Overdrive, a T-DNA transmission enhancer on the A. tumefaciens tumour-inducing plasmid

During crown gall tumorigenesis a specific segment of the Agrobacterium tumefaciens tumour-inducing (Ti) plasmid, the T-DNA, integrates into plant nuclear DNA. Similar 23-bp direct repeats at each end of the T region signal T-DNA borders, and T-DNA transmission (transfer and integration) requires the right-hand direct repeat. A chemically synthesized right border repeat in its wild-type orientation promotes T-DNA transmission at a low frequency; Ti plasmid sequences which normally flank the right repeat greatly stimulate the process. To identify flanking sequences required for full right border activity, we tested the activity of a border repeat surrounded by different amounts of normal flanking sequences. Efficient T-DNA transmission required a conserved sequence (5' TAAPuTPy-CTGTPuT-TGTTTGTTTG 3') which lies to the right of the two known right border repeats. In either orientation, a synthetic oligonucleotide containing this conserved sequence greatly stimulated the activity of a right border repeat, and a deletion removing 15 bp from the right end of this sequence destroyed it stimulatory effect. Thus, wild-type T-DNA transmission required both the 23-bp right border repeat and a conserved flanking sequence which we call overdrive.     

Molecular structure and flanking nucleotide sequences of the natural chicken ovomucoid gene

Five independent clones containing the natural chicken ovomucoid gene have been isolated from a chicken gene library. One of these clones, CL21, contains the complete ovomucoid gene and includes more than 3 kb of DNA sequences flanking both termini of the gene. Restriction endonuclease mapping, electron microscopy and direct DNA sequencing analyses of this clone have revealed that the ovomucoid gene is 5.6 kb long and codes for a messenger RNA of 821 nucleotides. The structural gene sequence coding Ifor the mature messenger RNA is split into at least eight segments by a minimum of seven intervening sequences of various sizes. The shortest structural gene segment is only 20 nucleotides long. All seven intervening sequences are located within the peptide coding region of the gene, and the sequences at the 5' and 3' untranslated regions of the mRNA are not interrupted by intervening sequences. The DNA sequences of the regions flanking the 5' and 3' termini of the gene have been determined. Thirty nucleotides before the start of the messenger RNA coding sequence is the heptanucleotide TATATAT, which is also present in a similar location relative to the chicken ovalbumin gene and other unique sequence eucaryotic genes. This sequence resembles that of the Pribnow box in procaryotic genes where a promoter function has been implicated. Seven nucleotides past the 3' end of the gene is the tetranucleotide TTGT, a sequence found to be present at identical locations as either TTTT or TTGT in other eucaryotic genes that have been sequenced. These conserved DNA sequences flanking eucaryotic genes may serve some regulator function in the expression of these genes.     

DNA from the A6S/2 crown gall tumor contains scrambled Ti-plasmid sequences near its junctions with plant DNA

The A6S/2 tumor incited on tobacco by Agrobacterium tumefaciens harboring the octopine-type A6 Ti plasmid contains one insert of Ti-plasmid sequences (the T DNA). This 13 kb insert is derived from a colinear sequence in the Ti plasmid (the T region) and becomes attached to plant DNA in the nucleus of the host cell. We have determined the DNA sequence encompassing the left end of the T region of the A6 Ti plasmid and the corresponding portion of the A6S/2 T DNA. The two sequences are identical for at least 806 bp. To the left of the divergence point, the tumor contains five partially overlapping sequences that are direct or inverted repeats of sequences to the right of the divergence point. The Ti plasmid contains only the right member of each of these repeats. We have also performed heteroduplex studies that indicate that this T DNA has a 520 bp inverted repeat of an internal sequence at the right end near its junction with plant DNA. The repeated sequences near the ends of the T DNA resemble the repeats of adenovirus type 12 sequences found near its junction with host DNA. We discuss data suggesting that the 23 bp to the immediate right of the divergence point of the A6 left junction form a site important in some step in the transfer of T-region DNA from the bacteria to the plant.     

Right 25 bp terminus sequence of the nopaline T-DNA is essential for and determines direction of DNA transfer from agrobacterium to the plant genome

We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 bp T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid.     

Genetic analysis of integration mediated by single T-DNA borders.

Transformation of plant cells by the T-DNA of the Ti plasmid of Agrobacterium tumefaciens depends in part upon a sequence adjacent to the right T-DNA end. When this sequence is absent, the T-DNA is almost avirulent; when it is present, DNA between it and the left T-DNA border region becomes integrated in plants. To investigate further this process of DNA transfer and integration, we introduced the right border region and the nopaline synthase (nos) gene of plasmid pTiC58 into a variety of new positions around Ti plasmids. The border region functioned when separated from the remainder of the T-DNA by almost 50 kilobases. It also worked when placed outside of the T-DNA region where there were no known left-border sequences with which to interact. Indeed, the nos gene could be transferred to plants even when no other Ti plasmid sequences were present on the same plasmid. These results may indicate that the sequence requirements for the left borders are not as stringent as those for the right borders. In addition, mutants with an extra copy of the right border region within their T-DNA were found to transfer or integrate only parts of the bacterial T-DNA region. It is possible that abnormally placed T-DNA borders interfere with the normal process of DNA transfer, integration, or both.     

Organization of the agropine synthesis region of the T-DNA of the Ri plasmid from Agrobacterium rhizogenes.

The agropine/mannopine synthesis region of the TR region of the Ri plasmid of Agrobacterium rhizogenes strain A4 was localized on the basis of sequence similarity with probes from Ti plasmids of Agrobacterium tumefaciens and analysis of transposon insertions. The nucleotide sequence of the right part of the TR-DNA of pRiA4, encompassing the three genes involved in mannityl-opine synthesis, was determined and compared to the sequence of the corresponding region of the octopine-type Ti plasmid pTi15955. The organization of this region is strongly conserved between Ri and Ti plasmids, but the similarity is restricted to the coding sequences: no homology was detected in the 5' and 3' flanking sequences. The mas1' and ags proteins are the most conserved, showing more than 68% amino acid conservation, whereas the mas2' proteins are only 59% identical. Significant G/C content and codon usage differences are observed between pTi15955 and pRiA4. An open reading frame strongly similar to that of bacterial repressors is situated immediately to the right of the TR region.     

vir-induced recombination in Agrobacterium. Physical characterization of precise and imprecise T-circle formation

Induction of Ti plasmid virulence (vir) gene expression during the early stages of plant cell transformation by Agrobacterium tumefaciens initiates the generation of several T-DNA-associated molecular events: (1) site-specific nicks at T-DNA border sequences (border nicks); (2) free, unipolar, linear, single-stranded T-DNA copies (T-strands); and (3) double-stranded, circular T-DNA molecules (T-circles). The first two T-DNA products have been detected in A. tumefaciens, while T-circles have only been detected following Escherichia coli transformation or transduction. The relationship between the three events has not been evaluated since the genesis of T-circles in A. tumefaciens has not been clarified. Evidence is presented here that T-circles are not an artefact of E. coli transformation, but are present as free, double-stranded molecules in A. tumefaciens resulting from site-specific reciprocal recombination between the left and right 25-base-pair border sequences that flank the T-DNA. Furthermore, the frequency of T-circle formation correlates with the frequency of formation of its reciprocal product, the Ti plasmid deleted in the T-DNA region. Several types of recombinant T-DNA circles arise after activation of vir gene expression, a major class representing precise site-specific recombination between both T-DNA borders, and a minor class representing recombination events either utilizing only one T-DNA border sequence and other Ti plasmid sequences, or utilizing only Ti plasmid sequences (i.e. no T-DNA borders). Nucleotide sequence analyses show that when one (nicked) border recombines with other Ti plasmid sequences, a small stretch (16 to 17 base-pairs) of local homology suffices to allow crossing over.