Nucleotide sequence of the 2,3-dihydroxybiphenyl dioxygenase gene of Pseudomonas pseudoalcaligenes.

2,3-Dihydroxybiphenyl dioxygenase, which catalyzes ring metacleavage of 2,3-dihydroxybiphenyl, is encoded by the bphC gene of Pseudomonas pseudoalcaligenes KF707 (K. Furukawa and T. Miyazaki, J. Bacteriol. 166:392-398, 1986). We determined the nucleotide sequence of a DNA fragment of 2,040 base pairs which included the bphC gene. The fragment included one open reading frame of 912 base pairs to accommodate the enzyme. The predicted processed amino acid sequence of the enzyme subunit consisted of 302 residues, and its 12 NH2-terminal residues were in perfect agreement with those determined for the enzyme. Approximately 10 base pairs upstream from the initiation codon for 2,3-dihydroxybiphenyl dioxygenase, there was a base sequence complementary to the 3' end of the 16S rRNA from Pseudomonas aeruginosa. There was no promoterlike sequence in the region upstream of the bphC gene, but another long open reading frame was present. A putative bphD gene encoding a metacleavage compound-hydrolyzing enzyme was suggested in the region downstream of the bphC gene.     

Nucleotide sequence analysis of the Pseudomonas putida PpG7 salicylate hydroxylase gene (nahG) and its 3'-flanking region

Gene nahG of naphthalene/salicylate catabolic plasmid NAH7 encodes a protein of molecular weight 45,000, salicylate hydroxylase. This enzyme catalyzes the formation of catechol from salicylate, a key intermediate in naphthalene catabolism. DNA sequence analysis of the 3.1-kilobase HindIII fragment containing the nahG locus reveals an open reading frame (ORF) of 1305 base pairs that corresponds to a protein of 434 amino acid residues. The predicted amino acid sequence of salicylate hydroxylase is in agreement with the molecular weight, NH2-terminal amino acid sequence, and total amino acid composition of the purified salicylate hydroxylase [You, I.-S., Murray, R. I., Jollie, D., & Gunsalus, I. C. (1990) Biochem. Biophys. Res. Commun. 169, 1049-1054]. The amino acid sequence between positions 8 and 37 of salicylate hydroxylase shows homology with known ADP binding sites of other FAD-containing oxidoreductases, thus confirming its biochemical function. The sequence of the Pseudomonas putida salicylate hydroxylase was compared with those of other similar flavoproteins. A small DNA segment (831 base pairs) disrupts the continuity of the known gene order nahG and nahH, the latter encoding catechol 2,3-dioxygenase. The complete nucleotide sequence of the intergenic region spanning genes nahG and nahH has been determined and its biological role proposed.     

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.     

DNA sequence of the gene coding for Escherichia coli ribonuclease H

The gene for Escherichia coli ribonuclease H has been studied by use of a plasmid which contains a segment of the E. coli chromosome. The genomic DNA was subcloned from pLC28-22 to pBR322 by use of various restriction enzymes. Such subcloning limited the RNase H gene to a piece of DNA no longer than 760 base pairs. Cells bearing plasmids containing the RNase H gene produce as much as 10-15 times the normal amount of RNase H without any drastic effect on maintenance of the plasmid or cell growth. DNA sequence analysis has permitted the prediction of a protein whose molecular weight is 17,559 (155 amino acid residues). The predicted sequence was confirmed by amino acid analysis, NH2-terminal amino acid sequence, and size determination of highly purified RNase H.     

The cloning and DNA sequence of the gene xylE for xylose-proton symport in Escherichia coli K12

The gene xylE, coding for xylose-proton symport in Escherichia coli, was cloned and its DNA sequence determined. The cloning strategy utilized lambda placMu insertions and exploited the proximity of xylE to malB. A 2.8-kilobase HincII fragment of cloned DNA restored [14C]xylose transport and xylose-proton symport activities to a xylose transport-negative strain. The xylE gene was identified as a 1473-base pair open reading frame, located 373 base pairs downstream of malG, encoding a hydrophobic protein of Mr 53,607. The amino acid sequence of XylE bore little resemblance to the lactose-proton LacY symporter or melibiose-sodium MelB symporter, but a high degree of homology was found with the arabinose-proton AraE symporter of E. coli and glucose transport proteins of mammals. Structural analyses and comparisons suggest that 12 membrane-spanning segments may occur in the XylE protein.     

Nucleotide sequence and expression of clcD, a plasmid-borne dienelactone hydrolase gene from Pseudomonas sp. strain B13.

The clcD structural gene encodes dienelactone hydrolase (EC 3.1.1.45), an enzyme that catalyzes the conversion of dienelactones to maleylacetate. The gene is part of the clc gene cluster involved in the utilization of chlorocatechol and is carried on a 4.3-kilobase-pair BglII fragment subcloned from the Pseudomonas degradative plasmid pAC27. A 1.9-kilobase-pair PstI-EcoRI segment subcloned from the BglII fragment was shown to carry the clcD gene, which was expressed inducibly under the tac promoter at levels similar to those found in 3-chlorobenzoate-grown Pseudomonas cells carrying the plasmid pAC27. In this study, we present the complete nucleotide sequence of the clcD gene and the amino acid sequence of dienelactone hydrolase deduced from the DNA sequence. The NH2-terminal amino acid sequence encoded by the clcD gene from plasmid pAC27 corresponds to a 33-residue sequence established for dienelactone hydrolase encoded by the Pseudomonas sp. strain B13 plasmid pWR1. A possible relationship between the clcD gene and pcaD, a Pseudomonas putida chromosomal gene encoding enol-lactone hydrolase (EC 3.1.1.24) is suggested by the fact that the gene products contain an apparently conserved pentapeptide neighboring a cysteinyl side chain that presumably lies at or near the active sites; the cysteinyl residue occupies position 60 in the predicted amino acid sequence of dienelactone hydrolase.     

Molecular cloning and nucleotide sequence of a pectin lyase gene from Pseudomonas marginalis N6301.

A pectin lyase (PNL;EC4.2.2.10) gene of Pseudomonas marginalis N6301 was cloned and expressed in Escherichia coli. We purified PNL from P. marginalis N6301 and determined N-terminal 33 amino acids sequence. From this sequence, we synthesized two oligonucleotide probes. From the analysis of Southern hybridization, 2. 1kb EcoRI-SmaI fragment from the chromosomal DNA of P. marginalis was found to hybridize with oligonucleotide probes. Then, we cloned the fragment into pUC119 vector and transformed into E. coli DH5 alpha. A plasmid thus obtained was designated as pPNL6301. E. coli DH5 alpha harboring pPNL6301 expressed PNL activity. The nucleotide sequence of pn1 gene in the plasmid pPNL6301 encoding PNL from P. marginalis N6301 was determined. The structural gene of pn1 consisted of 936 base pairs. An open reading frame that encodes a 34,103 dalton polypeptide composed of 312 amino acids was assigned. The molecular weight of the polypeptide predicted from the amino acid composition was close to that of PNL of P. marginalis N6301 determined. The nucleotide sequence of the 5'-flanking region of pn1 gene showed the presence of the consensus sequence of LexA binding site, Pribnow box and ribosome binding site as found in Escherichia coli. The amino acid sequence homology of PNLs and nucleotide sequence homology of pn1 gene between P. marginalis N6301 and E. carotovora Er were 60.8% and 57.2%, respectively.     

Structure of Escherichia coli dnaC. Identification of a cysteine residue possibly involved in association with dnaB protein

The nucleotide sequence of the Escherichia coli dnaC gene and the primary structure of the dnaC protein were determined. The NH2-terminal amino acid sequence of the dnaC protein matched that predicted from the nucleotide sequence of the 735-base pair coding region. The dnaC gene lacks characteristic promoter structures; neither the "Pribnow box" nor the "-35 sequence" was detected within 222 base pairs upstream from the initiator ATG codon. There is, however, a typical Shine-Dalgarno sequence 7-10 base pairs before the ATG codon. An upstream open reading frame, separated by just 2 base pairs from the coding region of dnaC, encodes the COOH-terminal half of the dnaT product (protein i; Masai, H., Bond, M. W., and Arai, K. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1256-1260). The dnaC protein contains 245 amino acids with a calculated molecular weight of 27,894 consistent with the observed value (29,000). Similar to dnaG and dnaT, dnaC uses several minor codons; the significance of these minor codons to the low level expression of the protein product in E. coli cells remains to be determined. The in vitro site-directed mutagenesis method was employed to determine the functional region involved in interaction with dnaB protein. The first cysteine residue located in the NH2-terminal region of the dnaC protein (Cys69) was shown to be important for this activity. Overall sequence homology between dnaC protein and lambda P protein, functionally analogous to the dnaC protein in the lambda phage DNA replication, is not extensive. There are, however, several short stretches of homologous regions including the NH2-terminal eight amino acids and the Cys78 region of dnaC protein.     

DNA sequence of the E. coli trpR gene and prediction of the amino acid sequence of Trp repressor.

A DNA sequence of 1041 base pairs from a BamHI fragment containing the E. coli trpR gene has been determined. With this sequence and other experimental evidence, the primary structure (88 amino acids) of the Trp repressor can be predicted. Additional features of the DNA sequences include a 22 base pair region upstream from the proposed structural gene which exhibits striking homology with the trp operator, thus implying that expression of the trpR gene may be under autogenous regulation.     

Cloning of the Bacillus subtilis glutamine phosphoribosylpyrophosphate amidotransferase gene in Escherichia coli. Nucleotide sequence determination and properties of the plasmid-encoded enzyme

The Bacillus subtilis gene encoding glutamine phosphoribosylpyrophosphate amidotransferase (amidophosphoribosyltransferase) was cloned in pBR322. This gene is designated purF by analogy with the corresponding gene in Escherichia coli. B. subtilis purF was expressed in E. coli from a plasmid promoter. The plasmid-encoded enzyme was functional in vivo and complemented an E. coli purF mutant strain. The nucleotide sequence of a 1651-base pair B. subtilis DNA fragment was determined, thus localizing the 1428-base pair structural gene. A primary translation product of 476 amino acid residues was deduced from the DNA sequence. Comparison with the previously determined NH2-terminal amino acid sequence indicates that 11 residues are proteolytically removed from the NH2 terminus, leaving a protein chain of 465 residues having an NH2-terminal active site cysteine residue. Plasmid-encoded B. subtilis amidophosphoribosyltransferase was purified from E. coli cells and compared to the enzymes from B. subtilis and E. coli. The plasmid-encoded enzyme was similar in properties to amidophosphoribosyltransferase obtained from B. subtilis. Enzyme specific activity, immunological reactivity, in vitro lability to O2, Fe-S content, and NH2-terminal processing were virtually identical with amidophosphoribosyltransferase purified from B. subtilis. Thus E. coli correctly processed the NH2 terminus and assembled [4Fe-4S] centers in B. subtilis amidophosphoribosyltransferase although it does not perform these maturation steps on its own enzyme. Amino acid sequence comparison indicates that the B. subtilis and E. coli enzymes are homologous. Catalytic and regulatory domains were tentatively identified based on comparison with E. coli amidophosphoribosyltransferase and other phosphoribosyltransferase (Argos, P., Hanei, M., Wilson, J., and Kelley, W. (1983) J. Biol. Chem. 258, 6450-6457).     

Molecular cloning, characterization, and nucleotide sequence of an extracellular amylase gene from Aeromonas hydrophila.

The structural gene for excreted amylase from Aeromonas hydrophila JMP636 has been cloned within a 2.1-kilobase SmaI fragment of DNA. The amylase gene is transcribed from its own promoter in Escherichia coli, producing a gene product of Mr 49,000. The amylase gene product is secreted to the periplasm of E. coli; however, it is not excreted. Nucleotide sequencing revealed an open reading frame of 1,392 base pairs corresponding to a protein of 464 amino acid residues. A potential signal peptide of 21 amino acid residues is present at the NH2 terminal of the predicted protein. Three regions of homology with other procaryotic and eucaryotic alpha-amylases were detected within the predicted amino acid sequence.     

Nucleotide sequence of the luxB gene of Vibrio harveyi and the complete amino acid sequence of the beta subunit of bacterial luciferase

The nucleotide sequence of the 1.30-kilobase EcoRI/BglII fragment from Vibrio harveyi carrying the majority of the luciferase beta subunit coding region (luxB gene) has been determined. The EcoRI/BglII fragment was derived from a 4.0-kilobase HindIII fragment carrying both luxA and luxB which was detected in a genomic clone bank based on the expression of bioluminescence from colonies of Escherichia coli carrying V. harveyi HindIII fragments in plasmid pBR322 (Baldwin, T. O., Berends, T., Bunch, T. A., Holzman, T. F., Rausch, S. K., Shamansky, L., Treat, M. L., and Ziegler, M. M. (1984) Biochemistry 23, 3663-3667). The entire alpha subunit coding sequence (luxA gene) and the amino-terminal 13 codons of the beta subunit sequence (luxB gene) were contained on a 1.85-kilobase EcoRI fragment, the sequence of which has been reported (Cohn, D. H., Mileham, A. J., Simon, M. I., Nealson, K. H., Rausch, S. K., Bonam, D., and Baldwin, T. O. (1985) J. Biol. Chem. 260, 6139-6146). The beta subunit coding sequence was found to terminate 972 bases past the start of the luxB coding sequence. The beta subunit had a calculated molecular weight of 36,349 and comprised a total of 324 amino acid residues; the alpha beta dimer had a molecular weight (alpha + beta) of 76,457. There were 27 base pairs separating the stop codon of the beta subunit structural gene and a 340-base open reading frame extending to (and beyond) the distal BglII site. Approximately two-thirds of the beta subunit was sequenced by protein chemical techniques. The amino acid sequence predicted from the DNA sequence, with few exceptions, confirmed the chemically determined sequence, and the measured amino acid composition was in excellent agreement with the composition implied from the DNA sequence.     

Cloning, nucleotide sequence, and expression in Escherichia coli of the Bacillus stearothermophilus peroxidase gene (perA).

The gene encoding a thermostable peroxidase was cloned from the chromosomal DNA of Bacillus stearothermophilus IAM11001 in Escherichia coli. The nucleotide sequence of the 3.1-kilobase EcoRI fragment containing the peroxidase gene (perA) and its flanking region was determined. A 2,193-base-pair open reading frame encoding a peroxidase of 731 amino acid residues (Mr, 82,963) was observed. A Shine-Dalgarno sequence was found 9 base pairs upstream from the translational starting site. The deduced amino acid sequence coincides with those of the amino terminus and four peptides derived from the purified peroxidase of B. stearothermophilus IAM11001. E. coli harboring a recombinant plasmid containing perA produced a large amount of thermostable peroxidase which comigrated on polyacrylamide gel electrophoresis with the B. stearothermophilus peroxidase. The peroxidase of B. stearothermophilus showed 48% homology in the amino acid sequence to the catalase-peroxidase of E. coli.     

Trimethylamine dehydrogenase of bacterium W3A1. Molecular cloning, sequence determination and over-expression of the gene.

The gene encoding trimethylamine dehydrogenase (EC 1.5.99.7) from bacterium W3A1 has been cloned. Using the polymerase chain reaction a 530 bp DNA fragment encoding a distal part of the gene was amplified. Using this fragment of DNA as a probe, a clone was then isolated as a 4.5 kb BamHI fragment and shown to encode residues 34 to 729 of trimethylamine dehydrogenase. The polymerase chain reaction was used also to isolate the DNA encoding the missing N-terminal part of the gene. The complete open reading frame contained 2,190 base pairs coding for the processed protein of 729 amino acids which lacks the N-terminal methionine residue. The high-level expression of the gene in Escherichia coli was achieved by the construction of an expression vector derived from the plasmid pKK223-3. The cloning and sequence analysis described here complete the partial assignment of the amino acid sequence derived from chemical sequence [1] and will now permit the refinement of the crystallographic structure of trimethylamine dehydrogenase and also a detailed investigation of the mechanism and properties of the enzyme by protein engineering.     

Nucleotide sequence and expression of the catechol 2,3-dioxygenase-encoding gene of phenol-catabolizing Pseudomonas CF600

Pseudomonas CF600 degrades phenol and some of its methylated derivatives via a plasmid-encoded catabolic pathway. The catechol 2,3-dioxygenase (C23O) enzyme of this pathway catalyses the conversion of catechol to 2-hydroxymuconic semialdehyde. We have determined the nucleotide (nt) sequence of the dmpB structural gene for this enzyme, and expressed and identified its polypeptide product in Escherichia coli. The xylE gene of TOL plasmid pWWO and the nahH gene of plasmid NAH7 encode analogous C23O enzymes. Comparison of these three genes shows homology of 78-81% on the nt level and 83-87% homology on the amino acid level.     

Cloning and sequence analysis of the Escherichia coli metH gene encoding cobalamin-dependent methionine synthase and isolation of a tryptic fragment containing the cobalamin-binding domain

A gene encoding cobalamin-dependent methionine synthase (EC 2.1.1.13) has been isolated from a plasmid library of Escherichia coli K-12 DNA by complementation to methionine prototrophy in an E. coli strain lacking both cobalamin-dependent and -independent methionine synthase activities (RK4536:metE, metHH). Maxicell expression of a series of plasmids containing deletions in the metH structural gene was employed to map the position and orientation of the gene on the cloned DNA fragment. A 6.3-kilobase EcoRI-SalI fragment containing the gene was cloned into the sequencing vector pGEM3B for double-stranded DNA sequencing; the MetH coding region consists of 3372 nucleotides. The enzyme was purified from an overproducing strain of E. coli harboring the recombinant plasmid, in which the level of methionine synthase was elevated 30- to 40-fold over wild-type E. coli. Recombinant enzyme is a protein of 123,640 molecular weight and has a turnover number of 1,450 min-1 in the standard assay. These values are to be compared with previously reported values of 133,000 for the molecular weight and 1,240-1,560 min-1 for the turnover number of the homogenous enzyme purified from a wild-type strain of E. coli B (Frasca, V., Banerjee, R. V., Dunham, W. R., Sands, R. H., and Matthews, R. G. (1988) Biochemistry 27, 8458-8465). Limited proteolysis of the native enzyme with trypsin resulted in loss of enzyme activity but retention of bound cobalamin on a peptide fragment of 28,000 molecular weight. This fragment has been shown to extend from residue 643 to residue 900 of the 1124-residue deduced amino acid sequence.     

Sequences of Escherichia coli uvrA gene and protein reveal two potential ATP binding sites

We have determined the nucleotide sequence of the uvrA gene of Escherichia coli. The coding region of the gene is 2820 base pairs which specifies a protein of 940 amino acids and Mr = 103,874. The polypeptide sequence predicted from the DNA sequence was confirmed by analyzing the UvrA protein: the sequence of the first 7 NH2-terminal amino acids as well as the amino acid composition of the pure protein agreed with those predicted from the nucleotide sequence. By comparing the sequence of UvrA protein to the amino acid sequences of other ATPases, we found that two regions in the UvrA protein, separated from one another by about 600 amino acids, have the highly conserved G-X4-GKT(S)-X6-I(V) sequence found at the active sites of many, but not all, ATPases. Our findings suggest that UvrA protein may have two ATP binding sites.