 1 x 3 internal loops.     

Reactive derivatives of oligonucleotide phosphorothioate analogues: IV. Site-directed modification of nucleic acids and intramolecular alkylation of phosphorothioate groups

Alkylation of the 22-mer DNA target pTGCCTGGAGCTGCTTGATGCCC (I) by oligodeoxynucleotide phosphorothioate derivatives (PTAO) GpsCpsApsTpsCpsApsApsGpsCpsApsGpsCpN(CH₃)CH₂(RCl)(II-PS) and (RCl)CH₂N(CH₃)pGpsCpsAps TpsCpsApsApsGpsCpsApsGpsC (III-PS) bearing a residue of an aromatic analogue of nitrogen lost (RCl=C₆H₄N(CH₃)(CH₂CH₂Cl) at the 3′- or 5′-end was studied. It was shown that the internucleotide phosphorothioate bonds do not affect the regiospecificity of the target modification. The maximum degree of the target modification (att→∞) at 20°C was about 25% for both (II-PS) and (III-PS). The use of GCATCAAGCAGCpN(CH₃)CH₂(RCl)(II-PO), containing internucleotide phosphodiester bonds, under the same conditions gave about 65% of the modified DNA. Kinetics of the PTAO-induced complementarily addressed nucleic acid (NA) modification was analyzed. The rate constants of the reaction of the intermediate reactive ethylenimmonium ion with phosphorothioate groups of the reagents were evaluated both in solution and in duplex. The intramolecular alkylation of phosphorothioate groups considerably affected the DNA target modification by decreasing the effectiveness of the modification in a wide range of temperatures and changing the temperature dependence of the modification from a bell-like to an S-like profile. It was concluded that, in the course of the modification, the PTAO phosphorothioate groups are intramolecularly alkylated both in solution and in the complementary NA target-oligonucleotide duplex. For Part III, see [1].     

A thermodynamic study of unusually stable RNA and DNA hairpins.

About 70% of the RNA tetra-loop sequences identified in ribosomal RNAs from different organisms fall into either (UNCG) or (GNRA) families (where N = A, C, G, or U; and R = A or G). RNA hairpins with these loop sequences form unusually stable tetra-loop structures. We have studied the RNA hairpin GGAC(UUCG)GUCC and several sequence variants to determine the effect of changing the loop sequence and the loop-closing base pair on the thermodynamic stability of (UNCG) tetra-loops. The hairpin GGAG(CUUG)CUCC with the conserved loop G(CUUG)C was also unusually stable. We have determined melting temperatures (Tm), and obtained thermodynamic parameters for DNA hairpins with sequences analogous to stable RNA hairpins with (UNCG), C(GNRA)G, C(GAUA)G, and G(CUUG)C loops. DNA hairpins with (TTCG), (dUdUCG), and related sequences in the loop, unlike their RNA counterparts, did not form unusually stable hairpins. However, DNA hairpins with the consensus loop sequence C(GNRA)G were very stable compared to hairpins with C(TTTT)G or C(AAAA)G loops. The C(GATA)G and G(CTTG)C loops were also extra stable. The relative stabilities of the unusually stable DNA hairpins are similar to those observed for their RNA analogs.     

The thermodynamic stability of nanoconstructions based on the double-stranded DNA molecules

The temperature stability of nanoconstructions formed by double-stranded DNA molecules fixed in the structure of their liquid crystalline dispersions and cross-linked by nanobridges was determined. It was shown that the heating of nanoconstructions is accompanied by a decrease in the amplitude of the negative bands in the CD spectrum both at lambda approximately 310 and lambda approximately 505 nm. Temperature "melting curves" were derived and characterzed by T(M) values. The T(M) values at lambda approximately 310 and lambda approximately 505 nm coincided with each other but differed from the T(M) value characteristic of the DNA cholesteric liquid crystalline dispersion.