Nonpathogenic common variants of IFNGR1 and IFNGR2 in association with total serum IgE levels.

Atopy is an immune disorder in which a Th2 dominant mechanism leads to high IgE levels and the clinical disorder asthma. It has been postulated that the Th1 cytokine IFNgamma, acting through its heterodimeric receptors, IFNgammaR1 and IFNgammaR2, in the induction/proliferation of Th1 cells, might suppress the Th2 responses that may underlie atopic asthma. However, neither murine nor human variants of IFNgamma associate with atopy. Several dysfunctional mutations have been identified in IFNgamma receptor genes (IFNGR1 and IFNGR2) in relation to severe and selective infections with poorly pathogenic organisms. However, little is known about common polymorphisms and their functional role in atopy. To test whether such variants of IFNGR1 and IFNGR2 relate to atopic asthma, we conducted a genetic association study in both British (n = 300) and Japanese (n = 200) populations. An intronic variant of IFNGR1 showed marginal association with total serum IgE levels in the British population compared with those with total IgE levels <30 IU/ml and those with >120-500 IU/ml [odds ratio = 2.00 (95% CI 1. 00-4.07), P = 0.048]. A coding variant, Gln64Arg of the IFNGR2, also associated with total serum IgE levels in the British population [chi(2) = 5.08, P = 0.024]. Further genetic and functional analyses are needed to clarify the role of variants of IFNgamma receptor genes in atopic immune disorder among different ethnic groups.     

Linkage and association analysis of candidate genes for TB and TNFα cytokine expression: evidence for association with IFNGR1, IL-10, and TNF receptor 1 genes

Tuberculosis (TB) is a growing public health threat globally and several studies suggest a role of host genetic susceptibility in increased TB risk. As part of a household contact study in Kampala, Uganda, we have taken a unique approach to the study of genetic susceptibility to TB by developing an intermediate phenotype model for TB susceptibility, analyzing levels of tumor necrosis factor-α (TNFα) in response to culture filtrate as the phenotype. In the present study, we analyzed candidate genes related to TNFα regulation and found that interleukin (IL)-10, interferon-gamma receptor 1 (IFNGR1), and TNFα receptor 1 (TNFR1) genes were linked and associated to both TB and TNFα. We also show that these associations are with progression to active disease and not susceptibility to latent infection. This is the first report of an association between TB and TNFR1 in a human population and our findings for IL-10 and IFNGR1 replicate previous findings. By observing pleiotropic effects on both phenotypes, we show construct validity of our intermediate phenotype model, which enables the characterization of the role of these genetic polymorphisms on TB pathogenesis. This study further illustrates the utility of such a model for disentangling complex traits. C. C. Whalen and S. K. Iyengar contributed equally as senior authors of this work.     

Intratumoral injection of Propionibacterium acnes suppresses malignant melanoma by enhancing Th1 immune responses

Malignant melanoma (MM) is an aggressive cutaneous malignancy associated with poor prognosis; many putatively therapeutic agents have been administered, but with mostly unsuccessful results. Propionibacterium acnes (P. acnes) is an aerotolerant anaerobic gram-positive bacteria that causes acne and inflammation. After being engulfed and processed by phagocytes, P. acnes induces a strong Th1-type cytokine immune response by producing cytokines such as IL-12, IFN-γ and TNF-α. The characteristic Th2-mediated allergic response can be counteracted by Th1 cytokines induced by P. acnes injection. This inflammatory response induced by P. acnes has been suggested to have antitumor activity, but its effect on MM has not been fully evaluated.We analyzed the anti-tumor activity of P. acnes vaccination in a mouse model of MM. Intratumoral administration of P. acnes successfully protected the host against melanoma progression in vivo by inducing both cutaneous and systemic Th1 type cytokine expression, including TNF-α and IFN-γ, which are associated with subcutaneous granuloma formation. P. acnes-treated tumor lesions were infiltrated with TNF-α and IFN-γ positive T cells. In the spleen, TNF-α as well as IFN-γ producing CD8(+)T cells were increased, and interestingly, the number of monocytes was also increased following P. acnes administration. These observations suggest that P. acnes vaccination induces both systemic and local antitumor responses. In conclusion, this study shows that P. acnes vaccination may be a potent therapeutic alternative in MM.     

Decreased plasma granulysin and increased interferon-gamma concentrations in patients with newly diagnosed and relapsed tuberculosis

Granulysin and interferon-gamma (IFN-γ) have broad antimicrobial activity which controls Mycobacterium tuberculosis (M. tuberculosis) infection. Circulating granulysin and IFN-γ concentrations were measured and correlated with clinical disease in Thai patients with newly diagnosed, relapsed and chronic tuberculosis (TB). Compared to controls, patients with newly diagnosed, relapsed and chronic TB had lower circulating granulysin concentrations, these differences being significant only in newly diagnosed and relapsed TB (P < 0.001 and 0.004, respectively). Granulysin concentrations in patients with newly diagnosed and relapsed TB were significantly lower than in those with chronic TB (P= 0.003 and P= 0.022, respectively). In contrast, significantly higher circulating IFN-γ concentrations were found in patients with newly diagnosed and relapsed TB compared to controls (P < 0.001). The IFN-γ concentrations in newly diagnosed and relapsed patients were not significantly different from those of patients with chronic TB. However, in vitro stimulation of peripheral blood mononuclear cells (PBMCs) from patients with newly diagnosed, relapsed and chronic TB with purified protein derivative (PPD) or heat killed M. tuberculosis (H37Ra) enhanced production of granulysin by PBMCs. In vitro, stimulation of PBMCs of newly diagnosed TB patients with PPD produced greater amounts of IFN-γ than did controls, while those stimulated with H37Ra did not. The results demonstrate that patients with active pulmonary TB have low circulating granulysin but high IFN-γ concentrations, suggesting possible roles in host defense against M. tuberculosis for these agents.     

The role of polymorphisms in Toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity

Toll-like receptors (TLRs) and their intracellular signaling molecules play an important role in innate immunity. In this study, we examined associations between polymorphisms in TLR family genes and measles vaccine-specific immune responses. We genotyped 764 subjects (11-22 years old) after two doses of measles vaccine for TLR signaling SNP markers (n = 454). The major alleles of coding SNPs in the TLR2 (rs3804100) and TLR4 (rs5030710) genes were associated with a dose-related increase (660 vs. 892 mIU/ml, p = 0.002) and a dose-related decrease (2,209 vs. 830 mIU/ml, p = 0.001) in measles-specific antibodies, respectively. A significant association was found between lower measles antibody levels and the haplotype ACGGCGAGAAAAGAGAAGAGAGAGAA (p = 0.01) in the MAP3K7 gene. Furthermore, the minor allele of a SNP (rs702966) of the KIAA1542 (IRF7) gene was associated with a dose-related decrease in IFN-γ Elispot responses (38 vs. 26 spot-forming cells per 2 × 10(5) PBMCs, p = 0.00002). We observed an additional 12 associations (p < 0.01) between coding (nonsynonymous and synonymous) polymorphisms within the TLRs (TLR2, 7, and 8), IKBKE, TICAM1, NFKBIA, IRAK2, and KIAA1542 genes and variations in measles-specific IL-2, IL-6, IFN-α, IFN-γ, IFNλ-1, and TNF-α secretion levels. Our data demonstrate that polymorphisms in TLR and other related immune response signaling molecules have significant effects on measles vaccine-associated immune responses. These data help to establish the genetic foundation for immune response variation in response to measles immunization and provide important insights for the rational development of new measles vaccines.     

NOS2A, TLR4, and IFNGR1 interactions influence pulmonary tuberculosis susceptibility in African-Americans

Tuberculosis (TB) has substantial mortality worldwide with 5–10% of those exposed progressing to active TB disease. Studies in mice and humans indicate that the inducible nitric oxide synthase (iNOS) molecule plays an important role in immune response to TB. A mixed case–control association study of individuals with TB, relatives, or close contact controls was performed in 726 individuals (279 case and 166 control African-Americans; 198 case and 123 control Caucasians). Thirty-nine single nucleotide polymorphisms (SNPs) were selected from the NOS2A gene for single SNP, haplotype, and multilocus interaction analyses with other typed candidate genes using generalized estimating equations. In African-Americans, ten NOS2A SNPs were associated with TB. The strongest associations were observed at rs2274894 (odds ratio (OR) = 1.84, 95% confidence interval (CI) [1.23–2.77], p = 0.003) and rs7215373 (OR = 1.67, 95% CI [1.17–2.37], p = 0.004), both of which passed a false discovery rate correction for multiple comparisons (q* = 0.20). The strongest gene–gene interactions were observed between NOS2A rs2248814 and IFNGR1 rs1327474 (p = 0.0004) and NOS2A rs944722 and IFNGR1 rs1327474 (p = 0.0006). Three other SNPs in NOS2A interacted with TLR4 rs5030729 and five other NOS2A SNPs interacted with IFNGR1 rs1327474. No significant associations were observed in Caucasians. These results suggest that NOS2A variants may contribute to TB susceptibility, particularly in individuals of African descent, and may act synergistically with SNPs in TLR4 and IFNGR1.     

Protective and therapeutic efficacy of Mycobacterium smegmatis expressing HBHA-hIL12 fusion protein against Mycobacterium tuberculosis in mice

Tuberculosis (TB) remains a major worldwide health problem. The only vaccine against TB, Mycobacterium bovis Bacille Calmette-Guerin (BCG), has demonstrated relatively low efficacy and does not provide satisfactory protection against the disease. More efficient vaccines and improved therapies are urgently needed to decrease the worldwide spread and burden of TB, and use of a viable, metabolizing mycobacteria vaccine may be a promising strategy against the disease. Here, we constructed a recombinant Mycobacterium smegmatis (rMS) strain expressing a fusion protein of heparin-binding hemagglutinin (HBHA) and human interleukin 12 (hIL-12). Immune responses induced by the rMS in mice and protection against Mycobacterium tuberculosis (MTB) were investigated. Administration of this novel rMS enhanced Th1-type cellular responses (IFN-γ and IL-2) in mice and reduced bacterial burden in lungs as well as that achieved by BCG vaccination. Meanwhile, the bacteria load in M. tuberculosis infected mice treated with the rMS vaccine also was significantly reduced. In conclusion, the rMS strain expressing the HBHA and human IL-12 fusion protein enhanced immunogencity by improving the Th1-type response against TB, and the protective effect was equivalent to that of the conventional BCG vaccine in mice. Furthermore, it could decrease bacterial load and alleviate histopathological damage in lungs of M. tuberculosis infected mice.     

Missense mutations of the interleukin-12 receptor beta 1(IL12RB1) and interferon-gamma receptor 1 (IFNGR1) genes are not associated with susceptibility to lepromatous leprosy in Korea

Interleukin-12 receptor beta 1 ( IL12RB1), interleukin-12 receptor beta 2 ( IL12RB2), and interferon gamma receptor 1 ( IFNGR1) perform important roles in the host defense against intracellular pathogens such as Mycobacteria. Several mutations within their genes have been confirmed as associated with increased susceptibility to mycobacterial infection. However, the association between mutations of the IL12RB1, IL12RB2, and IFNGR1 encoding genes and lepromatous leprosy has not been studied. This study screened for polymorphisms within IL12RB1, IL12RB2, and IFNGR1 encoding genes in the Korean populations using polymerase chain reaction (PCR)/single-strand conformation polymorphism (SSCP) DNA sequencing assay, and an association study was performed using the missense mutations of 705 A/G (Q214R), 1196 G/C (G378R), 1637 G/A (A525T), and 1664 C/T (P534S) of the IL12RB1, 83 G/A (V14M), and 1443 T/C (L467P) for the IFNGR1 encoding genes. There were no differences in the genotype and allele frequencies of IL12RB1 and IFNGR1 genes between 93 lepromatous leprosy patients and 94 control subjects. In conclusion, missense mutations of 705 A/G (Q214R), 1196 G/C (G378R), 1637 G/A (A525T), 1664 C/T (P534S) of the IL12RB1, 83 G/A (V14 M), and 1443 T/C (L467P) of the IFNGR1 encoding genes have no association with the susceptibility to lepromatous leprosy in the Korean population.     

Prospective monitoring reveals dynamic levels of T cell immunity to Mycobacterium tuberculosis in HIV infected individuals

Monitoring of latent Mycobacterium tuberculosis infection may prevent disease. We tested an ESAT-6 and CFP-10-specific IFN-γ Elispot assay (RD1-Elispot) on 163 HIV-infected individuals living in a TB-endemic setting. An RD1-Elispot was performed every 3 months for a period of 3-21 months. 62% of RD1-Elispot negative individuals were positive by cultured Elispot. Fluctuations in T cell response were observed with rates of change ranging from -150 to +153 spot-forming cells (SFC)/200,000 PBMC in a 3-month period. To validate these responses we used an RD1-specific real time quantitative PCR assay for monokine-induced by IFN-γ (MIG) and IFN-γ inducible protein-10 (IP10) (MIG: r?=?0.6527, p?=?0.0114; IP-10: r?=?0.6967, p?=?0.0056; IP-10+MIG: r?=?0.7055, p?=?0.0048). During follow-up 30 individuals were placed on ARVs and 4 progressed to active TB. Fluctuations in SFC did not correlate with CD4 count, viral load, treatment initiation, or progression to active TB. The RD1-Elispot appears to have limited value in this setting.     

Evaluation of microsatellite markers in association studies: a search for an immune-related susceptibility gene in sarcoidosis

Association studies using linkage disequilibrium (LD) between candidate loci and nearby markers have been proposed to identify susceptibility genes for complex diseases. We analyzed polymorphisms of microsatellites (MSs) and LD patterns of the regions in which candidate genes related to the Th1 immune response have been annotated and attempted to identify a susceptibility gene for sarcoidosis in a marker-based association study. Nineteen MSs were identified in six Th1-related genes (IFNGR1, IFNGR2, IL12RB1, IL12RB2, STAT1 and STAT4) and then eight were further characterized as useful polymorphic markers. Most of these MSs showed LD with single nucleotide polymorphisms (SNPs) on both 5 and 3 ends of these candidate genes, in which r² values between at least one of the MS marker alleles and the SNPs were higher than 0.1. A significant association with one MS allele near STAT4 was shown and a cluster of SNPs in LD with the MS marker was associated with sarcoidosis. These results suggest that association studies using not only SNPs but also multi-allelic MS within or near candidate loci would be useful markers to search for a disease susceptibility gene, especially in populations with unknown LD structure.     

IFNG polymorphisms are associated with tuberculosis in Han Chinese pediatric female population

Host genetic factors play a major role in determining differential susceptibility to human tuberculosis (TB), a re-emerging infectious disease throughout the world. Genetic variations in the IFNG gene coding for interferon gamma (IFN-γ), have been identified in TB patients. To investigate the association of the IFNG polymorphisms with TB susceptibility in Chinese pediatric population. A case–control study of 189 TB patients and 164 controls was performed using single-nucleotide polymorphism (SNP) analysis. Genomic DNA was extracted from leukocytes in peripheral blood. Three SNPs of IFNG, including ?1616C/T (rs2069705), +874A/T (rs2430561), and +3234C/T (rs2069718), were selected for genotyping and analysis. The +874A and +3234C alleles were more frequent among TB patients (P = 0.108 and P = 0.088), especially in females (both P = 0.029), although this difference was not significant since Bonferroni corrected significance threshold was 0.025 (two of three SNPs were found to be in linkage disequilibrium). More pronounced differences for the +874 and +3234 polymorphisms were found under the genotype comparison between TB cases and controls in the total population [P = 0.026 (borderline non-significance) and P = 0.020, respectively], and in the female subgroup (P = 0.020 and P = 0.020). The dominant model of inheritance was shown to be significant for +874A and +3234C alleles (both P = 0.019) in the female subgroup. The +874A and +3234C alleles were more frequently found in extrapulmonary TB patients than in controls (P = 0.039). Haplotype analysis carried out on these three SNPs showed the TTT haplotype to be more frequent in controls than in TB cases, and this difference showed a strong significance (P = 0.005). The +874A and +3234C alleles may be related to TB susceptibility in the female subgroup in the Chinese pediatric population of North China. The higher rate of +874A (known to correlate with lower IFN-γ expression) in the extrapulmonary TB subgroup suggests a sufficient IFN-γ expression to be not only an important factor for the onset of TB disease but also for limiting its dissemination to lungs.     

Mitochondrial adenine nucleotide translocator 3 is regulated by IL-4 and IFN-gamma via STAT-dependent pathways

IL-4 and IFN-γ are prototypical Th2 and Th1 cytokines, respectively. They reciprocally regulate a number of genes involved in Th1 vs Th2 immune balance. Using DD-PCR analysis, adenine nucleotide translocase (ANT) 3, an enzyme which exchanges ATP and ADP through mitochondrial membrane, has been identified as a novel target counter-regulated by IL-4 and IFN-γ. We have observed that IL-4 and IFN-γ each up-regulates ANT3 in T cells both at mRNA and protein levels, while cotreatment of IL-4 and IFN-γ counter-regulates ANT3 expression. In contrast, other isoforms of ANT were not affected by IL-4 or IFN-γ. Emplyoing transfection and overexpression of STAT6 and STAT1 in STAT-deficient cells, we demonstrate that induction of ANT3 by IL-4 and IFN-γ proceeds via pathways involving STAT6 and STAT1, respectively. Furthermore, regulation of ANT3 expression by IL-4 and IFN-γ correlated with the modulation T cell survival by these cytokines from dex-induced apoptosis. Considering the critical role of mitochondrial ANTs in energy metabolism and apoptosis, ANT3 regulation by IL-4 and IFN-γ may have a functional implication in cytokine-mediated T cell survival.     

Gene-gene interaction between tuberculosis candidate genes in a South African population

In a complex disease such as tuberculosis (TB) it is increasingly evident that gene-gene interactions play a far more important role in an individual??s susceptibility to develop the disease than single polymorphisms on their own, as one gene can enhance or hinder the expression of another gene. Gene-gene interaction analysis is a new approach to elucidate susceptibility to TB. The possibility of gene-gene interactions was assessed, focusing on 11 polymorphisms in nine genes (DC-SIGN, IFN-??, IFNGR1, IL-8, IL-1Ra, MBL, NRAMP1, RANTES, and SP-D) that have been associated with TB, some repeatedly. An optimal model, which best describes and predicts TB case?Ccontrol status, was constructed. Significant interactions were detected between eight pairs of variants. The models fitted the observed data extremely well, with p?<?0.0001 for all eight models. A highly significant interaction was detected between INFGR1 and NRAMP1, which is not surprising because macrophage activation is greatly enhanced by IFN-?? and IFN-?? response elements that are present in the human NRAMP1 promoter region, providing further evidence for their interaction. This study enabled us to test the theory that disease outcome may be due to interaction of several gene effects. With eight instances of statistically significant gene-gene interactions, the importance of epistasis is clearly identifiable in this study. Methods for studying gene-gene interactions are based on a multilocus and multigene approach, consistent with the nature of complex-trait diseases, and may provide the paradigm for future genetic studies of TB.     

Interferon gamma +874T/A polymorphism is associated with susceptibility to active pulmonary tuberculosis development in Tunisian patients

Interferon gamma (IFN-γ) is a key cytokine involved mainly in the defense against intracellular pathogens such as Mycobacterium tuberculosis. Given its key role in the control of tuberculosis (TB), in the present article we have investigated a possible association between IFN-γ gene single-nucleotide polymorphism linked to high and low producer phenotypes (IFN-γ [+874T(high)?→?A(low)]) (rs2430561) and risk development of active TB in Tunisian patients. Genomic DNA samples were obtained from 223 patients with active TB (168 pulmonary and 55 extrapulmonary cases) and 150 healthy blood donors. Genotypes were analyzed using polymerase chain reaction-restriction fragment length polymorphism method. The +874 AA genotype (low IFN-γ producer) was significantly associated with increased risk of developing of active pulmonary TB (odds ratio [OR]?=?2.18; 95% confidence intervals [CI], 1.33-3.57; P corrected for the number of genotypes [Pc]?=?0.003). By contrast, the AT genotype was found to be significantly associated with resistance to pulmonary TB (OR?=?0.46; 95% CI, 0.28-0.74; Pc?=?0.0018) and extrapulmonary TB development (OR?=?0.46; 95% CI, 0.23-0.91; Pc?=?0.045). Collectively, our data showed that the IFN-γ +874T/A polymorphism is a determinant in the resistance or susceptibility to the development of active TB in the studied population.     

Enhanced T cell responsiveness to Mycobacterium bovis BCG r32-kDa Ag correlates with successful anti-tuberculosis treatment in humans

Th1 and Th2 cytokines play key role in protection from and pathogenesis of mycobacterial infection and their dynamic changes may predict clinical outcome of the patient. Patients with tuberculosis (TB) have a poorer cellular immune response to recombinant 32-kDa antigen (Ag) of Mycobacterium bovis (r32-kDa M. bovis) than do healthy volunteers. The basis for this observation was studied by evaluating the Th1 (gamma interferon [IFN-γ]) produced in response to the r32-kDa Ag M. bovis by peripheral blood mononuclear cells (PBMC) from patients with pulmonary TB (n = 20), extra-pulmonary TB (n = 13) and from healthy volunteers (n = 9). Recombinant 32-kDa M. bovis stimulated PBMC from TB patients produced significantly lower levels of IFN-γ at 0 month, and increased at 2–4, and 6 months of treatment and were highly significant (p < 0.000) compared to the responses in controls. The ratios of IFN-γ to IL-10 were low in patients newly diagnosed and improved both during and after treatment. The present study concludes that the levels of in vitro response to M. bovis BCG r32-kDa Ag leading to the specific release of IFN-γ increased after anti-tuberculosis treatment and seems to reflect the clinical status of the patient, thus reiterating the utility of this antigen in T cell based assays as a surrogate marker of cell mediated responses.     

Genome-wide SNP associations with rubella-specific cytokine responses in measles-mumps-rubella vaccine recipients

Genetic polymorphisms are known to affect responses to both viral infection and vaccination. Our previous work has described genetic polymorphisms significantly associated with variations in immune response to rubella vaccine from multiple gene families with known immune function, including HLA, cytokine and cytokine receptor genes, and in genes controlling innate and adaptive immunity. In this study, we assessed cellular immune responses (IFNγ and IL-6) in a cohort of healthy younger individuals and performed genome-wide SNP analysis on these same individuals. Here, we report the first genome-wide association study focused on immune responses following rubella vaccination. Our results indicate that rs16928280 in protein tyrosine phosphatase delta (PTPRD) and a collection of SNPs in ACO1 (encoding an iron regulatory protein) are associated with interindividual variations in IFNγ response to rubella virus stimulation. In contrast, we did not identify any significant genetic associations with rubella-specific IL-6 response. These genetic regions may influence rubella vaccine-induced IFNγ responses and warrant further studies in additional cohorts in order to confirm these findings.     

Whole-blood flow-cytometric analysis of antigen-specific CD4 T-cell cytokine profiles distinguishes active tuberculosis from non-active states

T-cell based IFN-γ release assays do not permit distinction of active tuberculosis (TB) from successfully treated disease or latent M. tuberculosis infection. We postulated that IFN-γ and IL-2 cytokine profiles of antigen-specific T cells measured by flow-cytometry ex vivo might correlate with TB disease activity in vivo. Tuberculin (PPD), ESAT-6 and CFP-10 were used as stimuli to determine antigen-specific cytokine profiles in CD4 T cells from 24 patients with active TB and 28 patients with successfully treated TB using flow-cytometry. Moreover, 25 individuals with immunity consistent with latent M. tuberculosis infection and BCG-vaccination, respectively, were recruited. Although the frequency of cytokine secreting PPD reactive CD4 T cells was higher in patients with active TB compared to patients with treated TB (median 0.81% vs. 0.39% of CD4 T cells, p?=?0.02), the overlap in frequencies precluded distinction between the groups on an individual basis. When assessing cytokine profiles, PPD specific CD4 T cells secreting both IFN-γ and IL-2 predominated in treated TB, latent infection and BCG-vaccination, whilst in active TB the cytokine profile was shifted towards cells secreting IFN-γ only (p<0.0001). Cytokine profiles of ESAT-6 or CFP-10 reactive CD4 T cells did not differ between the groups. Receiver operator characteristics (ROC) analysis revealed that frequencies of PPD specific IFN-γ/IL-2 dual-positive T cells below 56% were an accurate marker for active TB (specificity 100%, sensitivity 70%) enabling effective discrimination from non-active states. In conclusion, a frequency lower than 56% IFN-γ/IL-2 dual positive PPD-specific circulating CD4 T-cells is strongly indicative of active TB.     

Construction and immunogenicity of a new Fc-based subunit vaccine candidate against <Emphasis Type="Italic">Mycobacterium tuberculosis</Emphasis>

As an ancient disease, tuberculosis (TB) is a major global health threat. Therefore, there is an urgent need for an effective and safe anti-TB vaccine. In the current study, a delivery system of Fc domain of mouse IgG2a and early secreted antigenic target protein 6 (ESAT-6) was evaluated for the selective uptake of antigens by antigen-presenting cells (APCs). Thus, it was based on the immunogenicity of a fusion protein. The study was initiated by the transfer of recombinant expression vectors of pPICZαA-ESAT-6:Fcγ2a and pPICZαA-ESAT-6: His into Pichia pastoris (P. pastoris). Recombinant proteins were assessed for immunogenicity following the immunoblotting analysis. High levels of IFN-γ and IL-12 were produced to induce Th1-type cellular responses through vaccination with both recombinant proteins [ESAT-6:Fcγ2a (EF) and ESAT-6:His (EH)]. The Fc-tagged recombinant protein induced more effective Th1-type cellular responses with a low increment in IL-4 compared to PBS, BCG, and EH groups. Although in all the immunized groups, the ratio of IFN-γ/IL-4 was in favor of Th1 responses, the highest Th1/Th2 balance was observed in EF immunized group. Fc fragment of mouse IgG2a may induce a selective uptake of APCs towards the cross-presentation and formation of Th1 responses in favor of an appropriate protective anti-tuberculosis reaction. Thus, further research on Fc-fusion proteins is required to develop Fc-based TB vaccines.     

Induction of T helper 1 response by immunization of BALB/c mice with the gene encoding the second subunit of Echinococcus granulosus antigen B (EgAgB8/2)

A pre-designed plasmid containing the gene encoding the second subunit of Echinococcus granulosus AgB8 (EgAgB8/2) was used to study the effect of the immunization route on the immune response in BALB/c mice. Mice were immunized with pDRIVEEgAgB8/2 or pDRIVE empty cassette using the intramuscular (i.m.), intranasal (i.n.) or the epidermal gene gun (g.g.) routes. Analysis of the antibody response and cytokine data revealed that gene immunization by the i.m. route induced a marked bias towards a T helper type 1 (Th1) immune response as characterized by high IFN-γ gene expression and a low IgG1/IgG2a reactivity index (R.I.) ratio of 0.04. The i.n. route showed a moderate IFN-γ expression but a higher IgG1/IgG2a R.I. ratio of 0.25 indicating a moderate Th1 response. In contrast, epidermal g.g. immunization induced a Th2 response characterized by high IL-4 expression and the highest IgG1/IgG2a R.I. ratio of 0.58. In conclusion, this study showed the advantage of genetic immunization using the i.m. route and i.n. over the epidermal g.g. routes in the induction of Th1 immunity in response to E. granulosus AgB gene immunization.