共查询到20条相似文献,搜索用时 31 毫秒
1.
Kazem Mashayekhi Mojtaba Sankian Saeed Mohammadian Haftcheshmeh Ramezan Ali Taheri Kazem Hassanpour Gholamreza Farnoosh 《Biotechnology progress》2021,37(5):e3191
To increase the efficiency of aptamers to their targets, a simple and novel method has been developed based on aptamer oligomerization. To this purpose, previously anti-human TNF-α aptamer named T1–T4 was trimerized through a trimethyl aconitate core for neutralization of in vitro and in vivo of TNF-α. At first, 54 mer T1–T4 aptamers with 5′-NH2 groups were covalently coupled to three ester residues in the trimethyl aconitate. In vitro activity of novel anti-TNF-α aptamer and its dissociation constant (Kd) was done using the L929 cell cytotoxicity assay. In vivo anti-TNF-α activity of new oligomerized aptamer was assessed in a mouse model of cutaneous Shwartzman. Anchoring of three T1–T4 aptamers to trimethyl aconitate substituent results in formation of the 162 mer fragment, which was well revealed by gel electrophoresis. In vitro study indicated that the trimerization of T1–T4 aptamer significantly improved its anti-TNF-α activity compared to non-modified aptamers (P < 0.0001) from 40% to 60%. The determination of Kd showed that trimerization could effectively enhance Kd of aptamer from 67 nM to 36 nM. In vivo study showed that trimer aptamer markedly reduced mean scar size from 15.2 ± 1.2 mm to 1.6 ± 0.1 mm (P < 0.0001), which prevent the formation of skin lesions. In vitro and in vivo studies indicate that trimerization of anti-TNF-α aptamer with a novel approach could improve the anti-TNF-α activity and therapeutic efficacy. According to our findings, a new anti-TNF-α aptamer described here could be considered an appropriate therapeutic agent in treating several inflammatory diseases. 相似文献
2.
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (Kd [kanamycin] = 78.8 nM, Kd [kanamycin B] = 84.5 nM, and Kd [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. 相似文献
3.
Nucleic acid-based aptamers offer many potential advantages relative to antibodies and other protein-based affinity reagents, including facile chemical synthesis, reversible folding, improved thermal stability and lower cost. However, their selection requires significant time and resources and selections often fail to yield molecules with affinities sufficient for molecular diagnostics or therapeutics. Toward a selection technique that can efficiently and reproducibly generate high performance aptamers, we have developed a microfluidic selection process (M-SELEX) that can be used to obtain high affinity aptamers against diverse protein targets. Here, we isolated DNA aptamers against three protein targets with different isoelectric points (pI) using a common protocol. After only three rounds of selection, we discovered novel aptamer sequences that bind to platelet derived growth factor B (PDGF-BB; pI = 9.3) and thrombin (pI = 8.3) with respective dissociation constants (Kd) of 0.028 nM and 0.33 nM, which are both superior to previously reported aptamers against these targets. In parallel, we discovered a new aptamer that binds to apolipoprotein E3 (ApoE; pI = 5.3) with a Kd of 3.1 nM. Furthermore, we observe that the net protein charge may exert influence on the affinity of the selected aptamers. To further explore this relationship, we performed selections against PDGF-BB under different pH conditions using the same selection protocol, and report an inverse correlation between protein charge and aptamer Kd. 相似文献
4.
Jiuxing Li Zijie Zhang Jimmy Gu Hannah D Stacey Jann C Ang Alfredo Capretta Carlos D M Filipe Karen L Mossman Cynthia Balion Bruno
J Salena Deborah Yamamura Leyla Soleymani Matthew S Miller John
D Brennan Yingfu Li 《Nucleic acids research》2021,49(13):7267
We performed in vitro selection experiments to identify DNA aptamers for the S1 subunit of the SARS-CoV-2 spike protein (S1 protein). Using a pool of pre-structured random DNA sequences, we obtained over 100 candidate aptamers after 13 cycles of enrichment under progressively more stringent selection pressure. The top 10 sequences all exhibited strong binding to the S1 protein. Two aptamers, named MSA1 (Kd = 1.8 nM) and MSA5 (Kd = 2.7 nM), were assessed for binding to the heat-treated S1 protein, untreated S1 protein spiked into 50% human saliva and the trimeric spike protein of both the wildtype and the B.1.1.7 variant, demonstrating comparable affinities in all cases. MSA1 and MSA5 also recognized the pseudotyped lentivirus of SARS-CoV-2 with respective Kd values of 22.7 pM and 11.8 pM. Secondary structure prediction and sequence truncation experiments revealed that both MSA1 and MSA5 adopted a hairpin structure, which was the motif pre-designed into the original library. A colorimetric sandwich assay was developed using MSA1 as both the recognition element and detection element, which was capable of detecting the pseudotyped lentivirus in 50% saliva with a limit of detection of 400 fM, confirming the potential of these aptamers as diagnostic tools for COVID-19 detection. 相似文献
5.
Xia Han Hideyuki Tomitori Satomi Mizuno Kyohei Higashi Christine Füll Tomohide Fukiwake Yusuke Terui Pathama Leewanich Kazuhiro Nishimura Toshihiko Toida Keith Williams Keiko Kashiwagi Kazuei Igarashi 《Journal of neurochemistry》2008,107(6):1566-1577
The binding of spermine and ifenprodil to the amino terminal regulatory (R) domain of the N‐methyl‐D ‐aspartate receptor was studied using purified regulatory domains of the NR1, NR2A and NR2B subunits, termed NR1‐R, NR2A‐R and NR2B‐R. The R domains were over‐expressed in Escherichia coli and purified to near homogeneity. The Kd values for binding of [14C]spermine to NR1‐R, NR2A‐R and NR2B‐R were 19, 140, and 33 μM, respectively. [3H]Ifenprodil bound to NR1‐R (Kd, 0.18 μM) and NR2B‐R (Kd, 0.21 μM), but not to NR2A‐R at the concentrations tested (0.1–0.8 μM). These Kd values were confirmed by circular dichroism measurements. The Kd values reflected their effective concentrations at intact NR1/NR2A and NR1/NR2B receptors. The results suggest that effects of spermine and ifenprodil on NMDA receptors occur through binding to the regulatory domains of the NR1, NR2A and NR2B subunits. The binding capacity of spermine or ifenprodil to a mixture of NR1‐R and NR2A‐R or NR1‐R and NR2B‐R was additive with that of each individual R domain. Binding of spermine to NR1‐R and NR2B‐R was not inhibited by ifenprodil and vice versa, indicating that the binding sites for spermine and ifenprodil on NR1‐R and NR2B‐R are distinct. 相似文献
6.
Background
Aptamers are oligonucleotides that bind proteins and other targets with high affinity and selectivity. Twenty years ago elements of natural selection were adapted to in vitro selection in order to distinguish aptamers among randomized sequence libraries. The primary bottleneck in traditional aptamer discovery is multiple cycles of in vitro evolution.Methodology/Principal Findings
We show that over-representation of sequences in aptamer libraries and deep sequencing enables acyclic identification of aptamers. We demonstrated this by isolating a known family of aptamers for human α-thrombin. Aptamers were found within a library containing an average of 56,000 copies of each possible randomized 15mer segment. The high affinity sequences were counted many times above the background in 2–6 million reads. Clustering analysis of sequences with more than 10 counts distinguished two sequence motifs with candidates at high abundance. Motif I contained the previously observed consensus 15mer, Thb1 (46,000 counts), and related variants with mostly G/T substitutions; secondary analysis showed that affinity for thrombin correlated with abundance (Kd = 12 nM for Thb1). The signal-to-noise ratio for this experiment was roughly 10,000∶1 for Thb1. Motif II was unrelated to Thb1 with the leading candidate (29,000 counts) being a novel aptamer against hexose sugars in the storage and elution buffers for Concanavilin A (Kd = 0.5 µM for α-methyl-mannoside); ConA was used to immobilize α-thrombin.Conclusions/Significance
Over-representation together with deep sequencing can dramatically shorten the discovery process, distinguish aptamers having a wide range of affinity for the target, allow an exhaustive search of the sequence space within a simplified library, reduce the quantity of the target required, eliminate cycling artifacts, and should allow multiplexing of sequencing experiments and targets. 相似文献7.
S. Yu. Rakhmetova S. P. Radko O. V. Gnedenko N. V. Bodoev A. S. Ivanov A. I. Archakov 《Biochemistry (Moscow) Supplemental Series B: Biomedical Chemistry》2010,4(1):68-74
Using DNA aptamers selectively recognizing anion-binding exosites 1 and 2 of thrombin as a model, it has been demonstrated
that their conjugation by a poly-(dT)-linker (ranging from 5 to 65 nucleotides (nt) in length) to produce aptamer heterodimeric
constructs results into affinity enhancement. At the linker lengths ranged from 35 to 55 nt the apparent dissociation constants
(K
Dapp) measured using the optical biosensor Biacore-3000 for complexes of thrombin with the heterodimeric constructs reached minimum
values (K
Dapp) = 0.2–0.4 nM), which were approximately 30-fold less than for the complexes with the initial aptamers. A photoaptamer heterodimeric
construct was designed connecting photoaptamer and aptamer sequences with the poly-(dT)-linker of 35 nt long. The photoaptamer
used could form photo-induced cross-links with the exosite 2 of thrombin and the aptamer could bind to the exosite 1. The
(K
Dapp value for the photoaptamer construct was approximately 40-fold less than that for the primary photoaptamer (5.3 and 190 nM,
respectively). Upon exposure of the equimolar mixtures of thrombin with the photoaptamer construct to the UV radiation at
308 nm the equal yield of the crosslinked complexes was observed at concentrations, which were lower by two orders of magnitude
than in the case of the primary photoaptamer. It was found that concurrently with crosslinking to thrombin a photo-induced
inactivation of the photoaptamer occurs presumably due to formation of the intermolecular crosslinking. 相似文献
8.
Isolation of a new ssDNA aptamer against staphylococcal enterotoxin B based on CNBr‐activated sepharose‐4B affinity chromatography
下载免费PDF全文
![点击此处可从《Journal of molecular recognition : JMR》网站下载免费的PDF全文](/ch/ext_images/free.gif)
Mojtaba Hedayati Ch Jafar Amani Hamid Sedighian Mohsen Amin Jafar Salimian Raheleh Halabian Abbas Ali Imani Fooladi 《Journal of molecular recognition : JMR》2016,29(9):436-445
Staphylococcus aureus are potent human pathogens possessing arsenal of virulence factors. Staphylococcal food poisoning (SFP) and respiratory infections mediated by staphylococcal enterotoxin B (SEB) are common clinical manifestations. Many diagnostic techniques are based on serological detection and quantification of SEB in different food and clinical samples. Aptamers are known as new therapeutic and detection tools which are available in different ssDNA, dsDNA and protein structures. In this study, we used a new set of ssDNA aptamers against SEB. The methods used included preparation of a dsDNA library using standard SEB protein as the target analyte, affinity chromatography matrix in microfuge tubes, SELEX procedures to isolate specific ssDNA‐aptamer as an affinity ligand, aptamer purification using ethanol precipitation method, affinity binding assay using ELISA, aptamer cloning and specificity test. Among 12 readable sequences, three of them were selected as the most appropriate aptamer because of their affinity and specificity to SEB. This study presents a new set of ssDNA aptamer with favorable selectivity to SEB through 12 rounds of SELEX. Selected aptamers were used to detect SEB in infected serum samples. Results showed that SEB c1 aptamer (2 µg SEB/100 nM aptamer) had favorable specificity to SEB (kd = 2.3 × 10?11). In conclusion, aptamers can be considered as useful tools for detecting and evaluating SEB. The results showed that affinity chromatography was an affordable assay with acceptable accuracy to isolate sensitive and selective novel aptamers. Copyright © 2016 John Wiley & Sons, Ltd. 相似文献
9.
Nuo Duan Xiaoying DingShijia Wu Yu XiaXiaoyuan Ma Zhouping WangJie Chen 《Journal of microbiological methods》2013
To identify DNA aptamers demonstrating binding specificity for Shigella dysenteriae, a whole-bacterium Systemic Evolution of Ligands by Exponential enrichment (SELEX) method was applied to a combinatorial library of single-stranded DNA (ssDNA) molecules. After several rounds of selection using S. dysenteriae as the target, the highly enriched oligonucleotide pool was sequenced and then grouped into different families based on primary sequence homologies and similarities in the secondary structures. Aptamer S 1, which showed particularly high binding affinity in preliminary studies, was chosen for further characterisation. This aptamer displayed a dissociation constant (Kd value) of 23.47 ± 2.48 nM. Binding assays to assess the specificity of aptamer S 1 showed high binding affinity for S. dysenteriae and low apparent binding affinity for other bacteria. The ssDNA aptamers generated may serve as a new type of molecular probe for microbial pathogens, as it has the potential to overcome the tedious isolation and purification requirements for complex targets. 相似文献
10.
Hari P. Dwivedi R. Derike Smiley Lee-Ann Jaykus 《Applied microbiology and biotechnology》2010,87(6):2323-2334
The need for pre-analytical sample processing prior to the application of rapid molecular-based detection of pathogens in
food and environmental samples is well established. Although immunocapture has been applied in this regard, alternative ligands
such as nucleic acid aptamers have advantages over antibodies such as low cost, ease of production and modification, and comparable
stability. To identify DNA aptamers demonstrating binding specificity to Campylobacter jejuni cells, a whole-cell Systemic Evolution of Ligands by EXponential enrichment (SELEX) method was applied to a combinatorial
library of FAM-labeled single-stranded DNA molecules. FAM-labeled aptamer sequences with high binding affinity to C. jejuni A9a as determined by flow cytometric analysis were identified. Aptamer ONS-23, which showed particularly high binding affinity
in preliminary studies, was chosen for further characterization. This aptamer displayed a dissociation constant (K
d
value) of 292.8 ± 53.1 nM with 47.27 ± 5.58% cells fluorescent (bound) in a 1.48-μM aptamer solution. Binding assays to assess
the specificity of aptamer ONS-23 showed high binding affinity (25–36%) for all other C. jejuni strains screened (inclusivity) and low apparent binding affinity (1–5%) with non-C. jejuni strains (exclusivity). Whole-cell SELEX is a promising technique to design aptamer-based molecular probes for microbial pathogens
without tedious isolation and purification of complex markers or targets. 相似文献
11.
The human tumor necrosis factor α (hTNF-α) is an important pro-inflammatory cytokine which plays critical roles in inflammatory diseases such as rheumatoid arthritis (RA). The anti-TNF-α proteins can reduce symptoms of RA. Due to limitations of protein-based therapies, it is necessary to find new anti-TNF-α agents instead of common anti-TNF-α proteins. Therefore, the aim of the current study was to identify a new DNA aptamer with anti-hTNF-α activity. The protein systematic evolution of ligands by exponential enrichment (SELEX) process was used for identifying DNA aptamers. Anti-hTNF-α aptamers were selected using dot blot, real-time PCR, and in vitro inhibitory assay. The selected aptamers were truncated in two steps, and finally, a dimer aptamer was constructed from different selected truncates to improve their inhibitory effect. Also, Etanercept was used as a positive control to inhibit TNF-α, in comparison to the designed aptamers. After 11 rounds, four aptamers with anti-hTNF-α inhibitory effect were identified. The truncation and dimerization strategy revealed a new dimer aptamer with 67 nM Kd, which has 40% inhibitory effect compared with Etanercept (60%). Overall, the dimerization and truncation aptamers could improve its activity. With regard to the several limitations of anti-TNF-α proteins therapies including immunogenicity, side effects, and cost-intensive, a new designed anti-hTNF-α dimer aptamer could be considered as a potential therapeutic and/or diagnostic agent for hTNF-α-related disorders. 相似文献
12.
We developed a method for aptamer identification without in vitro selection. We have previously obtained several aptamers, which may fold into the G-quadruplex (G4) structure, against target proteins; therefore, we hypothesized that the G4 structure would be an excellent scaffold for aptamers to recognize the target protein. Moreover, the G4-forming sequence contained in the promoter region of insulin can reportedly bind to insulin. We thus expected that G4 DNAs, which are contained in promoter regions, could act as DNA aptamers against their gene products. We designated this aptamer identification method as “G4 promoter-derived aptamer selection (G4PAS).” Using G4PAS, we identified vascular endothelial growth factor (VEGF)165, platelet-derived growth factor-AA (PDGF)-AA, and RB1 DNA aptamers. Surface plasmon resonance (SPR) analysis revealed that the dissociation constant (K
d) values of VEGF165, PDGF-AA, and RB1 DNA aptamers were 1.7 × 10−7 M, 6.3 × 10−9 M, and 4.4 × 10−7 M, respectively. G4PAS is a simple and rapid method of aptamer identification because it involves only binding analysis of G4 DNAs to the target protein. In the human genome, over 40% of promoters contain one or more potential G4 DNAs. G4PAS could therefore be applied to identify aptamers against target proteins that contain G4 DNAs on their promoters. 相似文献
13.
Two DNA aptamers against a tumor marker protein, human vascular endothelial growth factor (VEGF165) were identified. In the screening process, another protein was used as the competitor to isolate those aptamers that have
high specificity for the target. In addition, we evaluated the affinities of the enriched library by means of aptamer blotting.
The isolated aptamers bound to VEGF165 with a K
d value in the range of a few hundred nanomoles, and did not bind to the competitor. This selection method enabled us to efficiently
select the specific aptamers against the target protein. These specific aptamers would be useful sensor elements for cancer
diagnosis. 相似文献
14.
The Ability of “Low G + C Gram-Positive” Ruminal Bacteria to Resist Monensin and Counteract Potassium Depletion 总被引:1,自引:0,他引:1
Gram-negative ruminal bacteria with an outer membrane are generally more resistant to the feed additive, monensin, than Gram-positive
species, but some bacteria can adapt and increase their resistance. 16S rRNA sequencing indicates that a variety of ruminal
bacteria are found in the “low G + C Gram-positive group,” but some of these bacteria are monensin resistant and were previously
described as Gram-negative species (e.g., Selenomonas ruminantium and Megasphaera elsdenii). The activity of monensin can be assayed by its ability to cause potassium loss, and results indicated that the amount of
monensin needed to catalyze half maximal potassium depletion (Kd) from low G + C gram-positive ruminal bacteria varied by as much as 130-fold. The Kd values for Butyrivibrio fibrisolvens 49, Streptococcus bovis JB1, Clostridium aminophilum F, S. ruminantium HD4, and M. elsdenii B159 were 10, 65, 100, 1020, and 1330 nM monensin, respectively. B. fibrisolvens was very sensitive to monensin, and it did not adapt. S. bovis and C. aminophilum cultures that were transferred repeatedly with sub-lethal doses of monensin had higher Kd values than unadapted cultures, but the Kd was always less than 800 nM. S. ruminantium and M. elsdenii cells were highly resistant (Kd > 1000 nM), and this resistance could be explained by the ability of these low G + C Gram-positive bacteria to synthesize
outer membranes.
Received: 14 May 1999 / Accepted: 24 June 1999 相似文献
15.
16.
Shirin Kouhpayeh Zahra Hejazi Maryam Boshtam Mina Mirian Ilnaz Rahimmanesh Leila Darzi Abbas Rezaei Laleh Shariati Hossein Khanahmad 《Journal of cellular biochemistry》2019,120(9):16264-16272
One of the most important molecules for multiple sclerosis pathogenesis is α4 integrin, which is responsible for autoreactive leukocytes migration into the brain. The monoclonal antibody, natalizumab, was introduced to market for blocking the extravasation of autoreactive leukocytes via inhibition of α4 integrin. However, the disadvantages of antibodies provided a suitable background for other agents to be replaced with antibodies. Considering the profound advantages of aptamers over antibodies, aptamer isolation against α4 integrin was intended in the current study. The α4 integrin-specific aptamers were selected using cell-systematic evolution of ligands by exponential enrichment (SELEX) method with human embryonic kidney (HEK)-293T overexpressing α4 integrin and HEK-293T as target and control cells, respectively. Evaluation of selected aptamer was performed through flow cytometric analysis. The selected clones were then sequenced and analyzed for any possible secondary structure and affinity. The results of this study led to isolation of 13 different single-stranded DNA clones in 11 rounds of selection which were categorized to three clusters based on common structural motifs and the equilibrium dissociation constant (K d) of the most stable structure was calculated. The evaluation of SELEX progress showed growth in aptamer affinity with increasing of the number of cycles. Taken together, the findings of this study demonstrated the isolation of α4-specific single-stranded DNA aptamers with suitable affinity for ligand, which can further be replaced with natalizumab. 相似文献
17.
Nivedita P. Khairnar Ganesh Kumar Maurya Neha Pandey Anubrata Das Hari S. Misra 《Molecular microbiology》2019,112(3):854-865
The GC‐rich genome of Deinococcus radiodurans contains a very high density of putative guanine quadruplex (G4) DNA motifs and its RecQ (drRecQ) was earlier characterized as a 3′→5′ dsDNA helicase. We saw that N‐Methyl mesoporphyrin IX (NMM), a G4 DNA binding drug affected normal growth as well as the gamma radiation resistance of the wild‐type bacterium. Interestingly, NMM treatment and recQ deletion showed additive effect on normal growth but there was no effect of NMM on gamma radiation resistance of recQ mutant. The recombinant drRecQ showed ~400 times higher affinity to G4 DNA (Kd = 11.74 ± 1.77 nM) as compared to dsDNA (Kd = 4.88 ± 1.30 µM). drRecQ showed ATP independent helicase function on G4 DNA, which was higher than ATP‐dependent helicase activity on dsDNA. Unlike wild‐type cells that sparingly stained for G4 structure with Thioflavin T (ThT), recQ mutant showed very high‐density of ThT fluorescence foci on DNA indicating an important role of drRecQ in regulation of G4 DNA structure dynamics in vivo. These results together suggested that drRecQ is an ATP independent G4 DNA helicase that plays an important role in the regulation of G4 DNA structure dynamics and its impact on radioresistance in D. radiodurans. 相似文献
18.
Selective inhibitory DNA aptamers of the human RNase H1 总被引:5,自引:1,他引:4
Pileur F Andreola ML Dausse E Michel J Moreau S Yamada H Gaidamakov SA Crouch RJ Toulmé JJ Cazenave C 《Nucleic acids research》2003,31(19):5776-5788
Human RNase H1 binds double-stranded RNA via its N-terminal domain and RNA–DNA hybrid via its C-terminal RNase H domain, the latter being closely related to Escherichia coli RNase HI. Using SELEX, we have generated a set of DNA sequences that can bind efficiently (Kd values ranging from 10 to 80 nM) to the human RNase H1. None of them could fold into a simple perfect double-stranded DNA hairpin confirming that double-stranded DNA does not constitute a trivial ligand for the enzyme. Only two of the 37 DNA aptamers selected were inhibitors of human RNase H1 activity. The two inhibitory oligomers, V-2 and VI-2, were quite different in structure with V-2 folding into a large, imperfect but stable hairpin loop. The VI-2 structure consists of a central region unimolecular quadruplex formed by stacking of two guanine quartets flanked by the 5′ and 3′ tails that form a stem of six base pairs. Base pairing between the 5′ and 3′ tails appears crucial for conferring the inhibitory properties to the aptamer. Finally, the inhibitory aptamers were capable of completely abolishing the action of an antisense oligonucleotide in a rabbit reticulocyte lysate supplemented with human RNase H1, with IC50 ranging from 50 to 100 nM. 相似文献
19.
Shraddha Aptekar Mohit Arora Clare Louise Lawrence Robert William Lea Katherine Ashton Tim Dawson Jane Elizabeth Alder Lisa Shaw 《PloS one》2015,10(8)
Malignant glioma is characterised by a rapid growth rate and high capacity for invasive infiltration to surrounding brain tissue; hence, diagnosis and treatment is difficult and patient survival is poor. Aptamers contribute a promising and unique technology for the in vitro imaging of live cells and tissues, with a potentially bright future in clinical diagnostics and therapeutics for malignant glioma. The binding selectivity, uptake capacity and binding target of two DNA aptamers, SA43 and SA44, were investigated in glioma cells and patient tissues. The binding assay showed that SA43 and SA44 bound with strong affinity (Kd, 21.56 ± 4.60 nM and Kd, 21.11 ± 3.30 nM respectively) to the target U87MG cells. Quantitative analysis by flow cytometry showed that the aptamers were able to actively internalise in U87MG and 1321N1 glioma cells compared to the non-cancerous and non-glioma cell types. Confocal microscopy confirmed staining in the cytoplasm, and co-localisation studies with endoplasmic reticulum, Golgi apparatus and lysosomal markers suggested internalisation and compartmentalisation within the endomembrane system. Both aptamers selectively bound to Ku 70 and Ku 80 DNA repair proteins as determined by aptoprecipitation (AP) followed by mass spectrometry analysis and confirmation by Western blot. In addition, aptohistochemical (AHC) staining on paraffin embedded, formalin fixed patient tissues revealed that the binding selectivity was significantly higher for SA43 aptamer in glioma tissues (grade I, II, III and IV) compared to the non-cancerous tissues, whereas SA44 did not show selectivity towards glioma tissues. The results indicate that SA43 aptamer can differentiate between glioma and non-cancerous cells and tissues and therefore, shows promise for histological diagnosis of glioma. 相似文献