A novel universal linker for efficient synthesis of phosphorothioate oligonucleotides

A versatile and conformationally preorganized universal linker molecule is reported here for efficient synthesis of phosphorothioate oligonucleotides. With respect to nucleoside loaded support, comparable yield and quality based on ion-pair LC-MS are obtained for both deoxy and 2'-O-methoxyethyl modified phosphorothioate oligonucleotides. No 3'-phosphate or phosphorothioate monoester or any modification of universal molecule still attached to oligonucleotide was observed. [structure: see text]     

Preactivated carboxyl linker for the rapid conjugation of alkylamines to oligonucleotides on solid support

A C10 linker phosphoramidite reagent terminated with a succinimidyl-activated carboxyl group was prepared and used to couple to the 5'-end of an oligonucleotide synthesized on a solid support. The succinimidyl-activated carboxyl functionality can be used for rapid conjugation of amines to oligonucleotides on solid support or it can be hydrolyzed to form a carboxylic acid functionality. The activated linker was successfully used for conjugation of several primary and secondary aliphatic amine derivatives (including biotin and fluorescein cadaverine) onto a solid support-bound 12-mer DNA oligonucleotide at scales ranging from 0.15 to 1.0 micromol. The overall yields of the conjugation products after AMA deprotection and cleavage from the solid support ranged from 43 to 75% of the total oligonucleotide product. This value is significant, as it includes oligonucleotide synthesis, coupling of the linker, and conjugation of the amine. In addition, the entire process of oligonucleotide synthesis, linker coupling, amine conjugation, deprotection, and cleavage of the oligonucleotide from solid support can be accomplished in 1 day.     

Synthesis of achiral linker reagents for direct labelling of oligonucleotides on solid supports

Full experimental procedures for the synthesis of a series of new functional linker reagents (14-16) and solid supports (11-13) are reported. The achiral linker reagents and supports can be used for high yield incorporation of free amino groups, fluorescein or biotin into DNA oligomers.     

A protected biotin containing deoxycytidine building block for solid phase synthesis of biotinylated oligonucleotides.

The synthesis of a modified 2'-deoxycytidine-3'-O-phosphoramidite carrying an N-t-butylbenzoyl protected biotin on a long polar spacer arm attached to the 4-N position is described. The presence of the bulky lipophilic t-butylbenzoyl protecting group enables the direct solid phase synthesis of biotinylated oligoribonucleotides and a variety of analogues in high yield without modification of the biotin moiety. Biotinylated antisense oligonucleotides incorporating this new derivative allow convenient isolation and purification of ribonucleic acid-protein complexes. The kinetics of biotin binding to streptavidin agarose is facilitated by the long polar spacer arm.     

A solid support with a hydroxyallyl linker, full parts of which are potentially reusable for the synthesis of oligonucleotides

This paper describes a solid support with a hydroxyallyl linker that is regenerated without loss of any parts after having used for the synthesis of nucleotides. Reproduction of the solid support can be achieved through detachment of the oligonucleotide by treatment with an organopalladium catalyst in the presence of triethylammonium acetate and subsequent methanolysis of the resulting allyl acetate.     

An evaluation of selective deprotection conditions for the synthesis of RNA on a light labile solid support

We have investigated the cleavage rates of various protecting groups for the exocyclic amine of cytosine, adenine, and guanine bases. Specifically, deprotection of N-benzoyl (Bz), N-acetyl (Ac), N-isobutyryl (iBu), N-phenoxyacetyl (PAC) and N-tert-butylphenoxyacetyl (tBPAC) groups from 2′-deoxyribonucleosides was effected under various cleavage conditions and the rates of cleavage (half-lives) were determined. Aqueous methylamine cleaves all of the examined protecting groups from the exocyclic amine the fastest among the six methods used. Ethanolic ammonia showed the highest selectivity between standard protecting groups (Ac, Bz, iBu) and fast-deprotecting groups (PAC, tBPAC). Under ammonia conditions, it was possible to cleave PAC and tBPAC rapidly and selectively in 2 h, while still retaining the large majority of the acetyl, benzoyl and isobutyryl groups. The results of this study allowed us to perform mild and complete deprotection of an oligoribonucleotide while still attached to the support with a light labile linker. This procedure simplifies and speeds up post-synthesis processing of the RNA chain and offers a new route to the synthesis of sensitive oligonucleotide derivatives on solid supports.     

A novel concept for ligand attachment to oligonucleotides via a 2'-succinyl linker

Conjugation of ligands to antisense oligonucleotides is a promising approach for enhancing their effects. In this report, a new method for synthesizing oligonucleotide conjugates is described. 2′-Amino-2′-deoxy-5′-dimethoxytrityl-uridine was select ively acylated with a succinic acid linker at the 2′ position. This compound was incorporated at the 3′ end of an oligonucleotide corresponding to the sequence of Oblimersen. The carboxyl group was protected for oligonucleotide synthesis as a benzyl ester, which could be selectively cleaved at the solid phase by a catalytic phase transfer reaction using palladium nanoparticles as catalyst. An oligonucleotide–fluorescein conjugate was prepared by condensation of aminofluorescein. Circular dichroism spectroscopic experiments showed a B-DNA type structure. The melting temperature of the duplex was only slightly lower than that of Oblimersen. Biological activity measured by western blotting resulted in a Bcl-2 target downregulation nearly identical to that of control Oblimersen on human melanoma cells, proving that this method is attractive for the binding of ligands located in the minor groove.     

Solid phase synthesis of C-terminal peptide amides: development of a new aminoethyl-polystyrene linker on the Multipin solid support.

A new aminoethyl-polystyrene linker, stable at low concentrations of TFA, has been developed for the solid phase synthesis of peptide amides. The described linker is stable under conditions which remove Bu(t) protecting groups (30-50% TFA in DCM) and the desired product can be finally cleaved off the solid support in 95% TFA (5% H2O). Model peptide amides and other N-alkylated peptide amides have been successfully synthesized in good yield and purity.     

An activated triple bond linker enables 'click' attachment of peptides to oligonucleotides on solid support

A general procedure, based on a new activated alkyne linker, for the preparation of peptide-oligonucleotide conjugates (POCs) on solid support has been developed. With this linker, conjugation is effective at room temperature (RT) in millimolar concentration and submicromolar amounts. This is made possible since the use of a readily attachable activated triple bond linker enhances the Cu(I) catalyzed 1,3-dipolar cycloaddition ('click' reaction). The preferred scheme for conjugate preparation involves sequential conjugation to oligonucleotides on solid support of (i) an H-phosphonate-based aminolinker; (ii) the triple bond donor p-(N-propynoylamino)toluic acid (PATA); and (iii) azido-functionalized peptides. The method gives conversion of oligonucleotide to the POC on solid support, and only involves a single purification step after complete assembly. The synthesis is flexible and can be carried out without the need for specific automated synthesizers since it has been designed to utilize commercially available oligonucleotide and peptide derivatives on solid support or in solution. Methodology for the ready conversion of peptides into 'clickable' azidopeptides with the possibility of selecting either N-terminus or C-terminus connection also adds to the flexibility and usability of the method. Examples of synthesis of POCs include conjugates of oligonucleotides with peptides known to be membrane penetrating and nuclear localization signals.     

Labeling of oligonucleotides with DTPA and DOTA on solid phase

Oligonucleotide conjugates labeled with metal chelates of diethylenetriaminepentaacetic acid (DTPA) and tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA) were synthesized on solid phase using appropriate nucleosidic phosphoramidite building blocks (3, 4) and a modified deprotection-metal chelation protocol. The major differences on the properties of the oligonucleotide conjugates also are discussed.     

Modification of guanine bases by nucleoside phosphoramidite reagents during the solid phase synthesis of oligonucleotides.

Nucleoside 3'-phosphoramidite and chlorophosphite reagents have been found to react with the lactam function of guanine. This reaction caused unsatisfactory results when oligodeoxyribonucleotides containing a large number of guanine bases were prepared in an automated solid phase synthesizer. The guanine modification is unstable, and leads to depurination and chain cleavage. This side reaction can be eliminated by protecting the O6-position. A new O6-p-nitrophenylethyldeoxyguanosine phosphoramidite derivative, 8, was used to prepare sequences containing up to 24 guanine bases with greatly improved results. A hexatriacontanucleotide, d(CGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCA), was also prepared using O6-protected deoxyguanosine nucleosides.     

Prevention of guanine modification and chain cleavage during the solid phase synthesis of oligonucleotides using phosphoramidite derivatives.

Phosphoramidite reagents can phosphitylate guanine bases at the O6-position during solid phase synthesis and serious chain cleavage occurs if the base phosphitylation is not eliminated before the iodine/water oxidation step. This can be accomplished by blocking the O6-position with a 2-cyanoethyl protecting group for deoxyribonucleotides or with a p-nitrophenylethyl group for ribonucleotides, regenerating the guanine base with water or acetate ions, or using N-methylanilinium trifluoroacetate (TAMA) as the phosphoramidite activator. The effectiveness of these methods was demonstrated by both 31P NMR studies and by the synthesis of d(Gp)23G, (Gp)14G, and d-(Gp)13rG sequences.     

2'-modified oligonucleotides from methoxyoxalamido and succinimido precursors: synthesis, properties, and applications

Synthesis of 2'-modified oligonucleotides from 2'-methoxyoxalamido (MOX) and 2'-succinimido (SUC) precursors is described. Their physical and biochemical properties were assessed. Synthesized oligonucleotides were used as primers in advanced DNA sequencing protocols. An example of sequencing directly off genomic DNA template without prior cloning or PCR amplification is presented.     

Improvements to solid phase phosphotriester synthesis of deoxyoligonucleotides.

A solution of benzenesulphonic acid (3%, w/v) in a dimethylformamide and dichloromethane mixture (9:1, v/v) is shown to be a very effective reagent for the detritylation of deoxyoligonucleotides attached to a solid support. The levels of depurination with this reagent were lower than those observed with other reagents such as trichloroacetic acid. Coupling reactions are described using above ambient temperatures with no detectable increase in side products. Both procedures have been successfully incorporated into an automated system, which can compete with the rate of synthesis by the phosphite approach.     

Hydroquinone-O,O'-diacetic acid ('Q-linker') as a replacement for succinyl and oxalyl linker arms in solid phase oligonucleotide synthesis.

When hydroquinone-O,Ooffiacetic acid is used as a linker arm in solid phase oligonucleotide synthesis, the time for NH4OH cleavage of oligodeoxy- or oligoribonucleotides is reduced to only 2 min. This allows increased productivity on automated DNA synthesizers without requiring any other modifications to existing reagents or synthesis and deprotection methods. The Q-linker may also be rapidly cleaved by milder reagents such as 5% NH4OH, potassium carbonate, anhydrous ammonia, t-butylamine or fluoride ion. However, the Q-linker is sufficiently stable for long-term storage at room temperature without degradation and no loss of material occurs during synthesis. The linker is also reasonably resistant to 20% piperidine/DMF, 0.5 M DBU/pyridine and 1:1 triethylamine/ethanol. The Q-linker can therefore serve as a general replacement for both succinyl and oxalyl linker arms.     

New synthesis of 5-carboxy-2'-deoxyuridine and its incorporation into synthetic oligonucleotides

5-Carboxy-2'-deoxyuridine is a methyl oxidation product of thymidine. It can be formed by the menadione-mediated photosensitization of thymidine in aerated aqueous solution. Here in we present a new four-step synthesis of the 5-carboxy-2'-deoxyuridine phosphoramidite building block based on the alkaline hydrolysis of 5-trifluoromethyl-2'-deoxyuridine. The phosphoramidite derivative has been incorporated at defined sites into oligonucleotides using the solid phase synthesis approach.     

Universal solid supports for the synthesis of oligonucleotides with terminal 3''-phosphates.

The preparation of two types of supports based on controlled pore glass (CPG) is presented. These supports are compatible with established phosphoroamidite chemistry of oligonucleotides synthesis giving rise to an oligonucleotide with terminal 3'-phosphate function during final deprotection. CPG was modified with: (i) methacrylic acid derivatives and 2-mercaptoethanol (1) or (ii) aminoalkylsilane, succinic anhydride and benzidine (2). Support 2 can be also used for the synthesis of partially protected oligonucleotide 3'-phosphates.     

Mechanisms and strategies for effective delivery of antisense and siRNA oligonucleotides

The potential use of antisense and siRNA oligonucleotides as therapeutic agents has elicited a great deal of interest. However, a major issue for oligonucleotide-based therapeutics involves effective intracellular delivery of the active molecules. In this Survey and Summary, we review recent reports on delivery strategies, including conjugates of oligonucleotides with various ligands, as well as use of nanocarrier approaches. These are discussed in the context of intracellular trafficking pathways and issues regarding in vivo biodistribution of molecules and nanoparticles. Molecular-sized chemical conjugates and supramolecular nanocarriers each display advantages and disadvantages in terms of effective and nontoxic delivery. Thus, choice of an optimal delivery modality will likely depend on the therapeutic context.