The nucleotide sequence of 5S ribosomal RNA from Schizosaccharomyces pombe

The nucleotide sequence of 5S rRNA from the fission yeast, S. pombe, has been established by post labeling procedures combined with cataloging RNase T1- and A-oligonucleotides derived from unlabeled 5S rRNA. The sequence consists of 119 nucleotides without a modified base and shows more dissimilarities (at 38 positions) from that of S. cerevisiae than from that of humans (at 33 positions).     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria.     

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.     

The nucleotide sequence of ribosomal 5S RNA from Rhizobium meliloti: comparison with 5S rRNA of Agrobacterium

The complete nucleotide sequence of R. meliloti 5S ribosomal RNA has been determined and compared with the already known sequence of A. tumefaciens 5S rRNA (Vandenberghe et al., 1985, Eur. J. Biochem., 149, 537-542) and of other 5S rRNAs from Rodobacteria Alpha-2 (Wolters et al., 1988, Nucleic Acids Res., 16, rl-r70). The differences found at eight positions (23, 73, 83, 72 in helical fragments; 16, 40, 88 in loops; 54 in bulge), which might affect secondary structures of 5S rRNA, are small. Moreover, the sequence analysis specifies both variable and common positions in 5S rRNA secondary structure of Rodobacteria Alpha-2.     

The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.     

Nucleotide sequence of 5S ribosomal RNA from Lingula anatina. A study on the molecular evolution of 5S ribosomal RNA from a living fossil

By chromatography on columns of DEAE-Sephadex A-50 and Sephadex G-100, and electrophoresis on polyacrylamide gel, 5S rRNA was purified from a low-molecular-weight RNA fraction extracted from the total tissues of Lingula anatina. Complete digests of the 5S rRNA with RNase T1 [EC 3.1.4.8] and pancreatic RNase [EC 3.1.4.22] were sequenced by conventional column chromatography procedures. The nucleotide sequence of this RNA was determined mainly by a chemical method for sequencing the RNA 3' end-labeled with 32P (1), with the complement of the oligonucleotide catalog obtained by the complete RNase digestions of the RNA. By comparing the sequences of several invertebrate, vertebrate, and Chlorella 5S rRNAs, a phylogenic tree of the rRNAs was constructed and the time of divergence of Lingula was estimated.