Nucleosides and nucleotides. Part 226: alternate-strand triple-helix formation by 3'-3'-linked oligodeoxynucleotides composed of asymmetrical sequences

In this paper, we describe the synthesis of the 3'-3'-linked oligonucleotides connected with pentaerythritol composed of asymmetrical sequences. Stability of the triplexes between these oligonucleotides and the DNA targets involving the adjacent oligopurine domains on alternate strands was investigated using the electrophoretic mobility shift assay (EMSA) and DNase I footprinting experiment. It was found that the 3'-3'-linked oligonucleotides composed of asymmetrical sequences formed the stable antiparallel triplexes with the DNA targets as compared with the unlinked oligonucleotides. Thus, oligonucleotides linked with pentaerythritol would be useful as antigene oligonucleotides for DNA targets consisting of the alternating oligopyrimidine-oligopurine sequences.     

Synthesis of 3'-3'-linked oligonucleotides branched by a pentaerythritol linker and the thermal stabilities of the triplexes with single-stranded DNA or RNA

Synthesis of 3'-3'-linked oligonucleotides branched by a pentaerythritol linker is described. The branched oligonucleotides were synthesized on a DNA/RNA synthesizer using a controlled pore glass (CPG) with a pentaerythritol linker carrying 4,4'-dimethoxytrityl (DMTr) and levulinyl (Lev) groups. The stability of the triplexes between the branched oligonucleotides and the target single-stranded DNA or RNA was studied by thermal denaturation. The oligonucleotides with the pentaerythritol linker formed thermally stable triplexes with the single-stranded DNA and RNA. Furthermore, the branched oligonucleotides containing 2'-O-methylribonucleosides, especially the oligonucleotide composed of 2'-deoxyribonucleosides and 2'-O-methylribonucleosides, stabilized the triplexes with the single-stranded DNA or RNA. Thus, the branched oligonucleotide containing 2'-O-methylribonucleosides may be a candidate for a novel antisense molecule by the triplex formation.     

Analysis of products formed during bleomycin-mediated DNA degradation

By the use of DNA, copolymers of defined nucleotide composition, and a synthetic dodecanucleotide having putative bleomycin cleavage sites in proximity to the 5'- and 3'-termini, the products formed concomitant with DNA strand scission have been isolated and subjected to structural identification and quantitation via direct comparison with authentic synthetic samples. The products of DNA strand scission by Fe(II)-bleomycin include oligonucleotides having each of the four possible nucleoside 3'-(phosphoro-2'-O-glycolates) at their 3'-termini, as well as the four possible base propenals. At least for 3-(adenin-9'-yl)propenal and 3-(thymin-1'-yl)propenal, the products formed were exclusively of the trans configuration.     

Identification of aberrant 2'-5' RNA linkage isomers by pellicular anion exchange chromatography

During chemical RNA synthesis, many undesired products may be formed. In addition to the "n-x" sequences, depurination products, and incompletely deprotected oligonucleotides, linkage isomers may form during condensation and/or deprotection of the synthetic products. Under acidic conditions, bond migration may alter normal 3'-5' diesters to aberrant 2'-5' diesters. This results in isomers that are difficult to identify by MS and LC-MS techniques because the isomers have identical masses. HPLC methods for identification of these isomers have not advanced because the isomers are not expected to exhibit differences in hydrophobicity that allow resolution by reversed-phase columns. Neither are changes in ionic interactions anticipated for these isomers that would allow resolution by ion exchange methods. We observed that chromatography on pellicular anion exchange phases, but not on porous anion exchange phases, completely resolves oligonucleotides with very slight conformation differences (e.g., DNA vs. RNA of identical sequence). Because incorporation of 2'-5' linkages in RNA will alter solution conformation slightly, we considered that this pellicular ion exchanger might also allow resolution of identical RNA sequences harboring aberrant 2'-5' linkages from those lacking aberrant 2'-5' linkages. Using the nonporous DNAPac PA200 column, we demonstrated a chromatographic procedure for resolving synthetic RNA with aberrant linkages from their normally linked counterparts. Under certain conditions, aberrant isomers are not completely resolved from those containing only normal linkages. Therefore, we also developed an independent linkage-confirming method using a 5'-3' exonuclease. This enzyme produces incomplete digestion products during digestion of synthetic RNA containing aberrant 2'-5' linkages, and these are readily resolved by DNAPac PA200 chromatography.     

Base excision repair intermediates as topoisomerase II poisons

Abasic sites are the most commonly formed DNA lesions in the cell and are produced by numerous endogenous and environmental insults. In addition, they are generated by the initial step of base excision repair (BER). When located within a topoisomerase II DNA cleavage site, "intact" abasic sites act as topoisomerase II poisons and dramatically stimulate enzyme-mediated DNA scission. However, most abasic sites in cells are not intact. They exist as processed BER intermediates that contain DNA strand breaks proximal to the damaged residue. When strand breaks are located within a topoisomerase II DNA cleavage site, they create suicide substrates that are not religated readily by the enzyme and can generate permanent double-stranded DNA breaks. Consequently, the effects of processed abasic sites on DNA cleavage by human topoisomerase IIalpha were examined. Unlike substrates with intact abasic sites, model BER intermediates containing 5'- or 3'-nicked abasic sites or deoxyribosephosphate flaps were suicide substrates. Furthermore, abasic sites flanked by 5'- or 3'-nicks were potent topoisomerase II poisons, enhancing DNA scission approximately 10-fold compared with corresponding nicked oligonucleotides that lacked abasic sites. These findings suggest that topoisomerase II is able to convert processed BER intermediates to permanent double-stranded DNA breaks.     

Supported synthesis of ferrocene modified oligonucleotides as new electroactive DNA probes

The use of 1-[3-O-(2-cyanoethyl-N,N-diisopropylphosphor amidityl)propyl]ferrocene and 1-[3-O-dimethoxytrityl propyl]-1'-[3'-O-(2-cyanoethyl-N,N-diisopropylphosphoramidityl) propyl] ferrocene as reactive synthons for DNA/RNA synthesizer allows to generate ferrocene-labelled oligonucleotides with remarkable DNA detection properties.     

Hairpin-shaped DNA duplexes with disulfide bonds in sugar-phosphate backbone as potential DNA reagents for crosslinking with proteins

Convenient approaches were described to incorporate -OP(=O)O(-)-SS-O(-)(O=)PO- bridges in hairpin-shaped DNA duplexes instead of regular phosphodiester linkages: (i) H2O2- or 2,2'-dipyridyldisulfide-mediated coupling of 3'- and 5'-thiophosphorylated oligonucleotides on complementary template and (ii) more selective template-guided autoligation of a preactivated oligonucleotide derivative with an oligomer carrying a terminal thiophosphoryl group. Dithiothreitol was found to cleave completely modified internucleotide linkage releasing starting oligonucleotides. The presence of complementary template as an intrinsic element of the molecule protects the hairpin DNA analog from spontaneous exchange of disulfide-linked oligomer fragments and makes it a good candidate for auto-crosslinking with cysteine-containing proteins.     

Mixed backbone antisense oligonucleotides: design, biochemical and biological properties of oligonucleotides containing 2'-5'-ribo- and 3'-5'-deoxyribonucleotide segments.

We have designed and synthesized mixed backbone oligonucleotides (MBOs) containing 2'-5'-ribo- and 3'-5'-deoxyribonucleotide segments. Thermal melting studies of the phosphodiester MBOs (three 2'-5'linkages at each end) with the complementary 3'-5'-DNA and -RNA target strands suggest that 2'-5'-ribonucleoside incorporation into 3'-5'-oligodeoxyribonucleotides reduces binding to the target strands compared with an all 3'-5'-oligodeoxyribonucleotide of the same sequence and length. Increasing the number of 2'-5'linkages (from six to nine) further reduces binding to the DNA target strand more than the RNA target strand [Kandimalla,E.R. and Agrawal,S. (1996)Nucleic Acids Symp. Ser., 35, 125-126]. Phosphorothioate (PS) analogs of MBOs destabilize the duplex with the DNA target strand more than the duplex with the RNA target strand. Circular dichroism studies indicate that the duplexes of MBOs with the DNA and RNA target strands have spectral characteristics of both A- and B-type conformations. Compared with the control oligonucleotide, MBOs exhibit moderately higher stability against snake venom phosphodiesterase, S1 nuclease and in fetal calf serum. Although 2'-5'modification does not evoke RNase H activity, this modification does not effect the RNase H activation property of the 3'-5'-deoxyribonucleotide segment adjacent to the modification. In vitro studies with MBOs suggest that they have lesser effects on cell proliferation, clotting prolongation and hemolytic complement lysis than do control PS oligodeoxyribonucleotides. PS analogs of MBOs show HIV-1 inhibition comparable with that of a control PS oligodeoxyribonucleotide with all 3'-5'linkages. The current results suggest that a limited number of 2'-5'linkages could be used in conjunction with PS oligonucleotides to further modulate the properties of antisense oligonucleotides as therapeutic agents.     

Single-strand DNA triple-helix formation

Chemical modification studies provide evidence that single-stranded oligodeoxyribonucleotides can form stable intrastrand triple helices. Two oligonucleotides of opposite polarity were synthesized, each composed of a homopurine-homopyrimidine hairpin stem linked to a pyrimidine sequence which is capable of folding back on the hairpin stem and forming specific Hoogsteen hydrogen bonds. Using potassium permanganate as a chemical modification reagent, we have found that two oligodeoxyribonucleotides of sequence composition type 5'-(purine)8(N)4(pyrimidine)8(N)6(pyrimidine)8-3' and 5'-(pyrimidine)8N6(pyrimidine)8N4(purine)8-3' undergo dramatic structural changes consistent with intrastrand DNA triple-helix formation induced by lowering the pH or raising the Mg2+ concentration. The intrastrand DNA triple helix is sensitive to base mismatches.     

Triple helix formation with purine-rich phosphorothioate-containing oligonucleotides covalently linked to an acridine derivative.

Purine-rich (GA)- and (GT)-containing oligophosphorothioates were investigated for their triplex-forming potential on a 23 bp DNA duplex target. In our system, GA-containing oligophosphorothioates (23mer GA-PS) were capable of triplex formation with binding affinities lower than (GA)-containing oligophosphodiesters (23mer GA-PO). The orientation of the third strand 23mers GA-PS and GA-PO was antiparallel to the purine strand of the duplex DNA target. In contrast, (GT)-containing oligophosphorothioates (23mer GT-PS) did not support triplex formation in either orientation, whereas the 23mer GT-PO oligophosphodiester demonstrated triplex formation in the antiparallel orientation. GA-PS oligonucleotides, in contrast to GT-PS oligonucleotides, were capable of self-association, but these self-associated structures exhibited lower stabilities than those formed with GA-PO oligonucleotides, suggesting that homoduplex formation (previously described for the 23mer GA-PO sequence by Noonberg et al.) could not fully account for the decrease in triplex stability when phosphorothioate linkages were used. The 23mer GA-PS oligonucleotide was covalently linked via its 5'-end to an acridine derivative (23mer Acr-GA-PS). In the presence of potassium cations, this conjugate demonstrated triplex formation with higher binding affinity than the unmodified 23mer GA-PS oligonucleotide and even than the 23mer GA-PO oligonucleotide. A (GA)-containing oligophosphodiester with two phosphorothioate linkages at both the 5'- and 3'-ends exhibited similar binding affinity to duplex DNA compared with the unmodified GA-PO oligophosphodiester. This capped oligonucleotide was more resistant to nucleases than the GA-PO oligomer and thus represents a good alternative for ex vivo applications of (GA)-containing, triplex-forming oligonucleotides, allowing a higher binding affinity for its duplex target without rapid cellular degradation.     

Synthesis of oligodeoxyribonucleotides containing oleylamine moieties]

A method for directional introduction of oleylamine residues to any position of oligodeoxyribonucleotides during their automated synthesis was developed. The presence of oleylamine residues in 3'- or 5'-terminal nucleotides was shown to have no effect on the thermodynamic stability of DNA duplexes formed by such oligonucleotides and the complementary sequences. The rate of the snake venom phosphodiesterase hydrolysis of oligonucleotides containing oleylamine residues in the 3'-terminal units was shown to be markedly lower than that of natural oligonucleotides.     

Construction and assembly of branched Y-shaped DNA: "click" chemistry performed on dendronized 8-aza-7-deazaguanine oligonucleotides

Branched DNA was synthesized from tripropargylated oligonucleotides by the Huisgen-Meldal-Sharpless cycloaddition using "stepwise and double click" chemistry. Dendronized oligonucleotides decorated with 7-tripropargylamine side chains carrying two terminal triple bonds were further functionalized with bis-azides to give derivatives with two terminal azido groups. Then, the branched side chains with two azido groups or two triple bonds were combined with DNA-fragments providing the corresponding clickable function. Both concepts afforded branched (Y-shaped) three-armed DNA. Annealing of branched DNA with complementary oligonucleotides yielded supramolecular assemblies. The concept of "stepwise and double click" chemistry combined with selective hybridization represents a flexible tool to generate DNA nanostructures useful for various purposes in DNA diagnostics, delivery, and material science applications.     

Thermostability of double-stranded deoxyribonucleic acids: effects of covalent additions of a psoralen

We have carried out a thermodynamic study on the effects of covalent additions of the psoralen derivative HMT, 4'-(hydroxymethyl)-4,5',8-trimethylpsoralen, on the stability of double-stranded deoxyoligonucleotides. This was done with two systems. The first was a double-stranded DNA formed by two non-self-complementary oligonucleotides, 5'-GAAGCTACGAGC-3' and 5'-GCTCGTAGCTTC-3', where we site specifically placed an HMT molecule on the thymidine residue in oligonucleotide 5'-GAAGCTACGAGC-3' as either a furan-side monoadduct or a pyrone-side monoadduct. The second was a double-stranded DNA formed by a self-complementary oligonucleotide, 5'-GGGTACCC-3', where we placed an HMT molecule on the thymidine residue of each strand as a furan-side monoadduct or cross-linked the two strands with an HMT molecule linked to the two thymidines. We found that HMT cross-linking of the two strands stabilizes the double helix formed by 5'-GGGTACCC-3', as one might expect. Less predictable results were that the monoaddition of a psoralen stabilizes the double helix formed by the two non-self-complementary oligonucleotides by as much as 1.3 kcal/mol as a furan-side monoadduct and 0.7 kcal/mol as a pyrone-side monoadduct at 25 degrees C in 50 mM NaCl. In contrast, the monoaddition of a psoralen on each of the two thymidines in the double helix formed by 5'-GGGTACCC-3' destabilizes the helix by 1.8 kcal/mol at 25 degrees C in 1 M NaCl. This destabilization arises from an unfavorable enthalpy change (8.6 kcal/mol) and a favorable entropy change (23 cal/K X mol) due to the two HMT molecules at the centers of each strand.(ABSTRACT TRUNCATED AT 250 WORDS)     

Novel missense mutations in red/green opsin genes in congenital color-vision deficiencies

Lipocortin I-S100 (calcyclin) heterotetramer exhibited ATPase activity in the presence of dsDNA but not ssDNA. To demonstrate its helicase activity, an 80-mer polynucleotide complementary to the replication origin of M13mp18 was synthesized, and the oligonucleotide, (dC)(20), was ligated to either its 5'- or 3'- end for binding to lipocortin. Lipocortin I heterotetramer displaced chains of the partially Y-shaped duplexes with a dC-tail at either the 5'- or 3'- end. The chain displacement required ATP and Mg(2+). Nonhydrolyzable ATP analogues were not effective. Lipocortin I heterotetramer also catalyzed annealing of the polynucleotides to M13mp18. Ca(2+) and phospholipids but not ATP and Mg(2+) were essential for this reaction. Since the chain displacing and annealing reactions were inhibited by monospecific anti-lipocortin I or anti-S100 antibodies, the present observations suggest that the lipocortin I heterotetramer regulates unwinding and annealing of DNA by Mg(2+) (plus ATP) and Ca(2+) (and phospholipids), respectively.     

'Cyclicons' as hybridization-based fluorescent primer-probes: synthesis, properties and application in real-time PCR

We have studied the use of 'pseudocyclic oligonucleotides' (PCOs) (Jiang et al. Bioorg. Med. Chem. 1999, 7, 2727) as hybridization-based fluorescent probes. The resulting fluorescent tag-attached PCOs are called 'cyclicons'. Cyclicons consist of two oligonucleotides linked to each other through 3'-3' or 5'-5' ends. One of the oligos is the probe or primer-probe sequence that is complementary to a target nucleic acid (mRNA/DNA), and the other is a modifier oligo that is complementary to one of the ends of the probe oligo. A fluorescence molecule and a quencher molecule are attached at an appropriate position in the cyclicons. In the absence of the target nucleic acid, the fluorophore and the quencher are brought in close proximity to each other because of the formation of an intramolecular cyclic structure, resulting in fluorescence quenching. When the cyclicon hybridizes to the complementary target nucleic acid strand, the intramolecular cyclic structure of the cyclicon is destabilized and opened up, separating the fluorophore and quencher groups, resulting in spontaneous fluorescence emission. Fluorescent studies in the presence and absence of a target nucleic acid suggest that cyclicons exist in intramolecular cyclic structure form in the absence of the target and form the duplex with the target sequence when present. Both the cyclicons are useful for nucleic acid detection. The studies with DNA polymerase on 5'-5'-attached cyclicons suggest that the presence of quencher moiety in the probe sequence does not inhibit chain elongation by polymerase. The experiments with a 5'-5'-attached cyclicon suggest the new design serves as an efficient unimolecular primer-probe in real-time PCR experiments.     

Junctions between i-motif tetramers in supramolecular structures

The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3'- or 5'-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms.     

Complementary addressed modification of single- and double-stranded DNA by alkylating derivatives of oligonucleotides isolated by partial DNA fragmentation

Reagents for complementary addressed modification of nucleic acids are proposed to be synthesized on the base of oligonucleotides obtained by partial chemical fragmentation of DNA. The alkylating 4-(N-2 chlorethyl-N-methylamino) benzyl-5'-phosphamide derivatives of 5'-[32P]-labelled oligonucleotides obtained from single and double-stranded DNA cloned in bacteriophage M13 mp9 have been synthesized. The alkylated derivatives of oligonucleotides selectively modify the complementary tracts of single-stranded DNA-target. They are also able to modify the complementary regions in double-stranded supercoiled plasmid DNA.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

The DNA restriction endonuclease of Escherichia coli B. II. Further studies of the structure of DNA intermediates and products

The DNA intermediates and final products formed by the Type I restriction endonuclease, EcoB, were further characterized. DNA cleaved on only one strand (hemi-restricted DNA) contains gaps of approximately 70-100 nucleotides, while the fully restricted products contain 3'-single-stranded tails averaging approximately 70-100 nucleotides for each strand cleaved. The gaps and tails are formed with the release of an equal number of nucleotides as small oligonucleotides that are soluble in acid. After purification, neither the hemi-restricted nor the fully restricted DNAs are cleaved again by EcoB. There is no apparent specificity for which strand of a duplex is initially cleaved by EcoB, nor is there specificity with respect to the composition of the 3'-terminal nucleotide formed on the DNA or the 3'- or 5'-terminal nucleotides of the acid-soluble oligonucleotides released during DNA cleavage. The structure formed at the 5' terminus of the DNA product which blocks phosphorylation by T4 polynucleotide kinase remains unknown, but its removal with phage lambda exonuclease allows at least some reutilization of recognition sites by EcoB as well as phosphorylation of the newly formed 5' termini. To explain the complex mechanism of this enzyme, it is suggested that the unidentified 5'-tails prevent wasteful rerestriction from occurring, whereas the 3'-single-stranded tails create DNA which, when nonhomologous to chromosomal DNA, cannot be rescued because such tails are not substrate for DNA polymerases. However, when homologous chromosomal DNA exists, the randomly cleaved large fragments with these tails can easily be assimilated by recA-mediated genetic recombination, thus stimulating DNA exchange between related organisms.     

Parallel thermodynamic analysis of duplexes on oligodeoxyribonucleotide microchips.

A microchip method has been developed for massive and parallel thermodynamic analyses of DNA duplexes. Fluorescently labeled oligonucleotides were hybridized with oligonucleotides immobilized in the 100 x 100 x 20 mum gel pads of the microchips. The equilibrium melting curves for all microchip duplexes were measured in real time in parallel for all microchip duplexes. Thermodynamic data for perfect and mismatched duplexes that were obtained using the microchip method directly correlated with data obtained in solution. Fluorescent labels or longer linkers between the gel and the oligonucleotides appeared to have no significant effect on duplex stability. Extending the immobilized oligonucleotides with a four-base mixture from the 3'-end or one or two universal bases (5-nitroindole) from the 3'- and/or 5'-end increased the stabilities of their duplexes. These extensions were applied to increase the stabilities of the duplexes formed with short oligonucleotides in microchips, to significantly lessen the differences in melting curves of the AT- and GC-rich duplexes, and to improve discrimination of perfect duplexes from those containing poorly recognized terminal mismatches. This study explored a way to increase the efficiency of sequencing by hybridization on oligonucleotide microchips.