共查询到20条相似文献,搜索用时 0 毫秒
1.
The thermophilic eubacterium Thermus thermophilus belongs to one of the oldest branches of evolution and has a multilayered cell envelope that differs from that of modern Gram-negative bacteria. Its outer membrane contains integral outer membrane proteins (OMPs), of which only a few are characterized. TtoA, a new β-barrel OMP, was identified by searching the genome sequence of strain HB27 for the presence of a C-terminal signature sequence. The structure of TtoA was determined to a resolution of 2.8 Å, representing the first crystal structure of an OMP from a thermophilic bacterium. TtoA consists of an eight-stranded β-barrel with a large extracellular part to which a divalent cation is bound. A five-stranded extracellular β-sheet protrudes out of the membrane-embedded transmembrane barrel and is stabilized by a disulfide bridge. The edge of this β-sheet forms crystal contacts that could mimic interactions with other proteins. In modern Gram-negative bacteria, the C-terminal signature sequence of OMPs is required for binding to an Omp85 family protein as a prerequisite for its assembly. We present hints that a similar assembly pathway exists in T. thermophilus by an in vitro binding assay, where unfolded TtoA binds to the Thermus Omp85 family protein TtOmp85, while a mutant without the signature sequence does not. 相似文献
2.
Sergey A. Siletsky Ilya Belevich Audrius Jasaitis Mårten Wikström Michael I. Verkhovsky 《BBA》2007,1767(12):1383-1392
The kinetics of the oxidation of fully-reduced ba3 cytochrome c oxidase from Thermus thermophilus by oxygen were followed by time-resolved optical spectroscopy and electrometry. Four catalytic intermediates were resolved during this reaction. The chemical nature and the spectral properties of three intermediates (compounds A, P and O) reproduce the general features of aa3-type oxidases. However the F intermediate in ba3 oxidase has a spectrum identical to the P state. This indicates that the proton taken up during the P → F transition does not reside in the binuclear site but is rather transferred to the covalently cross-linked tyrosine near that site. The total charge translocation associated with the F → O transition in ba3 oxidase is close to that observed during the F → O transition in the aa3 oxidases. However, the PR → F transition is characterized by significantly lower charge translocation, which probably reflects the overall lower measured pumping efficiency during multiple turnovers. 相似文献
3.
Christian Löw Henning Tidow Caroline Haupt Christian Scholz Jochen Balbach 《Journal of molecular biology》2010,398(3):375-390
SlyD (sensitive to lysis D; product of the slyD gene) is a prolyl isomerase [peptidyl-prolyl cis/trans isomerase (PPIase)] of the FK506 binding protein (FKBP) type with chaperone properties. X-ray structures derived from three different crystal forms reveal that SlyD from Thermus thermophilus consists of two domains representing two functional units. PPIase activity is located in a typical FKBP domain, whereas chaperone function is associated with the autonomously folded insert-in-flap (IF) domain. The two isolated domains are stable and functional in solution, but the presence of the IF domain increases the PPIase catalytic efficiency of the FKBP domain by 2 orders of magnitude, suggesting that the two domains act synergistically to assist the folding of polypeptide chains. The substrate binding surface of SlyD from T. thermophilus was mapped by NMR chemical shift perturbations to hydrophobic residues of the IF domain, which exhibits significantly reduced thermodynamic stability according to NMR hydrogen/deuterium exchange and fluorescence equilibrium transition experiments. Based on structural homologies, we hypothesize that this is due to the absence of a stabilizing β-strand, suggesting in turn a mechanism for chaperone activity by ‘donor-strand complementation.’ Furthermore, we identified a conserved metal (Ni2+) binding site at the C-terminal SlyD-specific helical appendix of the FKBP domain, which may play a role in metalloprotein assembly. 相似文献
4.
Immacolata Del Giudice Danila Limauro Emilia Pedone Simonetta Bartolucci Gabriella Fiorentino 《Biochimica et Biophysica Acta - Proteins and Proteomics》2013,1834(10):2071-2079
Microorganisms living in arsenic-rich geothermal environments act on arsenic with different biochemical strategies, but the molecular mechanisms responsible for the resistance to the harmful effects of the metalloid have only partially been examined. In this study, we investigated the mechanisms of arsenic resistance in the thermophilic bacterium Thermus thermophilus HB27. This strain, originally isolated from a Japanese hot spring, exhibited tolerance to concentrations of arsenate and arsenite up to 20 mM and 15 mM, respectively; it owns in its genome a putative chromosomal arsenate reductase (TtarsC) gene encoding a protein homologous to the one well characterized from the plasmid pI258 of the Gram + bacterium Staphylococcus aureus. Differently from the majority of microorganisms, TtarsC is part of an operon including genes not related to arsenic resistance; qRT-PCR showed that its expression was four-fold increased when arsenate was added to the growth medium. The gene cloning and expression in Escherichia coli, followed by purification of the recombinant protein, proved that TtArsC was indeed a thioredoxin-coupled arsenate reductase with a kcat/KM value of 1.2 × 104 M− 1 s− 1. It also exhibited weak phosphatase activity with a kcat/KM value of 2.7 × 10− 4 M− 1 s− 1. The catalytic role of the first cysteine (Cys7) was ascertained by site-directed mutagenesis. These results identify TtArsC as an important component in the arsenic resistance in T. thermophilus giving the first structural–functional characterization of a thermophilic arsenate reductase. 相似文献
5.
The kinetics of single-electron injection into the oxidized nonrelaxed state (OH → EH transition) of the aberrant ba3 cytochrome oxidase from Thermus thermophilus, noted for its lowered efficiency of proton pumping, was investigated by time-resolved optical spectroscopy. Two main phases of intraprotein electron transfer were resolved. The first component (τ ∼ 17 μs) reflects oxidation of CuA and reduction of the heme groups (low-spin heme b and high-spin heme a3 in a ratio close to 50:50). The subsequent component (τ ∼ 420 μs) includes reoxidation of both hemes by CuB. This is in significant contrast to the OH → EH transition of the aa3-type cytochrome oxidase from Paracoccus denitrificans, where the fastest phase is exclusively due to transient reduction of the low-spin heme a, without electron equilibration with the binuclear center. On the other hand, the one-electron reduction of the relaxed O state in ba3 oxidase was similar to that in aa3 oxidase and only included rapid electron transfer from CuA to the low-spin heme b. This indicates a functional difference between the relaxed O and the pulsed OH forms also in the ba3 oxidase from T. thermophilus. 相似文献
6.
7.
8.
Optimized variants of the cold shock protein from in vitro selection: structural basis of their high thermostability 总被引:1,自引:0,他引:1
Max KE Wunderlich M Roske Y Schmid FX Heinemann U 《Journal of molecular biology》2007,369(4):1087-1097
The bacterial cold shock proteins (Csp) are widely used as models for the experimental and computational analysis of protein stability. In a previous study, in vitro evolution was employed to identify strongly stabilizing mutations in Bs-CspB from Bacillus subtilis. The best variant found by this approach contained the mutations M1R, E3K and K65I, which raised the midpoint of thermal unfolding of Bs-CspB from 53.8 degrees C to 83.7 degrees C, and increased the Gibbs free energy of stabilization by 20.9 kJ mol(-1). Another selected variant with the two mutations A46K and S48R was stabilized by 11.1 kJ mol(-1). To elucidate the molecular basis of these stabilizations, we determined the crystal structures of these two Bs-CspB variants. The mutated residues are generally well ordered and provide additional stabilizing interactions, such as charge interactions, additional hydrogen bonds and improved side-chain packing. Several mutations improve the electrostatic interactions, either by the removal of unfavorable charges (E3K) or by compensating their destabilizing interactions (A46K, S48R). The stabilizing mutations are clustered at a contiguous surface area of Bs-CspB, which apparently is critically important for the stability of the beta-barrel structure but not well optimized in the wild-type protein. 相似文献
9.
Handa N Terada T Doi-Katayama Y Hirota H Tame JR Park SY Kuramitsu S Shirouzu M Yokoyama S 《Protein science : a publication of the Protein Society》2005,14(4):1004-1010
The isoprenoid quinones exist widely among prokaryotes and eukaryotes. They play essential roles in respiratory electron transport and in controlling oxidative stress and gene regulation. In the isoprenoid quinone biosynthetic pathway, polyprenyl pyrophosphates are used as isoprenoid side-chain precursors. Here we report the crystal structure of a novel polyprenyl pyrophosphate binding protein, TT1927b, from Thermus thermophilus HB8, complexed with its ligand. This protein belongs to the YceI-like family in the Pfam database, and its sequence homologs are present in a broad range of bacteria and archaea. The structure consists of an extended, eight-stranded, antiparallel beta-barrel. In the hydrophobic pore of the barrel, the protein binds the polyisoprenoid chain by hydrophobic interactions. Its overall structure resembles the lipocalin fold, but there is no sequence homology between TT1927b and the lipocalin family of proteins. 相似文献
10.
C. WillemsJ. Berberof-Van Sande J.E. Dumont 《Biochimica et Biophysica Acta (BBA)/General Subjects》1972
NaF mimicked the activation by thyrotropin of iodide binding to proteins and of glucose C-I oxidation but not the accumulation of intracellular colloid droplets or the stimulation of secretion in dog thyroid slices in vitro. On the contrary, NaF inhibited the two latter thyrotropin effects. The inhibitory action of F− was partially relieved by the addition of glucose to the medium; it was mimicked by sodium oxamate. These data suggest that NaF depresses the endocytosis of colloid and thyroid secretion by inhibiting aerobic glycolysis in the follicular cell. NaF inhibited the activation of colloid droplet accumulation and secretion by N6,O2′-dibutyryl-adenosine 3′,5′-monophosphate (dibutyryl cyclic AMP) and the accumulation of cyclic AMP in thyrotropin-stimulated slices. This suggests an inhibition at the level of both cyclic AMP accumulation and cyclic AMP action. The inhibition by NaF and sodium oxamate of colloid droplet formation and thyroid secretion but not of glucose C-I oxidation in stimulated slices further confirms our conclusion that the latter effect is not merely a consequence of the activation by thyrotropin of colloid endocytosis. 相似文献
11.
Nakaminami K Sasaki K Kajita S Takeda H Karlson D Ohgi K Imai R 《FEBS letters》2005,579(21):4887-4891
The cold-induced wheat WCSP1 protein belongs to the cold shock domain (CSD) protein family. In prokaryotes and eukaryotes, the CSD functions as a nucleic acid-binding domain. Here, we demonstrated that purified recombinant WCSP1 is boiling soluble and binds ss/dsDNA and mRNA. Furthermore, boiled-WCSP1 retained its characteristic nucleic acid-binding activity. A WCSP1 deletion mutant, containing only a CSD, lost ssDNA/RNA-binding activity; while a mutant containing the CSD and the first glycine-rich region (GR) displayed the activity. These data indicated that the first GR of WCSP1 is necessary for the binding activity but is not for the heat stability of the protein. 相似文献
12.
Ito K Arai R Fusatomi E Kamo-Uchikubo T Kawaguchi S Akasaka R Terada T Kuramitsu S Shirouzu M Yokoyama S 《Protein science : a publication of the Protein Society》2006,15(5):1187-1192
TTHA0727 is a conserved hypothetical protein from Thermus thermophilus HB8, with a molecular mass of 12.6 kDa. TTHA0727 belongs to the carboxymuconolactone decarboxylase (CMD) family (Pfam 02627). A sequence comparison with its homologs suggested that TTHA0727 is a distinct protein from alkylhydroperoxidase AhpD and gamma-carboxymuconolactone decarboxylase in the CMD family. Here we report the 1.9 A crystal structure of TTHA0727 (PDB ID: 2CWQ) determined by the multiwavelength anomalous dispersion method. The TTHA0727 monomer structure consists of seven alpha-helices (alpha1-alpha7) and one short 3(10)-helix. The crystal structure and the analytical ultracentrifugation revealed that TTHA0727 forms a hexameric ring structure in solution. The electrostatic potential distribution on the solvent-accessible surface of the TTHA0727 hexamer showed that positively charged regions exist on the side of the ring structure, suggesting that TTHA0727 interacts with some negatively charged molecules. A structural homology search revealed that the structure of three alpha-helices (alpha4-alpha6) is remarkably conserved, suggesting that it is the common structural motif for the CMD family proteins. In addition, the nine residues of the N-terminal tag bound to the cleft region between alpha1 and alpha3 in chains A and B of TTHA0727, implying that this region is the putative binding/active site for some small molecules. 相似文献
13.
14.
Hua Wang Yan Fang Zhongzan Bao Xing Jin Wenjuan Zhu Lipeng Wang Teng Liu Haipeng Ji Haiying Wang Shiqing Xu Yanghu Sima 《Gene》2014
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression. A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins. Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA level was elevated at high-temperature and this increase was greater in females. The ORF without the signal peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to high-temperature stress. 相似文献
15.
In the present study, we identified and characterized two small heat shock protein genes from Apis cerana cerana, named AccHsp24.2 and AccHsp23.0. An alignment analysis showed that AccHsp24.2 and AccHsp23.0 share high similarity with other members of the α-crystallin/sHSP family, all of which contain the conserved α-crystallin domain. The recombinant AccHsp24.2 and AccHsp23.0 proteins were shown to have molecular chaperone activity by the malate dehydrogenase thermal aggregation assay. Three heat shock elements were detected in the 5′-flanking region of AccHsp24.2 and eleven in AccHsp23.0, and two Drosophila Broad-Complex genes for ecdysone steroid response sites were found in each of the genes. The presence of these elements suggests that the expression of these genes might be regulated by heat shock and ecdysone, which was confirmed by quantitative RT-PCR (RT-qPCR). The results revealed that the expression of the two genes could be induced by cold shock (4 °C) and heat shock (37 °C and 43 °C) in an analogous manner, and AccHsp24.2 was more susceptible than AccHsp23.0. In addition, the expression of the two genes was induced by high concentrations of ecdysone in vitro and in vivo. The accumulation of AccHsp24.2 and AccHsp23.0 mRNA was also detected in different developmental stages and tissues. In spite of the differential expression at the same stage, these genes shared similar developmental patterns, suggesting that they are regulated by similar mechanisms. 相似文献
16.
In an effort to understand whether heat shock protein 70 (Hsp70) participates in the environmental 5 °C signal reception/transduction toward breaking embryonic diapause of the silkworm Bombyx mori, we isolated a cDNA for Hsp70a and examined the expression of Hsp70a mRNA in B. mori diapause and nondiapause eggs by quantitative real-time PCR. Hsp70a mRNA gradually increased in diapause eggs continuously kept at 25 °C after oviposition to maintain diapause. When diapause eggs were exposed to the diapause-terminating condition of 5 °C beginning at 2 days post-oviposition, Hsp70a mRNA increased beginning at 5 days post-cold treatment. Even in nondiapause eggs, Hsp70a mRNA increased slightly with exposure to 5 °C. These results suggest that Hsp70a is involved in reception/transduction of the diapause-terminating (5 °C) signal via gene activation. The expression patterns of Hsp70a mRNA are discussed in relation to those of the cold-response gene Samui. 相似文献
17.
G. Girija Lakshmi Sushmita GhoshGabriel P. Jones Roshni ParikhBridgette A. Rawlins Jack C. Vaughn 《Gene》2012
Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA–protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. 相似文献
18.
19.
The cellular response of three Chlorella species that differ in their temperature preferences and tolerance – Chlorella vulgaris — Antarctic, C. vulgaris strain 8/1 — thermophilic, and Chlorella kesslery — mesophilic – is analysed. 相似文献
20.
The two-state folding reaction of the cold shock protein from Bacillus caldolyticus (Bc-Csp) is preceded by a rapid chain collapse. A fast shortening of intra-protein distances was revealed by F?rster resonance energy transfer (FRET) measurements with protein variants that carried individual pairs of donor and acceptor chromophores at various positions along the polypeptide chain. Here we investigated the specificity of this rapid compaction. Energy transfer experiments that probed the stretching of strand beta2 and the close approach between the strands beta1 and beta2 revealed that the beta1-beta2 hairpin is barely formed in the collapsed form, although it is native-like in the folding transition state of Bc-Csp. The time course of the collapse could not be resolved by pressure or temperature jump experiments, indicating that the collapsed and extended forms are not separated by an energy barrier. The co-solute (NH4)2SO4 stabilizes both native Bc-Csp and the collapsed form, which suggests that the large hydrated SO4(2-) ions are excluded from the surface of the collapsed form in a similar fashion as they are excluded from folded Bc-Csp. Ethylene glycol increases the stability of proteins because it is excluded preferentially from the backbone, which is accessible in the unfolded state. The collapsed form of Bc-Csp resembles the unfolded form in its interaction with ethylene glycol, suggesting that in the collapsed form the backbone is still accessible to water and small molecules. Our results thus rule out that the collapsed form is a folding intermediate with native-like chain topology. It is better described as a mixture of compact conformations that belong to the unfolded state ensemble. However, some of its structural elements are reminiscent of the native protein. 相似文献