Tools to study DNA repair: what's in the box?

Our understanding of the DNA repair mechanisms that preserve genome integrity has increased greatly in recent years. To follow the DNA repair process, researchers have developed sophisticated techniques including live cell imaging, local damage induction and refined biochemical assays. These techniques have helped to elucidate the 'orchestration' of DNA repair mechanisms (i.e. the order of factor assembly around the lesion, the identification of new functions of known factors and the discovery of novel key regulators involved in DNA repair). We will discuss the uses and the limitations of these methods and their applications in the study of DNA repair.     

IAPs: what's in a name?

Originally described in insect viruses, cellular proteins with Baculoviral IAP repeat (BIR) motifs have been thought to function primarily as inhibitors of apoptosis. The subsequent finding that a subset of IAPs that contain a RING domain have ubiquitin protein ligase (E3) activity implied the presence of other functions. It is now known that IAPs are involved in mitotic chromosome segregation, cellular morphogenesis, copper homeostasis, and intracellular signaling. Here, we review the current understanding of the roles of IAPs in apoptotic and nonapoptotic processes and explore the notion that the latter represents the primary physiologic activities of IAPs.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Stereoscopic vision: what's the first step?

Neurons in primary visual cortex respond to binocular disparity, the raw material of stereoscopic depth perception. Although these neurons are probably essential to depth perception, a recent study has shown that they are unable to compute depth itself.     

Men and sin: what's the difference?

A conserved signalling cascade--termed the mitotic-exit network in budding yeast and the septation-initiation network in fission yeast--controls key events during exit from mitosis and cytokinesis. Although the components of these signalling networks are highly conserved between the two yeasts, the outputs seem quite different. How, then, do these two pathways function, and how are they regulated?     

Marine nitrogen fixation: what's the fuss?

Biological nitrogen fixation is a much more important process in the nitrogen cycle of the oceans than previously thought. Further, nitrogen fixation may have an influence on the capacity of the oceans to sequester carbon. A greater diversity of marine nitrogen fixers has also been uncovered but their quantitative significance remains to be determined.     

Nomenclature: or what's in a name?

Transgenic Research -     

Albinism and immunity: what's the link?

A small number of inherited diseases show a combination of immunological and pigmentation defects. Chediak-Higashi, Griscellis and Hermansky-Pudlak syndromes are all autosomal recessive diseases with these characteristics. Recent advances in both the identification of the genes giving rise to these diseases and the cell biology of immune cells and melanocytes have begun to reveal the molecular links between immunodeficiencies and albinism. These studies identify key proteins, such as Rab27a, which are critical for secretion of specialised granules found in melanocytes and immune cells. The granules of these cells are modified lysosomes termed 'secretory lysosomes'. These studies reveal that secretory lysosomes use specialised mechanisms of secretion, not found in other cell types, which explains the selective defects in these diseases.     

Cellular evolution: what's in a mitochondrion?

Mitochondria and their relatives constitute a wide range of organelles, only some of which function in aerobic respiration. Mitochondrial remnants from different anaerobic lineages show a striking degree of functional convergence.     

Organelle evolution: what's in a name?

Plastids are organelles derived from cyanobacterial endosymbionts and the evolutionary process that gave rise to them is well understood. Or is it? The complete genome sequence of a recently evolved photosynthetic body in Paulinella chromatophora is cause for reflection on the distinction between 'endosymbiont' and 'organelle', and how the boundaries between these terms can blur.