A germline restricted, highly repetitive DNA sequence in Paramyxineatami : an interspecifically conserved, but somatically eliminated, element

In some species of hagfish, the phenomenon of chromosome elimination occurs during embryogenesis. However, only two repetitive DNA families are known to be represented in chromosomes that are eliminated from somatic cells of the Japanese hagfish Eptatretus okinoseanus. Using molecular analyses, another germ line-restricted, highly repetitive DNA family has been detected in another Japanese hagfish, Paramyxine atami. The repeat unit of this family, which is 83 bp long, has been designated “EEPa1”, for Eliminated Element of P. atami 1. DNA filter hybridization using EEPa1 as a probe revealed that this family is shared among several species and is conserved in the germline DNA. Although eliminated, repetitive DNA that is shared interspecifically has not been reported in hagfish species, cases of chromatin diminution and chromosome elimination processes have been described previously in other organisms.The patterns and intensities of hybridization signals suggest that members of the repetitive DNA family defined by EEPa1 have undergone concerted molecular evolution. Received: 7 January 1997 / Accepted: 13 May 1997     

GTPase Ran strongly accumulates at the kinetochores of somatic chromosomes in the spermatogonial mitoses of Acricotopus lucidus (Diptera,Chironomidae)

Unequal chromosome segregation and spindle formation occurs in the last gonial mitosis in the germ line of the chironomid Acricotopus lucidus. During this differential mitosis, all germ line-limited chromosomes (=Ks) migrate undivided to only one pole of the cell, while the somatic chromosomes (=Ss) first remain in the metaphase plane, and with the arrival of the Ks at the pole, they then separate equally. The evolutionarily conserved GTPase Ran plays a crucial role in many cellular processes. This includes the regulation of microtubule nucleation and stabilisation at kinetochores and of spindle assembly during mitosis, which is promoted by a RanGTP concentration gradient that forms around the mitotic chromosomes (Kalab et al. in Science 295:2452–2456, 2002, Nature 440:697–701, 2006). In the present study, a strong accumulation of Ran was detected by immunofluorescence at the kinetochores of the Ss in normal gonial and differential gonial mitoses of males of A. lucidus. In contrast, no Ran accumulation was observed at the kinetochores of the Ss in the metaphases of brain ganglia mitoses or of aberrant spermatocytes or in metaphases I and II of spermatocyte meiotic divisions. Likewise, there was no accumulation at the kinetochores of Drosophila melanogaster mitotic chromosomes from larval brains. The specific accumulation of Ran at the kinetochores of the Ss in differential gonial mitoses of A. lucidus strongly suggests that Ran is involved in a mechanism acting in this exceptional mitosis, which retains the Ss at the metaphase plane and prevents a premature separation and unequal segregation of the Ss during monopolar migration of the Ks.     

Structural evolution of the germ line-limited chromosomes in Acricotopus

The elimination of chromatin or whole chromosomes from the future somatic nuclei during germ line-soma differentiation in early embryogenesis is a genetic phenomenon found in a wide variety of animal species. Less is known about the origin, structure, and function of the germ line-limited chromosomes. In the chironomid Acricotopus lucidus fluorescence in situ hybridization (FISH) with labeled soma DNA to "Keimbahn" chromosomes (Ks) and soma chromosomes (Ss) of spermatogonial mitoses revealed that each of the nine different K types possesses large S-homologous sections, mostly in the distal parts of both chromosome arms. Painting probes of the three Ss and of each of their chromosome arms were generated by microdissection of polytene salivary gland chromosomes and subsequent amplification by the degenerate oligonucleotide-primed polymerase chain reaction. Multicolor FISH demonstrated that each of the Ks, with the exception of one K type, was painted by only one of the three S probes. Furthermore, in seven Ks, one chromosome arm was painted by the long-arm probe and the other by the short-arm probe of the S concerned. The hybridization pattern strongly suggests that each of these K types is derived from a specific S. One function of the S-homologous K sections is thought to be determination of the regular occurrence of crossover events, with the resulting chiasmata in these sections ensuring correct segregation of the K homologs during meiosis. Reverse chromosome painting on polytene S sets with a probe generated from metaphase Ks corroborates the above results and produces conclusive evidence for the hypothesis that during evolution the Ks have developed from the Ss by endopolyploidization and rearrangements followed by the accumulation of germ line-specific repetitive DNA sequences in the centromeric regions.     

Isolation of a new germ line-specific repetitive DNA family in Acricotopus by microdissection of polytenized germ line-limited chromosome sections from a permanent larval salivary gland preparation

In Acricotopus lucidus (Diptera, Chironomidae) the germ line-limited chromosomes (Ks) have developed from the soma chromosomes (Ss) by endoreduplication, rearrangements and accumulation of germ line-specific repetitive sequences. For molecular analysis of specific small K sections, microdissection of metaphase Ks generally yields very limited amounts of DNA. In this study, K-specific DNA was microdissected from defined polytenized K sections of X-ray induced K-S-rearrangements of permanent salivary gland chromosome preparations and was then amplified by DOP-PCR. A new germ line-specific tandem repetitive DNA family was isolated by this way from a heterochromatic K segment, characterized and localized on the Ks by FISH. The repetitive elements are related to sequences of earlier described K-specific tandem repetitive DNA families in A. lucidus, but are located mainly in terminal heterochromatin bands of the two largest Ks and only to a limited degree in the paracentromeric K heterochromatin. This demonstrates that a collection of permanent preparations of K-S-rearrangements with polytenized heterochromatic and S-homologous K sections of A. lucidus can be used as a source for obtaining K sequences of defined K parts to investigate the molecular evolution of the Ks.     

G-banding of germ line limited chromosomes in Acricotopus lucidus (Diptera,Chironomidae)

The germ line limited (K) chromosomes of Acricotopus lucidus (Diptera, Chironomidae) were stained for G-banding on gonial mitoses, along with the somatic (S) chromosomes. Nine different types of K chromosomes could be distinguished by the G-banding pattern and other cytological criteria. Various combinations of K chromosomes were found in the complements of different individuals and cells: some Ks were missing and others were present up to as many as five times. No two animals were completely alike in the composition of their gonial chromosome complement. Thus none of the different K types can be essential. These results are discussed in view of the complex chromosome cycle of the Orthocladiinae.     

Highly repetitive DNA sequences that are restricted to the germ line in the hagfish Eptatretus cirrhatus: a mosaic of eliminated elements

The New Zealand hagfish, Eptatretus cirrhatus, is known to eliminate parts of its chromosomes during embryogenesis from presumptive somatic cells. Electrophoresis of germ line and somatic DNAs of this species, after treatment with the restriction endonucleases DraI and EcoRI, revealed three fragments of DNA that were restricted to the germ line. DNA filter hybridization experiments demonstrated that these fragments were present almost exclusively in the germ line DNA of E. cirrhatus and that they were highly and tandemly repeated. Thus, these DNA fragments appeared to be eliminated during embryogenesis. Moreover, one fragment (a DraI fragment) cross-hybridized with the germ line DNA from other species of hagfish, namely, Eptatretus okinoseanus and Paramyxine atami. Molecular cloning and sequence analysis revealed that the DraI fragment was composed mainly of closely related sequences of 85 bp in length and that this sequence was about 75% homologous to the sequence of EEEo2 (eliminated element of E. okinoseanus 2) which is a germ line-restricted and highly repetitive sequence that was isolated previously from E. okinoseanus. The other two fragments were composed of three families of closely related sequences that were 172 bp long (designated EEEc1), 61 bp long (EEEc2) and 54 bp long (EEEc3). Fluorescence in situ hybridization experiments revealed that each eliminated element was distributed on several chromosomes that are limited to germ cells. EEEo2 was dispersed on 12 C-band-positive chromosomes. EEEc1 and EEEc3 were dispersed on all C-band-positive and several C-band-negative chromosomes. By contrast, EEEc2 was located to terminal regions of several C-band-negative chromosomes. These results suggest that the eliminated chromosomes in hagfish are mosaics of highly repeated, germ line-restricted families of DNA sequences. Received: ██; in revised form: 25 October 1997 / Accepted: ██     

Molecular and cytological characterization of repetitive DNA sequences in Brassica

Summary We isolated three different repetitive DNA sequences from B. campestris and determined their nucleotide sequences. In order to analyze organization of these repetitive sequences in Brassica, Southern blot hybridization and in situ hybridization with metaphase chromosomes were performed. The sequence cloned in the plasmid pCS1 represented a middle repetitive sequence present only in B. campestris and not detected in closely related B. Oleracea. This sequence was localized at centromeric regions of six specific chromosomes of B. campestris. The second plasmid, pBT4, contained a part of the 25S ribosomal RNA gene, and its copy number was estimated to be 1,590 and 1,300 per haploid genome for B. campestris and B. oleracea, respectively. In situ hybridization with this sequence showed a clear signal at the NOR region found in the second largest chromosome of B. Campestris. The third plasmid, pBT11, contained a 175-bp insert that belongs to a major family of tandem repeats found in all the Brassica species. This sequence was detected at centromeric regions of all the B. campestris chromosomes. Our study indicates that in situ hybridization with various types of repetitive sequences should give important information on the evolution of repetitive DNA in Brassica species.     

Asymmetric distribution of mitochondria and of spindle microtubules in opposite directions in differential mitosis of germ line cells in Acricotopus

Additional chromosomes present only in the germ line are a specific feature of the Orthocladiinae, a subfamily of the Chironomidae. During the complex chromosome cycle in the orthocladiid Acricotopus lucidus, about half of the germ-line-limited chromosomes (Ks) are eliminated in the first division of the primary germ cells. Following normal gonial mitoses, the reduction in the number of Ks is compensated for, in the last mitosis prior to meiosis, by a monopolar movement of the unseparated Ks, while the somatic chromosomes (Ss) segregate equally. This differential mitosis produces daughter cells with different chromosome constitutions and diverse developmental fates. A preferential segregation of mitochondria occurs to one pole associated with an asymmetric formation of the mitotic spindle. This has been detected in living gonial cells in both sexes by using MitoTracker probes and fluorochrome-labelled paclitaxel (taxol). In males, the resulting unequal partitioning of mitochondria to the daughter cells is equalised by the transport of mitochondria through a permanent cytoplasmic bridge from the aberrant spermatocyte to the primary spermatocyte. This asymmetry in the distribution and in the segregation of cytoplasmic components in differential gonial mitosis in Acricotopus may be involved in the process of cell-fate determination. Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorised users.     

A germline restricted, highly repetitive DNA sequence in Paramyxineatami: an interspecifically conserved, but somatically eliminated, element

In some species of hagfish, the phenomenon of chromosome elimination occurs during embryogenesis. However, only two repetitive DNA families are known to be represented in chromosomes that are eliminated from somatic cells of the Japanese hagfish Eptatretus okinoseanus. Using molecular analyses, another germ line-restricted, highly repetitive DNA family has been detected in another Japanese hagfish, Paramyxine atami. The repeat unit of this family, which is 83?bp long, has been designated “EEPa1”, for Eliminated Element of P. atami 1. DNA filter hybridization using EEPa1 as a probe revealed that this family is shared among several species and is conserved in the germline DNA. Although eliminated, repetitive DNA that is shared interspecifically has not been reported in hagfish species, cases of chromatin diminution and chromosome elimination processes have been described previously in other organisms.The patterns and intensities of hybridization signals suggest that members of the repetitive DNA family defined by EEPa1 have undergone concerted molecular evolution.     

X-ray induced rearrangements between germ-line limited and soma chromosomes of Acricotopus lucidus (Diptera,Chironomidae)

The germ-line limited chromosomes (Ks) [K being derived from Keimbahn (Bauer, 1970)] of Acricotopus lucidus were studied in gonial and differential mitosis. After C-banding the soma chromosomes (Ss) are stained only at their centromeric regions whereas the Ks exhibit centromeric, intercalary and terminal heterochromatin. By X-raying sperms it was attempted to transfer K sections on or into Ss in order to bring finally S-linked K sections to polytenization in the salivary glands, and to obtain more knowledge about the structure of Ks. Seven F₁-larvae were detected with K-S-rearrangements: four with insertions of heterochromatic segments, two with insertions of sections with S-homologous banding pattern and one with a translocated K chromosome part, which consists of S-homologous euchromatic sections as well as of an intercalary and a terminal heterochromatic segment. The present results strongly suggest that the Ks of A. lucidus are derived from the Ss by rearrangements and by formation and accumulation of repetitive sequences.     

NTRS, a new family of highly repetitive DNAs specific for the T1 chromosome of tobacco

Species-specific repeated DNAs are important for identifying genomic components of hybrid organisms in plant breeding and in taxonomic studies, and we have previously described the HRS60 and GRS families of highly repetitive DNA sequences in tobacco. Here we describe a new family of highly repetitive DNA sequences termed NTRS (SspI family) that we have isolated from Nicotiana tomentosiformis (Goodspeed) and characterized and that is specific for the genomes of several species of the subgenus Tabacum. In situ hybridization showed that NTRS sequences are present in three pairs of chromosomes of N. tomentosiformis, six pairs of chromosomes of N. kawakamii, and only one pair of chromosomes of N. tabacum at an intercalary site. The NTRS family is not present in the N. otophora genome. The majority of NTRS sequences appeared to be organized in tandem arrays in which local DNA structures sensitive to single strand-specific chemical probes, potassium permanganate, and osmium tetroxide complexed with pyridine revealed a periodicity of 220 bp, equal to the length of the repeat unit. The inner cytosine in CCGG and CC(A/T)GG sequences of the NTRS family is frequently methylated. Cloned and sequenced NTRS monomeric units are 212–219 bp in length and show 83.5%–95% mutual homology. They exhibit properties characteristic for molecules that possess stable intrinsic curvature, but there are differences among individual monomers in the degree of curvature. NTRS sequences like HRS60 and GRS sequences, were found to specify nucleosome positions. Received: 12 November 1996 / in revised form: 12 May 1997 / Accepted: 12 May 1997     

Genome size and determination of DNA content of the X chromosomes, autosomes, and germ line-limited chromosomes of Sciara coprophila

The unique chromosome biology of the fungus fly Sciara coprophila has fascinated investigators for over 80 years. Male meiosis exhibits a monopolar spindle, nonrandom segregation of imprinted chromosomes and nondisjunction of the X chromosome. The unusual mechanism of sex determination requires selective elimination of X chromosomes in embryogenesis. Supernumerary (L) chromosomes are also eliminated from the soma during early cleavage divisions. Distinctive DNA puffs on the larval salivary gland chromosomes are sites of DNA amplification. As a foundation for future genome studies to explore these many unusual phenomena, we have used DNA-Feulgen cytophotometry to determine genome size from hemocyte nuclei of male (X0) and female (XX) larvae and adults. The DNA content of the X chromosome is approximately 0.05 pg DNA and the autosomal complement is approximately 0.45 pg DNA. Measurements of DNA levels for individual sperm from adults showed that the DNA contribution of the germ line-limited (L) chromosomes constitutes as much as 35% of the DNA of the male gamete. A parallel study using Sciara ocellaris, a related species lacking L chromosomes, confirmed the presence of two X chromosomes in the sperm of this species.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Structure and function of Y chromosomal DNA

The sequence organization of four different families of Y chromosomal repetitive DNA is characterized at three levels of spatial extension along the Y chromosome of Drosophila hydei. At the lowest level of resolution, DNA blot analysis of Y chromosomal fragments of different lengths and in situ hybridization experiments on metaphase chromosomes demonstrate the clustering of each particular sequence family within one defined region of the chromosome. At a higher level of resolution, family specific repeats can be detected within these clusters by crosshybridization within 10–20 kb long continuous stretches of cloned DNA in EMBL3 phages. At the highest level of resolution, detailed sequence analysis of representative subclones about 1 kb in length reveals a satellite-like head to tail arrangement of family specific degenerated subrepeats as the building scheme common to all four families. Our results provide the first comparative sequence analysis of three novel families of repetitive DNA on the long arm of the F chromosome of D. hydei. Additional data are presented which support the existence of two related subfamilies of repetitive DNA on the short arm of the Y chromosome.     

Characterization of a family of repetitive sequences that is eliminated late during macronuclear development of the hypotrichous ciliate Stylonychia lemnae

A repetitive element from the hypotrichous ciliate Stylonychia lemnae was characterized by restriction and hybridization analysis. This repetitive element is present in about 5,000–7,000 copies per haploid genome in the micronucleus and the macronuclear anlagen. Its DNA sequence is very conserved, but the length of the repetitive sequence blocs is variable. In some cases, it is associated with telomeric sequences and macronucleus–homologous sequences. Restriction analysis of genomic micronuclear and macronuclear anlagen DNA and in situ hybridization showed that the repetitive sequences are amplified during the formation of polytene chromosomes. They are localized in many bands of the polytene chromosomes and are eliminated during the degradation of the polytene chromosomes. Possible functions of the repetitive sequences during macronuclear differentiation are discussed. Dev. Genet. 21:201–211, 1997.© 1997 Wiley-Liss, Inc.     

Chromosome-specific alpha satellite DNA: nucleotide sequence analysis of the 2.0 kilobasepair repeat from the human X chromosome.

The pericentromeric region of the human X chromosome is characterized by a tandemly repeated family of 2.0 kilobasepair (kb) DNA fragments, initially revealed by cleavage of human DNA with the restriction enzyme BamHI. We report here the complete nucleotide sequence of a cloned member of the repeat family and establish that this X-linked DNA family consists entirely of alpha satellite DNA. Our data indicate that the 2.0 kb repeat consists of twelve alpha satellite monomers arranged in imperfect, direct repeats. Each of the alpha X monomers is approximately 171 basepairs (bp) in length and is 60-75% identical in sequence to previously described primate alpha satellite DNAs. The twelve alpha X monomers are 65-85% identical in sequence to each other and are organized as two adjacent, related blocks of five monomers, plus an additional two monomers also related to monomers within the pentamer blocks. Partial nucleotide sequence of a second, independent copy of the 2.0 kb BamHI fragment established that the 2.0 kb repeat is, in fact, the unit of amplification on the X. Comparison of the sequences of the twelve alpha X monomers allowed derivation of a 171 bp consensus sequence for alpha satellite DNA on the human X chromosome. These sequence data, combined with the results of filter hybridization experiments of total human DNA and X chromosome DNA, using subregions within the 2.0 kb repeat as probes, provide strong support for the hypothesis that individual human chromosomes are characterized by different alpha satellite families, defined both by restriction enzyme periodicity and by chromosome-specific primary sequence.     

A novel source of highly specific chromosome painting probes for human karyotype analysis derived from primate homologues

We have established a series of highly specific painting probes for human acrocentric chromosomes. These chromosomes are involved in the formation of the nucleolar organizer region (NOR) and show DNA sequence homologies within their pericentric heterochromatin. To date, these chromosomes have shown considerable cross hybridization in chromosome painting experiments. Our probe set has been established from primate homologues that are not involved in the NOR in that particular species or from species in which highly repetitive sequences have undergone rapid sequence divergence. The new painting probes should be of particular value for automated microscopy, for which highly specific signals are required as they are recorded at low magnification, e.g. when scoring chromosome 21 domains in interphase nuclei. Received: 22 May 1997 / Accepted: 16 June 1997     

Origin and molecular structure of a midget chromosome in a common wheat carrying rye cytoplasm

The origin and molecular structure of the midget chromosome that is retained in a common wheat with rye cytoplasm, were studied by using fluorescent in situ hybridization (FISH). FISH with biotinylated rye genomic DNA as a probe clearly showed that the midget chromosome had originated from certain part(s) of rye chromosome(s). The midget chromosome did not possess sequences similar to wheat rDNA nor to a rye telomeric sequence with a 350 bp repeat unit. However, another repetitive sequence (120 bp family) of rye was found to occur at one end of the midget chromosome. The telomeric repeat sequences from Arabidopsis thaliana cross-hybridized to both ends of the midget chromosome as well as to wheat chromosomes. From the results obtained in this and previous studies, it is assumed that the midget chromosome originated from part of a rye chromosome, most likely the centromeric region of chromosome 1R, and that the telomeric sequences were synthesized de novo.by R. Appels     

Germ line-restricted,highly repeated DNA sequences and their chromosomal localization in a Japanese hagfish (Eptatretus okinoseanus)

The various species of Japanese hagfish, namely, Eptatretus okinoseanus (types A and B), Eptatretus burgeri and Myxine garmani, are known to eliminate a fraction of their chromosomes during early embryogenesis. High molecular weight DNA from germ line cells and somatic cells of these hagfish species was isolated and digested with different restriction enzymes. The DNA fragments were separated by agarose gel electrophoresis. Digestion with BamHI and DraI generated two weak bands and one weak band, respectively, that were estimated to be about 90, and 180 bp and about 90 bp long and were limited to the germ line DNA in both types of E. okinoseanus. DNA filter hybridization experiments showed that the two BamHI fragments and the one DraI fragment were present almost exclusively in the germ line DNA of E. okinoseanus. Thus, these DNA fragments appear to be eliminated during embryogenesis. Moreover, evidence was obtained that these fragments are highly and tandemly repeated. Molecular cloning and sequence analysis revealed that the BamHI fragments are mainly composed of a family of closely related sequences that are 95 bp long (EEEo1, for Eliminated Element of E. okinoseanus 1), and the DraI fragment is composed of another family of closely related sequences that are 85 bp long (EEEo2). The two DNA families account for about 19% of the total eliminated DNA in E. okinoseanus type A. Fluorescence in situ hybridization experiments demonstrated that the two families of DNA are located on several C-band-positive, small chromosomes that are limited to germ cells in both types of E. okinoseanus.by W. Hennig     

Satellite DNA properties of the germ line limited DNA and the organization of the somatic genomes in the nematodesAscaris suum andParascaris equorum

During the early cleavage divisions in some Ascarids, parts of the chromosomes are eliminated from the somatic blastomeres (chromatin diminution, Boveri, 1887) while the chromosomes in the germ line cells maintain their integrity. To characterize the germ line and soma genome, DNA was isolated from gametes and embryonic somatic cells of two Ascarid species,Parascaris equorum var. univalens andAscaris suum. It was shown that the germ line limited DNAs of these species have the same density and almost identical reassociation kinetics: in CsCl the predominant component of the germ line limited DNA ofP. equorum andA. suum has the buoyant density of 1.697g/cm³, while soma DNA of both species bands at 1.700 g/cm³. InP. equorum there is a small additional germ line limited satellite DNA component with the density of 1.690 g/cm³, identical to that of mitochondrial DNA of both organisms. Comparison of the reassociation kinetics of germ line and soma DNA demonstrates for both species that the eliminated DNA sequences are highly repetitive. In contrast to these similarities between the germ line limited DNAs ofP. equorum andA. suum the analysis of their base composition revealed differences (40% guanine plus cytosine inP. equorum and 36% inA. suum). The only very fast reassociating DNA sequences which we could isolate from soma DNA was demonstrated to be foldback DNA. The reassociation kinetics of totalA. suum soma DNA was investigated by hydroxylapatite chromatography. Least squares analysis of the data revealed about 10% of intermediate repetitive DNA sequences. Their interspersion between single copy DNA sequences was analyzed by comparing the reassociation kinetics of DNA fragments 0.35 and 7.2 kilobases long. Thus the DNA sequence arrangement ofAscaris does not follow the short period interspersion pattern observed in most organism.