Regulation of interaction of the iron-responsive element binding protein with iron-responsive RNA elements.

The 5' untranslated region of the ferritin heavy-chain mRNA contains a stem-loop structure called an iron-responsive element (IRE), that is solely responsible for the iron-mediated control of ferritin translation. A 90-kilodalton protein, called the IRE binding protein (IRE-BP), binds to the IRE and acts as a translational repressor. IREs also explain the iron-dependent control of the degradation of the mRNA encoding the transferrin receptor. Scatchard analysis reveals that the IRE-BP exists in two states, each of which is able to specifically interact with the IRE. The higher-affinity state has a Kd of 10 to 30 pM, and the lower affinity state has a Kd of 2 to 5 nM. The reversible oxidation or reduction of a sulfhydryl is critical to this switching, and the reduced form is of the higher affinity while the oxidized form is of lower affinity. The in vivo rate of ferritin synthesis is correlated with the abundance of the high-affinity form of the IRE-BP. In lysates of cells treated with iron chelators, which decrease ferritin biosynthesis, a four- to fivefold increase in the binding activity is seen and this increase is entirely caused by an increase in high-affinity binding sites. In desferrioxamine-treated cells, the high-affinity form makes up about 50% of the total IRE-BP, whereas in hemin-treated cells, the high-affinity form makes up less than 1%. The total amount of IRE-BP in the cytosol of cells is the same regardless of the prior iron treatment of the cell. Furthermore, a mutated IRE is not able to interact with the IRE-BP in a high-affinity form but only at a single lower affinity Kd of 0.7 nM. Its interaction with the IRE-BP is insensitive to the sulfhydryl status of the protein.     

An atypical iron-responsive element (IRE) within crayfish ferritin mRNA and an iron regulatory protein 1 (IRP1)-like protein from crayfish hepatopancreas

A putative crayfish iron-responsive element (IRE) is present in the 5'-untranslated region of the crayfish ferritin mRNA. The putative crayfish IRE is in a cap-proximal position and shares most of the structural features of the consensus IRE, but the RNA stem-loop structure contains a bulge of a guanine instead of a cytosine at the expected position, so far thought to be a hallmark of IREs. By using an electromobility shift assay this IRE was shown to specifically bind purified recombinant human iron regulatory protein 1 (IRP1) as well as a factor(s) present in a homogenate of crayfish hepatopancreas, likely to be a crayfish IRP1 homologue. With mutations in the crayfish IRE, the affinity of IRP to IRE was drastically decreased. A cDNA encoding an IRP1-like protein was cloned from the hepatopancreas of crayfish. This protein has sequence similarities to IRP, and contains all the active-site residues of aconitase, two putative RNA-binding regions and a putative contact site between RNA and IRP. These results show that a crayfish IRE, lacking the bulged C, can bind IRP1 in vitro and that an IRP1-like protein present in crayfish hepatopancreas may have both aconitase and RNA-binding activities.     

RBBP6 interacts with multifunctional protein YB-1 through its RING finger domain, leading to ubiquitination and proteosomal degradation of YB-1

RBBP6 (retinoblastoma binding protein 6) is a 250-kDa multifunctional protein that interacts with both p53 and pRb and has been implicated in mRNA processing. It has also been identified as a putative E3 ubiquitin ligase due to the presence of a RING finger domain, although no substrate has been identified up to now. Using the RING finger domain as bait in a yeast two-hybrid screen, we identified YB-1 (Y-box binding protein 1) as a binding partner of RBBP6, localising the interaction to the last 62 residues of YB-1. We showed, furthermore, that both full-length RBBP6 and the isolated RING finger domain were able to ubiquitinate YB-1, resulting in its degradation in the proteosome. As a result, RBBP6 was able to suppress the levels of YB-1 in vivo and to reduce its transactivational ability. In the light of the important role that YB-1 appears to play in tumourigenesis, our results suggest that RBBP6 may be a relevant target for therapeutic drugs aimed at modifying the activity of YB-1.     

Characteristics of the interaction of the ferritin repressor protein with the iron-responsive element

Summary The iron-responsive regulation of ferritin mRNA translation is mediated by the specific interaction of the ferritin repressor protein (FRP) with the iron-responsive element (IRE), a highly conserved 28-nucleotide sequence located in the 5 untranslated region of ferritin mRNAs. The IRE alone is necessary and sufficient to confer repression of translation by FRP upon a heterologous message, chloramphenicol acetyltransferase, in an in vitro translation system. The activity of FRP is sensitive to iron in vivo. Cytoplasmic extracts of rabbit kidney cells show reduction of FRP activity when grown in the presence of iron, as detected by RNA band shift assay. Using a nitrocellulose filter binding assay to examine the interaction of FRP with the IRE in more detail, we find that purified FRP has a single high-affinity binding site for the IRE with aK _d of 20–50 pM. Hemin pretreatment decreases the total amount of FRP which can bind to the IRE. This effect is dependent on hemin concentration. Interestingly, the FRP which remains active at a given hemin concentration binds to the IRE with the same high affinity as untreated FRP. A variety of hemin concentrations were examined for their effect on preformed FRP/IRE complexes. All hemin concentrations tested resulted in rapid complex breakdown. The final amount of complex breakdown corresponds to the concentration of hemin present in the reaction. The effect of hemin on FRP activity suggests that a specific hemin binding site exists on FRP.Abbreviations IRE iron-responsive element - FRP ferritin repressor protein - CAT chloramphenicol acetyltransferase - ORF open reading frame     

Proteasomal degradation of the multifunctional regulator YB-1 is mediated by an F-Box protein induced during programmed cell death

F-Box proteins (FBPs) are variable adaptor proteins that earmark protein substrates for ubiquination and destruction by the proteasome. Through their N-terminal F-box motif, they couple specific protein substrates to a catalytic machinery known as SCF (Skp-1/Cul1/F-Box) E3-ubiquitin ligase. Typical FBPs bind the specific substrates in a phosphorylation dependent manner via their C-termini using either leucine rich repeats (LRR) or tryptophan-aspartic acid (WD40) domains for substrate recognition. By using a gene trap strategy that selects for genes induced during programmed cell death, we have isolated the mouse homolog of the hypothetical human F-Box protein 33 (FBX33). Here we identify FBX33 as a component of an SCF E3-ubiquitin ligase that targets the multifunctional regulator Y-box binding protein 1 (YB-1)/dbpB/p50 for polyubiquitination and destruction by the proteasome. By targeting YB-1 for proteasomal degradation, FBX33 negatively interferes with YB-1 mediated functions. In contrast to typical FBPs, FBX33 has no C-terminal LRR or WD40 domains and associates with YB-1 via its N-terminus. The present study confirms the existence of a formerly hypothetical F-Box protein in living cells and describes one of its substrates.     

Alternative splicing regulation by interaction of phosphatase PP2Cgamma with nucleic acid-binding protein YB-1

Kinases and phosphatases participate in precursor messenger RNA (pre-mRNA) splicing regulation, but their precise roles and the identities of their cofactors and substrates remain poorly understood. The human Ser/Thr phosphatase PP2Cgamma promotes spliceosome assembly. We show that PP2Cgamma's distinctive acidic domain is essential for its activity in splicing and interacts with YB-1, a spliceosome-associated factor. Moreover, PP2Cgamma is a phosphoprotein in vivo, and its acidic domain is phosphorylated under splicing conditions in vitro. PP2Cgamma phosphorylation enhances its interaction with YB-1 and is reversed by the phosphatase in cis. PP2Cgamma knockdown leaves constitutive splicing unaffected but inhibits cell proliferation and affects alternative splicing of CD44, a YB-1 target. This effect on splicing regulation is mediated by PP2Cgamma's acidic domain, which is essential to promote inclusion of CD44 exons v4 and v5 in vivo. We propose that PP2Cgamma modulates alternative splicing of specific pre-mRNAs coregulated by YB-1.     

An acidic protein, YBAP1, mediates the release of YB-1 from mRNA and relieves the translational repression activity of YB-1

Eukaryotic Y-box proteins are nucleic acid-binding proteins implicated in a wide range of gene regulatory mechanisms. They contain the cold shock domain, which is a nucleic acid-binding structure also found in bacterial cold shock proteins. The Y-box protein YB-1 is known to be a core component of messenger ribonucleoprotein particles (mRNPs) in the cytoplasm. Here we disrupted the YB-1 gene in chicken DT40 cells. Through the immunoprecipitation of an epitope-tagged YB-1 protein, which complemented the slow-growth phenotype of YB-1-depleted cells, we isolated YB-1-associated complexes that likely represented general mRNPs in somatic cells. RNase treatment prior to immunoprecipitation led to the identification of a Y-box protein-associated acidic protein (YBAP1). The specific association of YB-1 with YBAP1 resulted in the release of YB-1 from reconstituted YB-1-mRNA complexes, thereby reducing the translational repression caused by YB-1 in the in vitro system. Our data suggest that YBAP1 induces the remodeling of YB-1-mRNA complexes.     

Differential translational regulation of IRE-containing mRNAs in Drosophila melanogaster by endogenous IRP and a constitutive human IRP1 mutant

Insects, like vertebrates, express iron regulatory proteins (IRPs) that may regulate proteins in cellular iron storage and energy metabolism. Two mRNAs, an unspliced form of ferritin H mRNA and succinate dehydrogenase subunit b (SDHb) mRNA, are known to comprise an iron responsive element (IRE) in their 5'-untranslated region making them susceptible to translational repression by IRPs at low iron levels. We have investigated the effect of wild-type human IRP1 (hIRP1) and the constitutively active mutant hIRP1-S437 in transgenic Drosophila melanogaster. Endogenous Drosophila IRE-binding activity was readily detected in gel retardation assays. However, translational repression assessed by polysome gradients was only visible for unspliced IRE-containing ferritin H mRNA, but not for SDHb mRNA. Upon expression of exogenous hIRP1-S437 both mRNAs were strongly repressed. This correlated with a diminished survival rate of adult flies with hIRP1 and complete lethality with hIRP1-S437. We conclude that constitutive IRP1 expression is deleterious to fly survival, probably due to the essential function of SDHb or proteins encoded by yet unidentified target mRNAs.     

Inhibition of an iron-responsive element/iron regulatory protein-1 complex by ATP binding and hydrolysis

Iron regulatory protein-1 binding to the iron-responsive element of mRNA is sensitive to iron, oxidative stress, NO, and hypoxia. Each of these agents changes the level of intracellular ATP, suggesting a link between iron levels and cellular energy metabolism. Furthermore, restoration of iron regulatory protein-1 aconitase activity after NO removal has been shown to require mitochondrial ATP. We demonstrate here that the iron-responsive element-binding activity of iron regulatory protein is ATP-dependent in HepG2 cells. Iron cannot decrease iron regulatory protein binding activity in cell extracts if they are simultaneously treated with an uncoupler of oxidative phosphorylation. Physiologic concentrations of ATP inhibit iron-responsive element/iron regulatory protein binding in cell extracts and binding of iron-responsive element to recombinant iron regulatory protein-1. ADP has the same effect, in contrast to the nonhydrolyzable analog adenosine 5'-(beta,gamma-imido)triphosphate, indicating that in order to inhibit iron regulatory protein-1 binding activity, ATP must be hydrolyzed. Indeed, recombinant iron regulatory protein-1 binds ATP with a Kd of 86+/-17 microM in a filter-binding assay, and can be photo-crosslinked to azido-ATP. Upon binding, ATP is hydrolyzed. The kinetic parameters [Km=5.3 microM, Vmax=3.4 nmol.min(-1).(mg protein)(-1)] are consistent with those of a number of other ATP-hydrolyzing proteins, including the RNA-binding helicases. Although the iron-responsive element does not itself hydrolyze ATP, its presence enhances iron regulatory protein-1's ATPase activity, and ATP hydrolysis results in loss of the complex in gel shift assays.     

Internal loop/bulge and hairpin loop of the iron-responsive element of ferritin mRNA contribute to maximal iron regulatory protein 2 binding and translational regulation in the iso-iron-responsive element/iso-iron regulatory protein family

Iron-responsive elements (IREs), a natural group of mRNA-specific sequences, bind iron regulatory proteins (IRPs) differentially and fold into hairpins [with a hexaloop (HL) CAGUGX] with helical distortions: an internal loop/bulge (IL/B) (UGC/C) or C-bulge. C-bulge iso-IREs bind IRP2 more poorly, as oligomers (n = 28-30), and have a weaker signal response in vivo. Two trans-loop GC base pairs occur in the ferritin IRE (IL/B and HL) but only one in C-bulge iso-IREs (HL); metal ions and protons perturb the IL/B [Gdaniec et al. (1998) Biochemistry 37, 1505-1512]. IRE function (translation) and physical properties (T(m) and accessibility to nucleases) are now compared for IL/B and C-bulge IREs and for HL mutants. Conversion of the IL/B into a C-bulge by a single deletion in the IL/B or by substituting the HL CG base pair with UA both derepressed ferritin synthesis 4-fold in rabbit reticulocyte lysates (IRP1 + IRP2), confirming differences in IRP2 binding observed for the oligomers. Since the engineered C-bulge IRE was more helical near the IL/B [Cu(phen)(2) resistant] and more stable (T(m) increased) and the HL mutant was less helical near the IL/B (ribonuclease T1 sensitive) and less stable (T(m) decreased), both CG trans-loop base pairs contribute to maximum IRP2 binding and translational regulation. The (1)H NMR spectrum of the Mg-IRE complex revealed, in contrast to the localized IL/B effects of Co(III) hexaammine observed previously, perturbation of the IL/B plus HL and interloop helix. The lower stability and greater helix distortion in the ferritin IL/B-IRE compared to the C-bulge iso-IREs create a combinatorial set of RNA/protein interactions that control protein synthesis rates with a range of signal sensitivities.     

Expression of the multifunctional Y-box protein, YB-1, in myofibroblasts of the infarcted rat heart

Intracellular signaling mechanisms regulating the turnover of alpha-SMA-positive myofibroblasts (myoFbs) at the site of myocardial infarction (MI) are poorly understood. Y-Box (YB)-1, a multifunctional protein, may be involved in regulation of proliferation, migration and apoptosis of myoFbs. Our objective was to study the expression of YB-1 in the infarcted rat heart and its localization in myoFbs. On days 3-28 following MI, we monitored YB-1 expression and its colocalization with alpha-SMA, and proliferation markers PCNA and Ki-67 in infarcted tissue by Western blot, immunohistochemistry, and immunofluorescent double-labeling. YB-1 is barely detectable in normal myocardium. At the infarct site, however, YB-1 is markedly elevated from day 3 post-MI concomitant with the induction of cell proliferation. MyoFbs are the major source of YB-1 and retain it up to day 28 post-MI. We suggest early expression of YB-1 promotes proliferation and migration of myoFbs, whereas prolonged expression may be responsible for scar formation.     

O-GlcNAc inhibits interaction between Sp1 and sterol regulatory element binding protein 2

O-linked N-acetylglucosamine (O-GlcNAc), a monosaccharide N-acetylglucosamine on the serine and threonine residues of nucleocytoplasmic proteins, is a novel protein modification that is ubiquitous among eukaryotes and implicated in cell regulation. Recent evidence indicates that O-GlcNAc regulates protein-protein interactions. Here we provide evidence that O-GlcNAc interrupts a known interaction between Sp1 and sterol regulatory element binding protein 2 (SREBP2), thereby inhibiting expression of the gene encoding acetyl-CoA synthetase 1, which is involved in lipid synthesis. This study suggests a novel mechanism in which lipid biosynthesis may be regulated by O-GlcNAc.     

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.