Genetic Similarity among Isolates of Pyrenophora tritici-repentis, Causal Agent of Tan Spot of Wheat

Tan spot, a foliar disease of wheat, is caused by the fungus Pyrenophora tritici‐repentis. On susceptible wheat cultivars, P. tritici‐repentis induces two distinct symptoms: tan necrosis and extensive chlorosis. Presently isolates of P. tritici‐repentis are classified into 11 races based on their virulence on a set of wheat differential genotypes. In nature, this pathogen reproduces both sexually and asexually, but the extent of genetic variability in the P. tritici‐repentis population of western Canada is unknown. This study was conducted to assess the genetic variability among different isolates of P. tritici‐repentis and to determine if similarities among isolates are correlated with race classification or geographic origin of the isolates. Thirty‐three isolates of P. tritici‐repentis and one isolate each of P. teres f. sp. teres, P. teres f. sp. maculata, P. graminea, Helminthosporium sativum and an uncharacterized isolate were studied with 30 random amplified polymorphic DNA (RAPD) primers. Cluster analysis showed that all isolates had unique banding patterns and that clustering of isolates was independent of their race designation or geographic origin. Analysis of molecular variation (amova ) showed that 96.8% of variability occurred among isolates and among race variability accounted for only 3.2% of the total variability.     

A proteomic evaluation of Pyrenophora tritici‐repentis,causal agent of tan spot of wheat,reveals major differences between virulent and avirulent isolates

Pyrenophora tritici‐repentis causes tan spot, an important foliar disease of wheat. The fungus produces multiple host‐specific toxins, including Ptr ToxB, a chlorosis‐inducing protein encoded by the ToxB gene. A homolog of ToxB is also found in avirulent isolates of the fungus. In order to improve understanding of the role of this homolog and evaluate the general pathogenic ability of P. tritici‐repentis, we compared the proteomes of avirulent race 4 and virulent race 5 isolates of the pathogen. Western blotting analysis revealed the presence of Ptr ToxB in spore germination and culture fluids of race 5 but not race 4. A comprehensive proteome‐level comparison by 2‐DE indicated 133 differentially abundant proteins in the secretome (29 proteins) and mycelium (104 proteins) of races 4 and 5, of which 63 were identified by MS/MS. A number of the proteins found to be up‐regulated in race 5 have been implicated in microbial virulence in other pathosystems, and included the secreted enzymes α‐mannosidase and exo‐β‐1,3‐glucanase, heat‐shock and BiP proteins, and various metabolic enzymes. These proteome‐level differences suggest a reduced general pathogenic ability in race 4 of P. tritici‐repentis, irrespective of toxin production. Such differences may reflect an adaptation to a saprophytic habit.     

Variation in Aggressiveness of Stagonospora nodorum Isolates in North Dakota

Stagonospora nodorum blotch (SNB), caused by Stagonospora nodorum, is an important disease in the northern Great Plains of the United States and in other wheat‐producing regions in the world. SNB can be managed by different strategies including the use of resistant cultivars. Genetic variation in the pathogen populations is one of the important factors in the development of durable resistant cultivars. Our main objective was to determine variation in aggressiveness/virulence in the 40 isolates of S. nodorum collected from various locations in North Dakota. To achieve this goal, we tested the isolates on two susceptible wheat cultivars (cvs ‘ND495’ and ‘Alsen’) and two resistant wheat cultivars (cvs ‘Erik’ and ‘Salamouni’) – two‐leaf‐stage seedlings under controlled conditions. Aggressiveness of each isolate was characterized by the two epidemiological parameters: percent necrotic leaf area (% NLA) and lesion type (LT) 8 days post‐inoculation. The isolates differed significantly (P ≤ 0.05) for % NLA and LT, and were grouped into three aggressiveness groups (AG): low, medium and highly aggressive. Four isolates (S50, S57, S66 and S89) induced 18–26% NLA and were included into the low aggressive group (AG 1). Three isolates (S15, S39 and S89) induced 57–59% NLA and were considered highly aggressive (AG 3). Thirty‐three isolates were medium aggressive (AG 2). No relationship between AG and mating types was observed. There were significant (P ≤ 0.05) differences in % NLA and LT among wheat cultivars. Significant wheat cultivars by isolates interaction was also demonstrated, suggesting evidence for the existence of host specificity in this system. Overall, our results indicate that S. nodorum isolates prevalent in North Dakota varied greatly in their aggressiveness and that AG 3 isolates can be utilized in breeding wheat for resistance to SNB.     

Catenarin Production by Isolates of Pyrenophora tritici-repentis (Died.) Drechsler and its Antimicrobial Activity

A total of 88 Pyrenophora tritici‐repentis (Died.) Drechsler isolates from different hosts and localities were screened for catenarin production using thin layer chromatography. Catenarin was detected in 29% of the tested strains. The level of this compound ranged from 2 to 400 ppm and was especially high in case of fungus variants unable to biosynthesize melanins. The extracted pigment exhibited antibiotic properties against Gram‐positive bacteria (Aureobacterium liquefaciens, Arthrobacter globiformis, Bacillus brevis, B. circulans, B. subtilis and Curtobacterium plantarum). Catenarin also inhibited the growth of fungi accompanying P. tritici‐repentis during the saprophytic phase of development. The most sensitive species was Epicoccum nigrum, whose growth was inhibited up to 90%.     

URP‐based DNA Fingerprinting of Bipolaris sorokiniana Isolates Causing Spot Blotch of Wheat

Spot blotch, caused by the pathogen Bipolaris sorokiniana is an important disease of wheat and is responsible for large economic losses world wide. In this study, molecular variability in B. sorokiniana isolates collected from different regions of India was investigated using URP‐PCR technique. All the 40 isolates used in the study were pathogenic when tested on susceptible host, Agra local, although they varied in pathogenicity. Isolate BS‐49 was least virulent showing 4.5 infection index while BS‐75 was the most virulent with 63.4 infection index. The universal rice primers (URPs’) are primers which have been derived from DNA repeat sequences in the rice genome. Out of the 12 URP markers used in the study, 10 markers were effective in producing polymorphic fingerprint patterns from DNA of B. sorokiniana isolates. The analysis of entire fingerprint profile using unweighted pair group method with arithmetic averages (UPGMA) differentiated B. sorokiniana isolates obtained from different geographic regions. One isolate BS‐53 from northern hill zone was different from rest of the isolates showing less than 50% similarity. Broadly, three major clusters were obtained using UPGMA method. One cluster consisted of isolates from North western plain zone; second cluster having isolates from North eastern plain zone and third cluster consisted of isolates from Peninsular zone showing more than 75% genetic similarity among them. One of the markers, URP‐2F (5′GTGTGCGATCAGTTGCTGGG3′) amplified three monomorphic bands of 0.60, 0.80 and 0.90 kb size which could be used as specific markers for identification of B. sorokiniana. Further, based on URP‐PCR analysis, the grouping of the isolates according to the geographic origin was possible. This analysis also provided important information on the degree of genetic variability and relationship between the isolates of B. sorokiniana.     

Morphology,Physiology, and Virulence of <Emphasis Type="Italic">Bipolaris sorokiniana</Emphasis> Isolates

Bipolaris sorokiniana is a phytopathogenic fungus that causes diseases in cereal crops. The high morphological, physiological, and genetic variability makes the control of this fungus a difficult task. The aim of this work was to study the virulence, morphological, and physiological variability of B. sorokiniana isolates. For this, 35 B. sorokiniana isolates from different geographic regions in Brazil and other countries were used. The isolates were evaluated for their morphological variability, considering mycelium color, sector formation, and growth rate. Based on these morphological characteristics, the isolates were grouped in five different morphological groups. Extracellular enzymes activity in solid medium, virulence in wheat seeds and seedlings, and analysis of total proteins by SDS-PAGE were evaluated for all isolates. Variations among the isolates were found for enzymatic activity, and esterase was the enzyme that showed the highest activity indices. The results obtained from infection of seeds and seedlings showed that isolates from the same geographical region and morphological group had different degrees of virulence. The total protein profile shown by the isolates varied in the number of bands and intensity, where some of them may be used to characterize the specie.     

Esterase electrophoretic analysis to distinguish isolates between Bipolaris spp. and Drechslera tritici-repentis from wheat

Diseases caused in wheat by Bipolaris sorokiniana and Drechslera tritici-repentis have led to considerable yield and production losses. In wheat seeds another isolate has recently been identified, resembling Bipolaris bicolor. The objective of the present trial was to differentiate and identify isolates of these fungi based on electrophoretic analyses and morphology. Esterase electrophoresis enabled the differentiation between Drechslera sp. and Bipolaris sp. isolates. In relation to morphology, conidia from D. tritici-repentis isolates were significantly longer than the isolates of B. sorokiniana. Bipolaris bicolor isolates, on the other hand, presented wider conidia than those of D. tritici-repentis and B. sorokiniana.     

Influence of Seed‐borne Cochliobolus sativus (Anamorph Bipolaris sorokiniana) on Crown Rot and Root Rot of Barley and Wheat

The effect of seed‐borne pathogens of wheat and barley on crown and root rot diseases of seven barley cultivars (Jimah‐6, Jimah‐51, Jimah‐54, Jimah‐58, Omani, Beecher and Duraqi) and three wheat cultivars (Cooley, Maissani and Shawarir) was investigated. Bipolaris sorokiniana and Alternaria alternata were detected in seeds of at least eight cultivars, but Fusarium species in seeds of only two barley cultivars (Jimah‐54 and Jimah‐58). Crown rot and root rot symptoms developed on barley and wheat cultivars following germination of infected seeds in sterilized growing media. Bipolaris sorokiniana was the only pathogen consistently isolated from crowns and roots of the emerging seedlings. In addition, crown rot and root rot diseases of non‐inoculated barley cultivars correlated significantly with B. sorokiniana inoculum in seeds (P = 0.0019), but not with Fusarium or Alternaria (P > 0.05). These results indicate the role of seed‐borne inoculum of B. sorokiniana in development of crown rot and root rot diseases. Pathogenicity tests of B. sorokiniana isolates confirmed its role in inducing crown rot and root rot, with two wheat cultivars being more resistant to crown and root rots than most barley cultivars (P < 0.05). Barley cultivars also exhibited significant differences in resistance to crown rot (P < 0.05). In addition, black point disease symptoms were observed on seeds of three barley cultivars and were found to significantly affect seed germination and growth of some of these cultivars. This study confirms the role of seed‐borne inoculum of B. sorokiniana in crown and root rots of wheat and barley and is the first report in Oman of the association of B. sorokiniana with black point disease of barley.     

Virulence of Septoria nodorum as Affected by Passage Through Detached Leaves of Wheat and Barley Cultivars1

Abstract Three genetically marked, single–spore isolates of Septoria nodorum from wheat were passed through detached leaves of wheat cvs Blueboy and Coker 747 and the barley cv. Boone to produce three sub–isolates per original isolate. Each sub–isolate was cultured for three pycnidiospore generations on its respective host. Virulence of each sub–isolate on detached leaves of Blueboy, Caldwell, Coker 747, and NK81W701 wheat, and Boone and Surry barley was compared with that of the original single–spore isolate from which it was derived. In most cases, sub–isolates passed through wheat were significantly more virulent than the originals on wheat cultivars. They also were more virulent to barley than the original isolates but they were less virulent to barley than to wheat cultivars. Isolate × cultivar interactions were statistically significant (P < .0001) for isolates passed through wheat or barley and were greater than isolate × cultivar interactions among the original isolates. In seven of eight isolates passed through wheat or barley, only the original genetic marker was recovered after three generations, indicating that cross–contamination could not account for the observed change of virulence. In the single case of apparent contamination, of a sub–isolate, virulence declined.     

Virulence Spectrum of Mycosphaerella graminicola Isolates on Wheat Genotypes Carrying Known Resistance Genes to Septoria tritici Blotch

The virulence spectrum of 23 monopycnidiospore isolates of Mycosphaerella graminicola was determined using wheat genotypes that carried different resistance genes (Stb1–Stb8 and Stb15). Disease severity was measured as the percentage of necrotic leaf area. The isolates used in the experiments were of diverse origin: eight from Poland, seven from Germany, and eight from other countries around the world. Analysis of variance revealed significant differences in the virulence of the isolates. Using multiple regression and Cook’s D statistic, 26 significant cultivar × isolate interactions were detected. The Israeli isolate IPO86036 showed the widest spectrum of specific reactions. It expressed specific virulence on at least four cultivars and specific avirulence on at least three. The other isolates showed specific interactions with 1–6 different cultivars. Despite the limited number of isolates that were tested, we recommend that a number of resistant lines, namely cultivars Veranopolis (Stb2), Cs/Synthetic 7D (Stb5), Arina (Stb15, Stb6 and partial resistance), and Liwilla (unknown resistance factors), could be incorporated into central European wheat breeding programmes that are aimed at developing resistance against septoria tritici blotch. In contrast, resistance gene Stb7, which is carried by cultivar Estanzuela Federal, was ineffective against most of the isolates that were used. These results on the virulence spectrum of M. graminicola isolates provide valuable information for effective wheat breeding programmes to develop resistance to the pathogen.     

Vegetative Compatibility Among Isolates of Colletotrichum gloeosporioides from Yam (Dioscorea spp.) in Nigeria

Isolates of Colletotrichum gloeosporioides obtained from yam‐based cropping systems in Nigeria, previously characterized on the basis of morphology, virulence and rDNA internal transcribed spacer (ITS) sequence variation were further compared for vegetative compatibility (VC). Chlorate‐resistant nitrate non‐utilizing (nit) mutants were generated from the isolates and used in complementation (heterokaryon) tests. Tests of VC between complementary mutants from different isolates indicated the presence of several genotypes within a single field, suggesting limited clonal spread. In some cases, isolates obtained from the same lesion were observed to belong to different vegetative compatibility groups (VCGs). No compatibility was observed between isolates of the highly virulent slow‐growing grey (SGG), the moderately virulent fast‐growing salmon (FGS) and the avirulent/weakly virulent fast‐growing grey (FGG) strains. Forty‐one C. gloeosporioides isolates belonged to 28 VCGs, giving a genotype diversity estimate of 0.68. This diversity confirmed the high variability of the pathogen population as revealed by previous characterization studies, however, a correlation between VCGs and isolate groupings based on morphology and virulence was not found. The finding that an isolate from weed was compatible with yam isolates indicated that transfer of important traits, such as virulence, may take place between isolates from yam and non‐yam hosts. The VCG diversity revealed by this study suggests that in addition to asexual reproduction, sexual reproduction may play an important role in the epidemiology of anthracnose on yam.     

Genetic Diversity of Pyrenophora teres Isolates as Detected by AFLP Analysis

Amplified fragment length polymorphism (AFLP) analysis has been used to analyse mainly 83 Czech isolates of Pyrenophora teres, P. graminea, P. tritici‐repentis and Helminthosporium sativum. Each species had distinct AFLP profiles. Using 19 primer combinations 948 polymorphic bands were detected. All main clusters in dendrogram correspond to the studied species. Even the two forms of P. teres–P. teres f. teres (PTT) and P. teres f. maculata (PTM) – formed different clusters. Genetic diversity, with regard to the locality and the year of the sample's collection, was analysed separately within the AFLP‐based dendrogram cluster of PTT and PTM. Unweighted pair‐group method (UPGMA) analysis of the 37 isolates of PTT and 30 isolates of PTM, using 469 polymorphic bands, showed that the variability seemed to have been influenced more by the year of sampling than by the geographic origin of the isolate. The presence of intermediate haplotypes with a relatively high number of shared markers between the two groups indicated that hybridization between the forms of P. teres could happen, but it is probably often overlapped by selection pressure or genetic drift.     

Comparative studies on the activities of chitinase, β-1,3-glucanase, peroxidase and phenylalanine ammonia lyase in the leaves of triticale and wheat infected with Stagonospora nodorum

The activities of chitinase, β-1,3-glucanase, peroxidase and phenylalanine ammonia lyase, constitutive and induced by Stagonospora nodorum were examined in the 10 – 14 day old seedlings of three triticale and two wheat cultivars under controlled environmental conditions and in flag leaves of two triticale cultivars in the field. Two S. nodorum isolates of different virulence were used. Both the constitutive and induced activities in triticale and wheat depended on genotype and in triticale the effect of growth conditions was also evidenced. The constitutive activities of chitinase, β-1,3-glucanase and peroxidase were several fold lower in flag triticale leaves in plants from the field than in the seedlings, growing under controlled conditions, but induction in the infected flag leaves was significantly more pronounced. In triticale genotypic differences in the response to infection were revealed only upon inoculation by S. nodorum isolate of higher virulence. The enzymatic activities increased several fold during successive days after the infection except for phenylalanine ammonia lyase. Induction of this enzyme was only transient and the activity decreased 48 or 96 h after infection when the activities of other enzymes were rising. In flag leaves in the field this activity was differentiated only after infection with more a virulent strain. A tendency appeared in triticale seedlings for association of the resistance to the pathogen with lower enzymatic constitutive activities. This relationship became more evident in triticale infected by S. nodorum and may imply that although the investigated enzymes are certainly involved in general, non-specific defense mechanism, they do not decide on the resistance to pathogen at least in the early stages of infection and cooperate with other factors in the complex pathogen-plant interaction. One can also assume that the enzymatic activities are associated with severity of infection rather than resistance to pathogen.     

Stability of Adult‐plant Resistance to Septoria tritici blotch in 24 European Winter Wheat Varieties Across Nine Field Environments

Septoria tritici blotch (STB) is one of the most important leaf diseases in wheat worldwide. Objectives of this study were (i) to compare inoculation and natural infection; (ii) to evaluate the level of adult‐plant resistance to STB using four isolates; and (iii) to analyse environmental stability of 24 winter wheat (Triticum aestivum L.) varieties in inoculated vs. non‐inoculated field trials across 3 years including nine environments (location × year combinations). Field trials were sown in split‐plot design inoculated with four aggressive isolates of S. tritici plus one non‐inoculated variant as main factor and 24 wheat varieties as subfactor. Septoria tritici blotch severity was visually scored as percentage flag leaves covered with lesions bearing pycnidia. Overall STB rating ranged from 8% (Solitär) to 63% (Rubens) flag leaf area affected, resulting in significant (P < 0.01) genotypic variance. Variance of genotype × environment interaction amounted to approximately 50% of the genotypic variance. Genotype × isolate interaction variance was significant too (P < 0.01) but of minor importance. Therefore, environmental stability of varieties should be a major breeding goal. The varieties Solitär, History and Florett were most resistant and stable as revealed by a regression approach, and the susceptible varieties were generally unstable. Hence, STB resistance and stability are correlated (P < 0.01), but there were some exceptions (Tuareg, Ambition). Promising candidates for an environmentally stable, effective adult‐plant resistance have been identified.     

Control of Mn status and infection rate by genotype of both host and pathogen in the wheat take-all interaction

Take-all is a world-wide root-rotting disease of cereals. The causal organism of take-all of wheat is the soil-borne fungus Gaeumannomyces graminis var tritici (Ggt). No resistance to take-all, worthy of inclusion in a plant breeding programme, has been discovered in wheat but the severity of take-all is increased in host plants whose tissues are deficient for manganese (Mn). Take-all of wheat will be decreased by all techniques which lift Mn concentrations in shoots and roots of Mn-deficient hosts to adequate levels. Wheat seedlings were grown in a Mn-deficient calcareous sand in small pots and inoculated with four field isolates of Ggt. Infection by three virulent isolates was increased under conditions which were Mn deficient for the wheat host but infection by a weakly virulent isolate, already low, was further decreased. Only the three virulent isolates caused visible oxidation of Mn in vitro. The sensitivity of Ggt isolates to manganous ions in vitro did not explain the extent of infection they caused on wheat hosts. In a similar experiment four Australian wheat genotypes were grown in the same Mn-deficient calcareous sand and inoculated with one virulent isolate of Ggt. Two genotypes were inefficient at taking up manganese and were very susceptible to take-all, one was very efficient at taking up manganese and was resistant to take-all, and the fourth genotype was intermediate for both characters. All genotypes were equally resistant under Mn-adequate conditions.