Immunochemical detection of multiple conformations within a 36 base pair oligonucleotide.

A 36 base pair chimeric oligonucleotide containing a central core of DNA duplex flanked by RNA/DNA hybrid at each end was synthesized. These distinct regions of the oligonucleotide adopt different conformations which were detected with antibody probes. Enzyme linked immunosorbent assays (ELISA) and a gel electrophoresis retardation assay were used to demonstrate the binding of antibodies which recognize B-DNA, Z-DNA and RNA/DNA hybrid. The DNA duplex core of this oligonucleotide adopts the B-conformation in 0.14 M NaCl. In high salt solution (4 M NaCl) the DNA core adopts the Z-conformation. The RNA/DNA hybrid at the ends of the oligomer adopt a conformation which is distinct from both B-DNA and A-RNA.     

Biochemical and NMR spectroscopy evidence for a new tertiary A-U base pair in lupin ribosomal 5 S RNA structure.

The new model for the tertiary structure of ribosomal 5 S rRNA from plants recently proposed by some of us has been already supported by RNase H digestions in the presence of complementary oligodeoxynucleotides. These results are confirmed now by the new biochemical and NMR spectroscopy data. Diethylpyrocarbonate (DEP) and monoperphthalic acid (MPA) are the reagents with the high specificity toward single-stranded adenosine residues. Our experiments clearly show that under native conditions adenosine 100 (A100) of lupin 5 S rRNA is not available for reaction toward these reagents. However under denaturing conditions this residue reacts with DEP and MPA. The detailed analysis of the lupin 5 S rRNA by NMR spectra provide the data on the specific interaction of A100-U53. Thus, we have seen for the first time the NMR signal due to the A100-U53 tertiary base pair, which as we believe, stabilizes interactions between loops B and E.     

Mu insertion duplicates a 5 base pair sequence at the host inserted site.

Nucleotide sequences were analyzed across the two ends of lysogenic Mu DNA. These ends were cloned separately in lambdapMu hybrid particles that derived from a single Mu lysogen in the lac Z part of lambdaplac5. The obtained data imply that Mu lysogenization was associated with the duplication of 5 base pairs present in lac DNA at the Mu insertion site. As a result of this duplication, Mu DNA is flanked by two copies of five identical base pairs oriented as direct repeats. A similar conclusion has been obtained independently by other investigators with the use of a different Mu lysogen (D. Kamp and R. Kahmann, personal communication). Thus Mu insertion seems to have a striking similarity to typical IS-mediated insertions that were found to be associated with a short DNA duplication at the target site.     

Drosophila 5 S RNA processing requires the 1-118 base pair and additional sequence proximal to the processing site.

Using an in vitro processing system, we have identified a required sequence surrounding the Drosophila melanogaster 5 S RNA processing site at nucleotide 120. Mutations in this region vary the processing rate from complete inhibition to a level equal to or greater than wild type. Analysis of mutants at +1 and in the region 118-122 separates the inhibitory effect into two parts. 1) Nucleotide 118 C, the base-paired nucleotide in helix I proximal to the processing site, plays an essential role. Changing it to a purine inhibits processing. The +1-118 base pair must be intact, but this alone is not sufficient for processing, since compensatory changes at +1 do not restore down-processing mutants at 118 to the wild type level. 2) The processing site has to be pyrimidine rich; multiple contiguous purines inhibit processing. On the other hand, multiple pyrimidines can largely negate the inhibitory effect of a mutation at position 118. Thus a base-paired C at 118 followed by a stretch of pyrimidines is the processing signal, which may be recognized by the processing enzyme and/or a required accessory factor.     

Organization, nucleotide sequence, and chromosomal mapping of a tandemly repeated unit containing the four core histone genes and a 5S rRNA gene in an isopod crustacean species.

A tandemly repeated unit of 6553 bp containing a copy of the four core histone genes H2B, H2A, H3, and H4, and also a 5S rRNA gene, was amplified by PCR from genomic DNA of the isopod crustacean Asellus aquaticus. The linkage between 5S rRNA genes and histone genes has been so far observed in only one other organism, the anostrac crustacean Artemia salina. The gene cluster was cloned and sequenced. The histone genes, in their 3' flanking region, have the interesting feature of possessing two different mRNA termination signals, the stem-loop structure and the AATAAA sequence. A part of the PCR product was used as a probe in FISH experiments to locate the gene cluster on an inter-individually variable number of chromosomes from 6 to 12 per diploid cell, always in a terminal position and never associated with the heterochromatic areas. Fluorescence in situ hybridization (FISH) was also performed on preparations of released chromatin and the reiteration level of the gene cluster was determined as approximately 200-300 copies per haploid genome.     

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).     

Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid.     

Identification and analysis of Dictyostelium actin genes,a family of moderately repeated genes

Plasmid M6 has been shown to contain sequences complementary to two related abundant mRNA species which differ in length by 100 nucleotides and code for Dictyostellum actin. M6 complementary RNA was isolated by hybridization to immobilized M6 DNA and translated in vitro. The product is identical to major forms of in vivo labeled actin in both mobility on two-dimensional gels and two-dimensional fingerprints of tryptic peptides. Both plasmid M6 and a second plasmid complementary to the actin mRNA complementary region in M6, pDd actin 2 (McKeown et al., 1978), direct the synthesis in minicells of a number of similar polypeptides that are not seen in minicells containing other recombinant plasmids. Three of these polypeptides are similar in two-dimensional gel mobility to Dictyostelium actin and bind to DNAase I agarose.The repetition frequency of isolated restriction fragments from actin mRNA complementary plasmid M6 has been examined. The data from two different experimental approaches (DNA excess hybridizations using plasmid DNA as probe, and hybridization of plasmid probe to DNA blot filters of restriction enzyme-digested Dictyostelium DNA) indicate that the mRNA complementary region is reiterated 15–20 times. When an actin cDNA probe is used in the same experiments, the results suggest that the entire coding region is reiterated.When the two major actin mRNA species are separated and independently translated, each appears to code for one of the two major actin species. The results suggest that there are at least two different functional genes, and possibly more, for Dictyostelium actin.     

5S ribosomal RNA is contained within a 25 S ribosomal RNA that accumulates in mutants of Escherichia coli defective in processing of ribosomal RNA.

A temperature-sensitive mutant strain of Escherichia coli defective in two RNA processing enzymes, RNase III and RNase E (rnc. rne), fails to produce normal levels of 23 S and 5 S rRNA at the non-permissive temperature. Instead, a molecule larger than 23 S is produced. This molecule, designated 25 S rRNA, can be processed in vitro to produce p5 rRNA. These findings further our understanding of the overall processing events of ribosomal RNA which take place in the bacterial cell.     

Determination of base pairing in yeast 5S and 5.8S RNA infrared spectroscopy.

Infrared Spectroscopy was used to determine the numbers of base pairs for yeast 5S RNA and 5.8S RNA. The spectra were recorded at 20 degrees C and 50 degrees C, where tertiary interactions are assumed to be of less importance. It may be concluded that the structure of both RNAs is highly ordered and that there are large contributions of tertiary interactions. The results are compared with data derived from structural models that were proposed in the literature as well as with data previously published for prokaryotic 5S RNAs.     

Construction and characterization of a site-directed CC-1065-N3-adenine adduct within a 117 base pair DNA restriction fragment

The design, construction, and characterization of a site-directed CC-1065-N3-adenine adduct in a 117 base pair segment of M13mpI DNA are described. CC-1065 is an extremely potent antitumor antibiotic produced by Streptomyces zelensis. Previous studies have demonstrated that the cyclopropyl ring of CC-1065 reacts quite specifically with N3 of adenine in double-stranded DNA to form a CC-1065-DNA adduct. Following alkylation, the drug molecule lies snugly within the minor groove of DNA, overlapping with five base pairs for which a marked sequence preference exists [Hurley, L. H., Reynolds, V. R., Swenson, D. H., Petzold, G. L., & Scahill, T. A. (1984) Science (Washington, D.C.) 226, 843-844]. On the basis of the unique characteristics of the reaction of CC-1065 with DNA and the structure of the resulting DNA adduct, we have designed a general strategy to construct a site-directed CC-1065-DNA adduct in a restriction fragment. The presence of unique AluI and HaeIII restriction enzymes sites on each side of a high-affinity CC-1065 binding sequence (5'-GATTA) permitted the preparation of a partial duplex DNA molecule containing the CC-1065 binding sequence in the duplex DNA region. Since CC-1065 only binds to duplex DNA, potential CC-1065 binding sequences in the long single-stranded regions were protected from drug binding during the construction process.(ABSTRACT TRUNCATED AT 250 WORDS)     

Optical properties and base pairing of E. coli 5S RNA

The ultraviolet absorption, optical rotatory dispersion, circular dichroism, and infrared absorption spectra of renatured 5S RNA have been measured at pH 7.0 in 0.1M NaCl at 25° and used to obtain four independent estimates of the number of base pairs. These four estimations are in reaonable agreement and average values of 28 ± 4 G.C and 13 ± 4 A.U. base pairs.     

In Euglena, spliced-leader RNA (SL-RNA) and 5S rRNA genes are tandemly repeated.

In Euglena gracilis, a 26 nucleotide leader sequence (spliced leader sequence = SL) is transferred by trans-splicing to the 5' end of a vast majority of cytoplasmic mRNAs (8). The SL originates from the 5' extremity of a family of closely related snRNAs (SL-RNAs) which are about 100 nucleotide long. In this paper we present the nucleotide sequences of two SL-RNA genes, confirming the sequences previously established by sequencing purified SL-RNAs. Although some SL-RNA genes are dispersed throughout the genome, we show that the majority of SL-RNA genes are located on 0.6 kb repeated units which also encode the cytoplasmic 5S rRNA. We estimate that the copy number of these repeated units is about 300 per haploid genome. The association of SL-RNA and 5S rRNA genes in tandemly repeated units is also found in nematodes but paradoxically does not exist in trypanosomes which are phylogenically much closer to Euglena. We also show that a high number of sequences analogous to the 26 nucleotide SL are dispersed throughout the genome and are not associated with SL-RNAs.     

Reconstitution of biologically active 50S ribosomal subunits with artificial 5S RNA molecules carrying disturbances in the base pairing within the molecular stalk.

Bacillus stearothermophilus 50S ribosomal subunits were reconstituted in vitro using artificial 5S RNA molecules constructed by combining parts of major and minor type (Raué et al. (1976) Europ. J. Biochem. 68, 169-176) B. licheniformis 5S RNA. The artificial 5S RNA molecules carry defined disturbances (A.C juxtapositions and extra G.U pairs) in the base pairing between the 5'- and 3'-terminal sequences of the molecule (the molecular stalk region). The biological activity of the reconstituted subunits was determined in an E. coli cell-free system programmed with poly-U. The results show that conservation of the base pairing within the molecular stalk is not required for biological activity of 5S RNA. Disturbances of the base pairing within this region do reduce the rate of reconstitution, however. Normal base pairing in the molecular stalk is thus required to ensure efficient ribosome assembly.     

Analysis of large specific T1 oligonucleotides of 17S and 25S ribosomal RNAs from Saccharomyces cerevisiae.

The primary structure of 17S and 25S ribosomal RNAs from Saccharomyces cerevisiae has been analysed by two-dimensional fractionation of T1 oligonucleotides. This method consists of an electrophoresis at pH 3.5 followed by a homochromatography on DEAE-cellulose plates. After the second dimension, the large T1 oligonucleotides were hydrolyzed by pancreatic RNAse, followed by alkaline hydrolysis of the pancreatic products. By fractionating a mixture of tritiated HeLa cell ribosomal RNAs and 32 P yeast cell ribosomal RNAs, two autoradiographs were obtained; one corresponding to the 32P labelled material and the other to the tritiated labelled material. By superposition of the two autoradiographs, the mobility of the various T1 oligonucleotides can be accurately compared and it is shown that yeast 17S rRNA and human 18S rRNA have in common 5 large oligonucleotides and that yeast 25S rRNA and human 28S rRNA have 4 identical oligonucleotides.     

Secondary structure of Bombyx mori and Dictyostelium discoideum 5S rRNA from S1 nuclease and cobra venom ribonuclease susceptibility, and computer assisted analysis.

The 5S rRNAs from Bombyx mori and Dictyostelium discoideum were end-labeled with [32-P] at either the 5' or 3' end and sequenced using enzymatic digestion. The secondary structure of these molecules was studied using the single-strand specific S1 nuclease and the base-pair specific cobra venom ribonuclease. Computer analysis of these results was performed and was used to generate a consensus secondary structure for each molecule. A comparison of these results with those of other workers is presented.     

The 5S ribosomal genes in the Drosophila melanogaster species subgroup. Nucleotide sequence of a 5S unit from Drosophila simulans and Drosophila teissieri

The 5S genes of the eight species of the D. melanogaster subgroup have been mapped. The spacers, in contrast with coding regions, differ markedly between most species. One 5S gene unit has been sequenced for both D. simulans and D. teissieri. The mature 5S RNA region in these two species is identical to the corresponding region of D. melanogaster. Only 5 nucleotide variations occur between the D. melanogaster and D. simulans 5S gene spacers. The spacer in D. teissieri is very different. Only two segments, located one at each side of the coding region, are clearly homologous to corresponding sequences of D. melanogaster and D. simulans.