IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4.

Poly(A) binding protein (PABP) binds mRNA poly(A) tails and affects mRNA stability and translation. We show here that there is little free PABP in NIH3T3 cells, with the vast majority complexed with RNA. We found that PABP in NIH3T3 cytoplasmic lysates and recombinant human PABP can bind to AU-rich RNA with high affinity. Human PABP bound an AU-rich RNA with Kd in the nm range, which was only sixfold weaker than the affinity for oligo(A) RNA. Truncated PABP containing RNA recognition motif domains 3 and 4 retained binding to both AU-rich and oligo(A) RNA, whereas a truncated PABP containing RNA recognition motif domains 1 and 2 was highly selective for oligo(A) RNA. The inducible PABP, iPABP, was found to be even less discriminating than PABP in RNA binding, with affinities for AU-rich and oligo(A) RNAs differing by only twofold. These data suggest that iPABP and PABP may in some situations interact with other RNA regions in addition to the poly(A) tail.     

Poly(A)-binding protein facilitates translation of an uncapped/nonpolyadenylated viral RNA by binding to the 3' untranslated region

Viruses employ an alternative translation mechanism to exploit cellular resources at the expense of host mRNAs and to allow preferential translation. Plant RNA viruses often lack both a 5' cap and a 3' poly(A) tail in their genomic RNAs. Instead, cap-independent translation enhancer elements (CITEs) located in the 3' untranslated region (UTR) mediate their translation. Although eukaryotic translation initiation factors (eIFs) or ribosomes have been shown to bind to the 3'CITEs, our knowledge is still limited for the mechanism, especially for cellular factors. Here, we searched for cellular factors that stimulate the 3'CITE-mediated translation of Red clover necrotic mosaic virus (RCNMV) RNA1 using RNA aptamer-based one-step affinity chromatography, followed by mass spectrometry analysis. We identified the poly(A)-binding protein (PABP) as one of the key players in the 3'CITE-mediated translation of RCNMV RNA1. We found that PABP binds to an A-rich sequence (ARS) in the viral 3' UTR. The ARS is conserved among dianthoviruses. Mutagenesis and a tethering assay revealed that the PABP-ARS interaction stimulates 3'CITE-mediated translation of RCNMV RNA1. We also found that both the ARS and 3'CITE are important for the recruitment of the plant eIF4F and eIFiso4F factors to the 3' UTR and of the 40S ribosomal subunit to the viral mRNA. Our results suggest that dianthoviruses have evolved the ARS and 3'CITE as substitutes for the 3' poly(A) tail and the 5' cap of eukaryotic mRNAs for the efficient recruitment of eIFs, PABP, and ribosomes to the uncapped/nonpolyadenylated viral mRNA.     

Dual Interactions of the Translational Repressor Paip2 with Poly(A) Binding Protein

The cap structure and the poly(A) tail of eukaryotic mRNAs act synergistically to enhance translation. This effect is mediated by a direct interaction of eukaryotic initiation factor 4G and poly(A) binding protein (PABP), which brings about circularization of the mRNA. Of the two recently identified PABP-interacting proteins, one, Paip1, stimulates translation, and the other, Paip2, which competes with Paip1 for binding to PABP, represses translation. Here we studied the Paip2-PABP interaction. Biacore data and far-Western analysis revealed that Paip2 contains two binding sites for PABP, one encompassing a 16-amino-acid stretch located in the C terminus and a second encompassing a larger central region. PABP also contains two binding regions for Paip2, one located in the RNA recognition motif (RRM) region and the other in the carboxy-terminal region. A two-to-one stoichiometry for binding of Paip2 to PABP with two independent K(d)s of 0.66 and 74 nM was determined. Thus, our data demonstrate that PABP and Paip2 could form a trimeric complex containing one PABP molecule and two Paip2 molecules. Significantly, only the central Paip2 fragment, which binds with high affinity to the PABP RRM region, inhibits PABP binding to poly(A) RNA and translation.     

Recognition of polyadenylate RNA by the poly(A)-binding protein.

The cocrystal structure of human poly(A)-binding protein (PABP) has been determined at 2.6 A resolution. PABP recognizes the 3' mRNA poly(A) tail and plays critical roles in eukaryotic translation initiation and mRNA stabilization/degradation. The minimal PABP used in this study consists of the N-terminal two RRM-type RNA-binding domains connected by a short linker (RRM1/2). These two RRMs form a continuous RNA-binding trough, lined by an antiparallel beta sheet backed by four alpha helices. The polyadenylate RNA adopts an extended conformation running the length of the molecular trough. Adenine recognition is primarily mediated by contacts with conserved residues found in the RNP motifs of the two RRMs. The convex dorsum of RRM1/2 displays a phylogenetically conserved hydrophobic/acidic portion, which may interact with translation initiation factors and regulatory proteins.     

Inhibitory effect of naked neural BC1 RNA or BC200 RNA on eukaryotic in vitro translation systems is reversed by poly(A)-binding protein (PABP)

Regulated protein biosynthesis in dendrites of neurons might be a key mechanism underlying learning and memory. Neuronal dendritic BC1 RNA and BC200 RNA and similar small untranslated RNAs inhibit protein translation in vitro systems, such as rabbit reticulocyte lysate. Likewise, co-transfection of these RNAs with reporter mRNA suppressed translation levels in HeLa cells. The oligo(A)-rich region of all active small RNAs were identified as the RNA domains chiefly responsible for the inhibitory effects. Addition of recombinant human poly(A)-binding protein (PABP) significantly compensated the inhibitory effect of the small oligo(A)-rich RNA. In vivo, all BC1 RNA appears to be complexed with PABP. Nevertheless, in the micro-environment of dendritic spines of neuronal cells, BC1 RNPs or BC200 RNPs might mediate regulatory functions by differential interactions with locally limited PABP and/or directly or indirectly, with other translation initiation factors.     

Modifiers of solid RNP granules control normal RNP dynamics and mRNA activity in early development

Ribonucleoproteins (RNPs) often coassemble into supramolecular bodies with regulated dynamics. The factors controlling RNP bodies and connections to RNA regulation are unclear. During Caenorhabditis elegans oogenesis, cytoplasmic RNPs can transition among diffuse, liquid, and solid states linked to mRNA regulation. Loss of CGH-1/Ddx6 RNA helicase generates solid granules that are sensitive to mRNA regulators. Here, we identified 66 modifiers of RNP solids induced by cgh-1 mutation. A majority of genes promote or suppress normal RNP body assembly, dynamics, or metabolism. Surprisingly, polyadenylation factors promote RNP coassembly in vivo, suggesting new functions of poly(A) tail regulation in RNP dynamics. Many genes carry polyglutatmine (polyQ) motifs or modulate polyQ aggregation, indicating possible connections with neurodegenerative disorders induced by CAG/polyQ expansion. Several RNP body regulators repress translation of mRNA subsets, suggesting that mRNAs are repressed by multiple mechanisms. Collectively, these findings suggest new pathways of RNP modification that control large-scale coassembly and mRNA activity during development.     

Shared protein components of SINE RNPs

The heterogeneous, short RNAs produced from the high, copy, short mobile elements (SINEs) interact with proteins to form RNA-protein (RNP) complexes. In particular, the BC1 RNA, which is transcribed to high levels specifically in brain and testis from one locus of the ID SINE family, exists as a discrete RNP complex. We expressed a series of altered BC1, and other SINE-related RNAs, in several cell lines and tested for the mobility of the resulting RNP complexes in a native PAGE assay to determine which portions of these SINE RNAs contribute to protein binding. When different SINE RNAs were substituted for the BC1 ID sequence, the resulting RNPs exhibited the same mobility as BC1. This indicates that the protein(s) binding to the ID portion of BC1 is not sequence specific and may be more dependent upon the secondary structure of the RNA. It also suggests that all SINE RNAs may bind a similar set of cellular proteins. Deletion of the A-rich region of BC1 RNA has a marked effect on the mobility of the RNP. Rodent cell lines exhibit a slightly different mobility for this shifted complex when compared to human cell lines, reflecting evolutionary differences in one or more of the protein components. On the basis of mobility change observed in RNP complexes when the A-rich region is removed, we decided to examine poly(A) binding protein (PABP) as a candidate member of the RNP. An antibody against the C terminus of PABP is able to immunoprecipitate BC1 RNA, confirming PABP's presence in the BC1 RNP. Given the ubiquitous role of poly(A) regions in the retrotransposition process, these data suggest that PABP may contribute to the SINE retrotransposition process.     

Poly (A) binding protein is bound to both stored and polysomal mRNAs in the mammalian testis

RNA-binding proteins that bind to the 3′ untranslated region of mRNAs play important roles in regulating gene expression. Here we examine the association between the 70 kDa poly (A) binding protein (PABP) and stored (RNP) and polysomal mRNAs during mammalian male germ cell development. PABP mRNA levels increase as germ cells enter meiosis, reaching a maximum in the early postmeiotic stages, and decreasing to a nearly nondetectable level towards the end of spermatogenesis. Most of the PABP mRNA is found in the nonpolysomal fractions of postmitochondrial extracts, suggesting that PABP mRNA is either inefficiently translated or stored as RNPs during spermatogenesis. Virtually all of the testicular PABP is bound to either polysomal or nonpolysomal mRNAs, with little, if any, free PABP detectable. Analysis of several specific mRNAs reveals PABP is bound to both stored (RNP) and translated forms of the mRNAs. Western blot analysis and immunocytochemistry indicate PABP is widespread in the mammalian testis, with maximal amounts detected in postmeiotic round spermatids. The presence of PABP in elongating spermatids, a cell type in which PABP mRNA is nearly absent, suggests that PABP is a stable protein in the later stages of male germ cell development. The high level of testicular PABP in round spermatids and in mRNPs suggests a role for PABP in the storage as well as in the subsequent translation of developmentally regulated mRNAs in the mammalian testis. © 1995 Wiley-Liss, Inc.     

A cytoplasmic ribonucleoprotein complex containing a small RNA inhibitor of protein synthesis

Ribonucleoprotein complexes (RNP) sedimenting between 10 and 15 S were isolated from the postpolysomal cytoplasmic fraction of embryonic chicken muscle. These RNP complexes lack mRNA but contain RNA with a sedimentation coefficient of 4.4 S. The 4.4 S RNA did not arise as a product of degradation during the course of the isolation procedure nor did it contain oligo(U)- or poly(A)-rich regions. Furthermore, the 4.4 S RNA-containing RNP complex was easily separable from free mRNPs and, therefore, is not considered as part of the free mRNP complexes. Both the 4.4 S RNA and 10 to 15 S RNP were able to inhibit translation of either "capped" or "uncapped" mRNA in a heterologous cell-free system. This inhibitory effect may result from interference of 4.4 S RNA with an early event in mRNA translation. A large number of polypeptides of Mr = 14,000 to 220,000 were present in the 10 to 15 S RNP. Among these, the most prominent polypeptides were of Mr = 36,000; 48,000; 52,000; 58,000; 65,000; 78,000; 84,000; 96,000; 105,000; 165,000; and 220,000. With the exception of the Mr = 36,000 polypeptide, these major components were also found in the nonpolysomal cytoplasmic mRNA protein complexes (free mRNP).     

Translational repression by a novel partner of human poly(A) binding protein, Paip2

The eukaryotic mRNA 3' poly(A) tail acts synergistically with the 5' cap structure to enhance translation. This effect is mediated by a bridging complex, composed of the poly(A) binding protein (PABP), eIF4G, and the cap binding protein, eIF4E. PABP-interacting protein 1 (Paip1) is another factor that interacts with PABP to coactivate translation. Here, we describe a novel human PABP-interacting protein (Paip2), which acts as a repressor of translation both in vitro and in vivo. Paip2 preferentially inhibits translation of a poly(A)-containing mRNA, but has no effect on the translation of hepatitis C virus mRNA, which is cap- and eIF4G-independent. Paip2 decreases the affinity of PABP for polyadenylate RNA, and disrupts the repeating structure of poly(A) ribonucleoprotein. Furthermore, Paip2 competes with Paip1 for PABP binding. Thus, Paip2 inhibits translation by interdicting PABP function.     

The flip-flop configuration of the PABP-dimer leads to switching of the translation function

Poly(A)-binding protein (PABP) is a translation initiation factor that interacts with the poly(A) tail of mRNAs. PABP bound to poly(A) stimulates translation by interacting with the eukaryotic initiation factor 4G (eIF4G), which brings the 3′ end of an mRNA close to its 5′ m⁷G cap structure through consecutive interactions of the 3′-poly(A)–PABP-eIF4G-eIF4E-5′ m⁷G cap. PABP is a highly abundant translation factor present in considerably larger quantities than mRNA and eIF4G in cells. However, it has not been elucidated how eIF4G, present in limited cellular concentrations, is not sequestered by mRNA-free PABP, present at high cellular concentrations, but associates with PABP complexed with the poly(A) tail of an mRNA. Here, we report that RNA-free PABPs dimerize with a head-to-head type configuration of PABP, which interferes in the interaction between PABP and eIF4G. We identified the domains of PABP responsible for PABP–PABP interaction. Poly(A) RNA was shown to convert the PABP–PABP complex into a poly(A)–PABP complex, with a head-to-tail-type configuration of PABP that facilitates the interaction between PABP and eIF4G. Lastly, we showed that the transition from the PABP dimer to the poly(A)–PABP complex is necessary for the translational activation function.     

Overexpression of poly(A) binding protein prevents maturation-specific deadenylation and translational inactivation in Xenopus oocytes.

The translational regulation of maternal mRNAs is the primary mechanism by which stage-specific programs of protein synthesis are executed during early development. Translation of a variety of maternal mRNAs requires either the maintenance or cytoplasmic elongation of a 3' poly(A) tail. Conversely, deadenylation results in translational inactivation. Although its precise function remains to be elucidated, the highly conserved poly(A) binding protein I (PABP) mediates poly(A)-dependent events in translation initiation and mRNA stability. Xenopus oocytes contain less than one PABP per poly(A) binding site suggesting that the translation of maternal mRNAs could be either limited by or independent of PABP. In this report, we have analyzed the effects of overexpressing PABP on the regulation of mRNAs during Xenopus oocyte maturation. Increased levels of PABP prevent the maturation-specific deadenylation and translational inactivation of maternal mRNAS that lack cytoplasmic polyadenylation elements. Overexpression of PABP does not interfere with maturation-specific polyadenylation, but reduces the recruitment of some mRNAs onto polysomes. Deletion of the C-terminal basic region and a single RNP motif from PABP significantly reduces both its binding to polyadenylated RNA in vivo and its ability to prevent deadenylation. In contrast to a yeast PABP-dependent poly(A) nuclease, PABP inhibits Xenopus oocyte deadenylase in vitro. These results indicate that maturation-specific deadenylation in Xenopus oocytes is facilitated by a low level of PABP consistent with a primary function for PABP to confer poly(A) stability.     

iPABP, an inducible poly(A)-binding protein detected in activated human T cells.

The poly(A)-binding protein (PABP) binds to the poly(A) tail present at the 3' ends of most eukaryotic mRNAs. PABP is thought to play a role in both translation and mRNA stability. Here we describe the molecular cloning and characterization of an inducible PABP, iPABP, from a cDNA library prepared from activated T cells. iPABP shows 79% sequence identity to PABP at the amino acid level. The RNA binding domains of iPABP and PABP are nearly identical, while their C termini are more divergent. Like PABP, iPABP is primarily localized to the cytoplasm. iPABP is expressed at low levels in resting normal human T cells; following T-cell activation, however, iPABP mRNA levels are rapidly up-regulated. In contrast, PABP is constitutively expressed in both resting and activated T cells. iPABP mRNA was also expressed at much higher levels than PABP mRNA in heart and skeletal muscle tissue. These data suggest that the regulation of cytoplasmic poly(A)-binding activity is more complex than previously believed. In most tissues, poly(A)-binding activity is likely to be the result of the combined effects of constitutively expressed PABP and iPABP, whose expression is subject to more complex regulation.     

General RNA‐binding proteins have a function in poly(A)‐binding protein‐dependent translation

The interaction between the poly(A)‐binding protein (PABP) and eukaryotic translational initiation factor 4G (eIF4G), which brings about circularization of the mRNA, stimulates translation. General RNA‐binding proteins affect translation, but their role in mRNA circularization has not been studied before. Here, we demonstrate that the major mRNA ribonucleoprotein YB‐1 has a pivotal function in the regulation of eIF4F activity by PABP. In cell extracts, the addition of YB‐1 exacerbated the inhibition of 80S ribosome initiation complex formation by PABP depletion. Rabbit reticulocyte lysate in which PABP weakly stimulates translation is rendered PABP‐dependent after the addition of YB‐1. In this system, eIF4E binding to the cap structure is inhibited by YB‐1 and stimulated by a nonspecific RNA. Significantly, adding PABP back to the depleted lysate stimulated eIF4E binding to the cap structure more potently if this binding had been downregulated by YB‐1. Conversely, adding nonspecific RNA abrogated PABP stimulation of eIF4E binding. These data strongly suggest that competition between YB‐1 and eIF4G for mRNA binding is required for efficient stimulation of eIF4F activity by PABP.     

The DEAD-box helicase DDX3 substitutes for the cap-binding protein eIF4E to promote compartmentalized translation initiation of the HIV-1 genomic RNA

Here, we show a novel molecular mechanism promoted by the DEAD-box RNA helicase DDX3 for translation of the HIV-1 genomic RNA. This occurs through the adenosine triphosphate-dependent formation of a translation initiation complex that is assembled at the 5′ m⁷GTP cap of the HIV-1 mRNA. This is due to the property of DDX3 to substitute for the initiation factor eIF4E in the binding of the HIV-1 m⁷GTP 5′ cap structure where it nucleates the formation of a core DDX3/PABP/eIF4G trimeric complex on the HIV-1 genomic RNA. By using RNA fluorescence in situ hybridization coupled to indirect immunofluorescence, we further show that this viral ribonucleoprotein complex is addressed to compartmentalized cytoplasmic foci where the translation initiation complex is assembled.     

Poly(A) binding protein, C-terminally truncated by the hepatitis A virus proteinase 3C, inhibits viral translation

Proteolytic cleavage of translation initiation factors is a means to interfere with mRNA circularization and to induce translation arrest during picornaviral replication or apoptosis. It was shown that the regulated cleavages of eukaryotic initiation factor (eIF) 4G and poly(A)-binding protein (PABP) by viral proteinases correlated with early and late arrest of host cap-dependent and viral internal ribosome entry site (IRES)-dependent translation, respectively. Here we show that in contrast to coxsackievirus, eIF4G is not a substrate of proteinase 3C of hepatitis A virus (HAV 3C^pro). However, PABP is cleaved by HAV 3C^pro in vitro and in vivo, separating the N-terminal RNA-binding domain (NTD) of PABP from the C-terminal protein-interaction domain. In vitro, NTD has a dominant negative effect on HAV IRES-dependent translation and an enhanced binding affinity to the RNA structural element pY1 in the 5′ nontranslated region of the HAV RNA that is essential for viral genome replication. The results point to a regulatory role of PABP cleavage in RNA template switching of viral translation to RNA synthesis.