A method for estimating the nearest neighbor base-pair content of RNAs using CD and absorption spectroscopy.

CD and absorption spectra are sensitive to the secondary structure of RNAs. By fitting the spectra contained in our basis set to the CD and absorption spectra of an RNA of known sequence, we could determine the fractions of base pairs, the fractions of each of the nearest neighbor base pairs, and the fractions of the single-stranded nucleotides in that RNA. The basis set included 58 CD and 58 absorption spectra. The fitting was done with a guided selection routine. The estimated error was about 0.05 for predicting the fractions of the nearest neighbor base pairs, 0.06 for predicting the fractions of A.U, G.C, and G.U base pairs, and 0.04 for predicting the fractions of the single-stranded nucleotides.     

Determination of base pairing in yeast 5S and 5.8S RNA infrared spectroscopy.

Infrared Spectroscopy was used to determine the numbers of base pairs for yeast 5S RNA and 5.8S RNA. The spectra were recorded at 20 degrees C and 50 degrees C, where tertiary interactions are assumed to be of less importance. It may be concluded that the structure of both RNAs is highly ordered and that there are large contributions of tertiary interactions. The results are compared with data derived from structural models that were proposed in the literature as well as with data previously published for prokaryotic 5S RNAs.     

Identifying G-protein coupled receptors using weighted Levenshtein distance and the nearest neighbor method

G-protein coupled receptors （GPCRs） are a class of seven-helix transmembrane proteins that have been used in bioinformatics as the targets to facilitate drug discovery for human diseases. Although thousands of GPCR sequences have been collected, the ligand specificity of many GPCRs is still unknown and only one crystal structure of the rhodopsin-like family has been solved. Therefore, identifying GPCR types only from sequence data has become an important research issue. In this study, a novel technique for identifying GPCR types based on the weighted Levenshtein distance between two receptor sequences and the nearest neighbor method （NNM） is introduced, which can deal with receptor sequences with different lengths directly. In our experiments for classifying four classes （acetylcholine, adrenoceptor, dopamine, and serotonin） of the rhodopsin-like family of GPCRs, the error rates from the leave-one-out procedure and the leave-half-out procedure were 0.62% and 1.24%, respectively. These results are prior to those of the covariant discriminant algorithm, the support vector machine method, and the NNM with Euclidean distance.     

A set of nearest neighbor parameters for predicting the enthalpy change of RNA secondary structure formation

A complete set of nearest neighbor parameters to predict the enthalpy change of RNA secondary structure formation was derived. These parameters can be used with available free energy nearest neighbor parameters to extend the secondary structure prediction of RNA sequences to temperatures other than 37°C. The parameters were tested by predicting the secondary structures of sequences with known secondary structure that are from organisms with known optimal growth temperatures. Compared with the previous set of enthalpy nearest neighbor parameters, the sensitivity of base pair prediction improved from 65.2 to 68.9% at optimal growth temperatures ranging from 10 to 60°C. Base pair probabilities were predicted with a partition function and the positive predictive value of structure prediction is 90.4% when considering the base pairs in the lowest free energy structure with pairing probability of 0.99 or above. Moreover, a strong correlation is found between the predicted melting temperatures of RNA sequences and the optimal growth temperatures of the host organism. This indicates that organisms that live at higher temperatures have evolved RNA sequences with higher melting temperatures.     

Do eukaryotic mRNA 5' noncoding sequences base-pair with the 18 S ribosomal RNA 3' terminus?

Protein synthesis initiation on prokaryotic mRNAs involves base-pairing of a site preceding the initiation codon with the 3' terminal sequence of 16 S rRNA. It has been suggested that a similar situation may prevail in eukaryotic mRNAs. This suggestion is not based on experiments, but on observation of complementarities between mRNA 5' noncoding sequences and a conserved sequence near the 18 S rRNA 3' terminus. The hypothesis can be evaluated by comparing the number of potential binding sites found in the 5' noncoding sequences with the number of such sites expected to occur by chance. A method for computing this number is presented. The 5' noncoding sequences contain more binding sites than expected for a random RNA chain, but the same is true for 3' noncoding sequences. The effect can be traced to a clustering of purines and pyrimidines, common to noncoding sequences. In conclusion, a close inspection of the available mRNA sequences does not reveal any indication of a specific base-pairing ability between their 5' noncoding segments and the 18 S rRNA 3' terminus.     

Morpholino spin-labeling for base-pair sequencing of a 3'-terminal RNA stem by proton homonuclear Overhauser enhancements: yeast ribosomal 5S RNA

Base-pair sequences for 5S and 5.8S RNAs are not readily extracted from proton homonuclear nuclear Overhauser enhancement (NOE) connectivity experiments alone, due to extensive peak overlap in the downfield (11-15 ppm) proton NMR spectrum. In this paper, we introduce a new method for base-pair proton peak assignment for ribosomal RNAs, based upon the distance-dependent broadening of the resonances of base-pair protons spatially proximal to a paramagnetic group. Introduction of a nitroxide spin-label covalently attached to the 3'-terminal ribose provides an unequivocal starting point for base-pair hydrogen-bond proton NMR assignment. Subsequent NOE connectivities then establish the base-pair sequence for the terminal stem of a 5S RNA. Periodate oxidation of yeast 5S RNA, followed by reaction with 4-amino-2,2,6,6-tetramethylpiperidinyl-1-oxy (TEMPO-NH2) and sodium borohydride reduction, produces yeast 5S RNA specifically labeled with a paramagnetic nitroxide group at the 3'-terminal ribose. Comparison of the 500-MHz 1H NMR spectra of native and 3'-terminal spin-labeled yeast 5S RNA serves to identify the terminal base pair (G1 . C120) and its adjacent base pair (G2 . U119) on the basis of their proximity to the 3'-terminal spin-label. From that starting point, we have then identified (G . C, A . U, or G . U) and sequenced eight of the nine base pairs in the terminal helix via primary and secondary NOE's.     

Oocyte and somatic 5S ribosomal RNA and 5S RNA encoding genes in Xenopus tropicalis.

We have investigated the structure of oocyte and somatic 5S ribosomal RNA and of 5S RNA encoding genes in Xenopus tropicalis. The sequences of the two 5S RNA families differ in four positions, but only one of these substitutions, a C to U transition in position 79 within the internal control region of the corresponding 5S RNA encoding genes, is a distinguishing characteristic of all Xenopus somatic and oocyte 5S RNAs characterized to date, including those from Xenopus laevis and Xenopus borealis. 5S RNA genes in Xenopus tropicalis are organized in clusters of multiple repeats of a 264 base pair unit; the structural and functional organization of the Xenopus tropicalis oocyte 5S gene is similar to the somatic but distinct from the oocyte 5S DNA in Xenopus laevis and Xenopus borealis. A comparative sequence analysis reveals the presence of a strictly conserved pentamer motif AAAGT in the 5'-flanking region of Xenopus 5S genes which we demonstrate in a separate communication to serve as a binding signal for an upstream stimulatory factor.     

Analysis of an RNA pseudoknot structure by CD spectroscopy.

The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions.     

Linkage of 5S RNA and 16S+23S RNA genes on the E. coli chromosome.

Summary Episomes carrying limited regions of the chromosome where 5S RNA genes have previously been located are described. The DNA purified from each of these episomes contains one gene per molecule for each of the three ribosomal RNA species as shown by hybridization experiments.This work was supported in part by a grant from the C.E.A.     

Stellacyanin. Studies of the metal-binding site using x-ray absorption spectroscopy.

Stellacyanin is a mucoprotein of molecular weight approximately 20,000 containing one copper atom in a blue or type I site. The metal ion can exist in both the Cu(II) and Cu(I) redox states. The metal binding site in plastocyanin, another blue copper protein, contains one cysteinyl, one methionyl, and two imidazoyl residues (Colman et al. 1978. Nature [Lond.]. 272:319-324.), but an exactly analogous site cannot exist in stellacyanin as it lacks methionine. The copper coordination in stellacyanin has been studied by x-ray edge absorption and extended x-ray absorption fine structure (EXAFS) analysis. A new, very conservative data analysis procedure has been introduced, which suggests that the there are two nitrogen atoms in the first coordination shell of the oxidized [Cu(II)] protein and one in the reduced [Cu(I)] protein; these N atoms have normal Cu--N distances: 1.95-2.05 A. In both redox states there are either one or two sulfur atoms coordinating the copper, the exact number being indeterminable from the present data. In the oxidized state the Cu--S distance is intermediate between the short bond found in plastocyanin and those found in near tetragonal copper model compounds. Above -140 degree C, radiation damage of the protein occurs. At room temperature the oxidized proteins is modified in the x-ray beam at a rate of 0.25%/s.     

Differential binding of zinc fingers from Xenopus TFIIIA and p43 to 5S RNA and the 5S RNA gene.

Zinc fingers are usually associated with proteins that interact with DNA. Yet in two oocyte-specific Xenopus proteins, TFIIA and p43, zinc fingers are used to bind 5S RNA. One of these, TFIIIA, also binds the 5S RNA gene. Both proteins have nine zinc fingers that are nearly identical with respect to size and spacing. We have determined the relative affinities of groups of zinc fingers from TFIIIA for both 5S RNA and the 5S RNA gene. We have also determined the relative affinities of groups of zinc fingers from p43 for 5S RNA. The primary protein regions for RNA and DNA interaction in TFIIIA are located at opposite ends of the molecule. All zinc fingers from TFIIIA participate in binding 5S RNA, but zinc fingers from the C terminus have the highest affinity. N-terminal zinc fingers are essential for binding the 5S RNA gene. In contrast, zinc fingers at the amino terminus of p43 are essential for binding 5S RNA.     

Prediction of oligonucleotide frequencies based upon dinucleotide frequencies obtained from the nearest neighbor analysis.

A statistical method of predicting hexanucleotide frequencies is presented. The method requires dinucleotide frequencies which can be readily obtained by nearest neighbor analysis. The frequencies of 64 hexanucleotides of E. coli were estimated and compared well with those predicted by a third order Markov chain.     

Nucleotide sequence and structure of cytoplasmic 5S RNA and 5.8S RNA of Chlamydomonas reinhardii.

Three small RNAs of the cytoplasmic 8OS ribosomes of the green unicellular alga Chlamydomonas reinhardii have been sequenced. They include two species of ribosomal 5S RNA, a major and a minor one of 122 and 121 nucleotides respectively, which differ from each other by 17 bases, and also the ribosomal 5.8S RNA of 156 nucleotides. Novel structural features can be recognized in the 5S RNAs of C. reinhardii by a comparison with published 5S RNA sequences. In addition the secondary structure of these small RNA molecules has been examined using a newly developed method based on differential nuclease susceptibility.