Probable involvement of 3'-terminal segment of 18S rRNA in translation initiation of uncapped mRNAs in plants

A possibility of involvement of 3'-terminal 18S rRNA segment in the cap-independent initiation of translation on plant ribosomes was studied. It was shown that 3-terminal segment (nucleotides 1777-1811) of 18S rRNA including the last hairpin 45 is accessible for complementary interactions in 40S ribosomal subunits. Oligonucleotides complementary to this segment of rRNA when added to wheat germ cell-free protein synthesizing system were found to specifically inhibit translation of uncapped reporter mRNA coding for beta-glucuronidase, which bears in the 5'-untranslated region (UTR) a leader sequence of potato virus Y (PVY) genomic RNA possessing fragments complementary to the region 1777-1811. It was shown that a sequence corresponding to nucleotides 291-316 of PVY, which is complementary to a major portion of the 3-terminal 18S rRNA segment 1777-1808, when placed into 5'-UTR, is able to enhance translational efficiency of the reporter mRNAs. The results obtained suggest that complementary interactions between mRNA 5'-UTR and 18S rRNA 3'-terminal segment can take place in the course of cap-independent translation initiation.     

Identification of the nucleotide sequences involved in the interaction between Escherichia coli 5 RNA and specific 50 S subunit proteins

Pancreatic RNase partial digests of ³²P-labelled 5 S RNA-protein complexes have been fractionated by electrophoresis on polyacrylamide gels. Specific fragments of the 5 S RNA molecule have been recovered from electrophoresis bands containing polynucleotide-protein complexes. These digestion-resistant complexes are only found if RNase treatment is carried out in the presence of at least one of the two 50 S subunit proteins L18 and L25, which are able to bind to 5 S RNA individually and specifically. The sequences of the isolated fragments have been determined. From the results, it can be concluded that sequence 69 to 120 and, possibly, sequence 1 to 11, are involved in the 5 S RNA-protein interactions which are responsible for the insertion of 5 S RNA in the 50 S subunit structure. Sequence 12 to 68, on the other hand, has no strong interactions with proteins L18 and L25. Each protein certainly binds to several nucleotide residues, which are not contiguous in the primary structure. In particular, good experimental evidence has been obtained in favour of the binding of protein L25 to two distant regions of the 5 S RNA molecule, which must have a bihelical secondary structure. The importance of the 5 S RNA conformation for its proper insertion in the 50 S subunit is thus confirmed.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.     

Binding of ribosomes to the 5' leader sequence (N = 258) of RNA 3 from alfalfa mosaic virus.

RNA 3 of alfalfa mosaic virus (AlMV) contains information for two genes: near the 5' end an active gene coding for a 35 Kd protein and, near the 3' end, a silent gene coding for viral coat protein. We have determined a sequence of 318 nucleotides which contains the potential initiation codon for the 35 Kd protein at 258 nucleotides from the 5' end. This long leader sequence can form initiation complexes containing three 80 S ribosomes. A shorter species of RNA, corresponding to a molecule of RNA 3 lacking the cap and the first 154 nucleotides (RNA 3') has been isolated. The remaining leader sequence of 104 nucleotides in RNA 3' forms a single 80 S initiation complex with wheat germ ribosomes. The location of the regions of the leader sequence of RNA 3 involved in initiation complex formation with 80 S ribosomes is reported.     

RNA-protein interactions of stored 5S RNA with TFIIIA and ribosomal protein L5 during Xenopus oogenesis

We studied the pathway of 5S RNA during oogenesis in Xenopus laevis from its storage in the cytoplasm to accumulation in the nucleus, the sequence requirements for the 5S RNA to follow that pathway, and the 5S RNA-protein interactions that occur during the mobilization of stored 5S RNA for assembly into ribosomes. In situ hybridization to sections of oocytes indicates that 5S RNA first becomes associated with the amplified nucleoli during vitellogenesis when the nucleoli are activity synthesizing ribosomal RNA and assembling ribosomes. When labeled 5S RNA is microinjected into the cytoplasm of stage V oocytes, it migrates into the nucleus, whether microinjected naked or complexed with the protein TFIIIA as a 7S RNP storage particle. During vitellogenesis, a nonribosome bound pool of 5S RNA complexed with ribosomal protein L5 (5S RNPs) is formed, which is present throughout the remainder of oogenesis. Immunoprecipitation assays on homogenates of microinjected oocytes showed that labeled 5S RNA can become complexed either with L5 or with TFIIIA. Nucleotides 11 through 108 of the 5S RNA molecule provide the necessary sequence and conformational information required for the formation of immunologically detectable complexes with TFIIIA or L5 and for nuclear accumulation. Furthermore, labeled 5S RNA from microinjected 7S RNPs can subsequently become associated with L5. Such labeled 5S RNA is found in both 5S RNPs and 7S RNPs in the cytoplasm, but only in 5S RNPs in the nucleus of microinjected oocytes. These data suggest that during oogenesis a major pathway for incorporation of 5S RNA into nascent ribosomes involves the migration of 5S RNA from the nucleus to the cytoplasm for storage in an RNP complex with TFIIIA, exchange of that protein association for binding with ribosomal protein L5, and a return to the nucleus for incorporation into ribosomes as they are being assembled in the amplified nucleoli.     

7 S RNA: A single site substrate for the RNA processing enzyme ribonuclease E of Escherichia coli

7 S RNA accumulates at non-permissive temperatures in an RNAase E strain containing the recombinant plasmid pJR3Δ which carries a single 5 S rRNA gene and expression sequences. 7 S RNA is a processing intermediate that contains the complete sequence of 5 S rRNA as well as a stem-and-loop structure encoded by the terminator of rrnD. 7 S RNA can be processed in vitro by RNAase E. Structural analysis of the products (5 S rRNA and the stem) of in vitro processing of 7 S RNA revealed that the cleavage site of RNAase E in 7 S RNA is 3 nucleotides downstream from the 3′ end of the mature 5 S rRNA. The cleavage generates 3′-hydroxyl and 5′-phosphate termini.     

Unusual structural features of the 5S ribosomal RNA from Streptococcus cremoris

The nucleotide sequence of the 5S ribosomal RNA of Streptococcus cremoris has been determined. The sequence is 5' (sequence in text) 3'. Comparison of the S. cremoris 5S RNA sequence to an updated prokaryotic generalized 5S RNA structural model shows that this 5S RNA contains some unusual structural features. These features result largely from uncommon base substitutions in helices I, II and IV. Some of these unusual structural features are shared by several of the known 5S RNA sequences from mycoplasmas. However, the characteristic bloc of deletions found in helix V of these mycoplasma 5S RNAs is not present in the 5S RNA of S. cremoris.     

Extensions of the known sequences at the 3'' and 5'' ends of 23S ribosomal RNA from Escherichia coli, possible base pairing between these 23S RNA regions and 16S ribosomal RNA.

Extensions of the known sequences at both 3' and 5' ends of 23S ribosomal RNA are presented: The 5' terminal is pG-G-U-U-A-A-G-Cp or pG-G-U... G-U-U-A-A-G-Cp, with a very short sequence between Up and Gp and the 3'terminal is G-A-A-C-C-G-A-(G)-G-C-U-U-A-A-C-C-U-UOH. These two terminal regions exhibit a high degree of complementarity. In addition, extensive complementarities are also found between the 5'terminal sequence of 23S RNA and a sequence contained in section A of the 16S ribosomal RNA, and between the 3'terminal sequence of 23S RNA and sequences in sections O and J in the 16S RNA. The degree of complementarity between the two extremities of 23S RNA, and between these extremities and regions of the 16S RNA, is far greater than would be expected on a random basis suggesting a possible involvement of this base-pairing in the functioning of ribosomes. This possibility is discussed.     

The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.     

Sequence and structural conservation in RNA ribose zippers

The "ribose zipper", an important element of RNA tertiary structure, is characterized by consecutive hydrogen-bonding interactions between ribose 2'-hydroxyls from different regions of an RNA chain or between RNA chains. These tertiary contacts have previously been observed to also involve base-backbone and base-base interactions (A-minor type). We searched for ribose zipper tertiary interactions in the crystal structures of the large ribosomal subunit RNAs of Haloarcula marismortui and Deinococcus radiodurans, and the small ribosomal subunit RNA of Thermus thermophilus and identified a total of 97 ribose zippers. Of these, 20 were found in T. thermophilus 16 S rRNA, 44 in H. marismortui 23 S rRNA (plus 2 bridging 5 S and 23 S rRNAs) and 30 in D. radiodurans 23 S rRNA (plus 1 bridging 5 S and 23 S rRNAs). These were analyzed in terms of sequence conservation, structural conservation and stability, location in secondary structure, and phylogenetic conservation. Eleven types of ribose zippers were defined based on ribose-base interactions. Of these 11, seven were observed in the ribosomal RNAs. The most common of these is the canonical ribose zipper, originally observed in the P4-P6 group I intron fragment. All ribose zippers were formed by antiparallel chain interactions and only a single example extended beyond two residues, forming an overlapping ribose zipper of three consecutive residues near the small subunit A-site. Almost all ribose zippers link stem (Watson-Crick duplex) or stem-like (base-paired), with loop (external, internal, or junction) chain segments. About two-thirds of the observed ribose zippers interact with ribosomal proteins. Most of these ribosomal proteins bridge the ribose zipper chain segments with basic amino acid residues hydrogen bonding to the RNA backbone. Proteins involved in crucial ribosome function and in early stages of ribosomal assembly also stabilize ribose zipper interactions. All ribose zippers show strong sequence conservation both within these three ribosomal RNA structures and in a large database of aligned prokaryotic sequences. The physical basis of the sequence conservation is stacked base triples formed between consecutive base-pairs on the stem or stem-like segment with bases (often adenines) from the loop-side segment. These triples have previously been characterized as Type I and Type II A-minor motifs and are stabilized by base-base and base-ribose hydrogen bonds. The sequence and structure conservation of ribose zippers can be directly used in tertiary structure prediction and may have applications in molecular modeling and design.     

Evidence for processivity and two-step binding of the RNA substrate from studies of J1/2 mutants of the Tetrahymena ribozyme.

J1/2 of the Tetrahymena ribozyme, a sequence of three A residues, connects the RNA-binding site to the catalytic core. Addition or deletion of bases from J1/2 improves turnover and substrate specificity in the site-specific endonuclease reaction catalyzed by this ribozyme: G2CCCUCUA5 (S) + G in-equilibrium G2CCCUCU (P) + GA5. These paradoxical enhancements are caused by decreased affinity of the ribozyme for S and P [Young, B., Herschlag, D., & Cech, T.R. (1991) Cell 67, 1007]. An additional property of these mutant ribozymes, decreased fidelity of RNA cleavage, is now analyzed. (Fidelity is the ability to cleave at the correct phosphodiester bond within a particular RNA substrate.) Introduction of deoxy residues to give "chimeric" ribo/deoxyribooligonucleotides changes the positions of incorrect cleavage. Previous work indicated that S is bound to the ribozyme by both base pairing and teritary interactions involving 2'-hydroxyl groups of S. The data herein strongly suggest that the P1 duplex, which consists of S base-paired with the 5' exon binding site of the ribozyme, can dock into tertiary interactions in different registers; different 2'-hydroxyl groups of S plug into tertiary contacts with the ribozyme in the different registers. It is concluded that the mutations decrease fidelity by increasing the probability of docking out of register relative to docking in the normal register, thereby giving cleavage at different positions along S. These data also show that the contribution of J1/2 to the teritiary interactions is indirect, not direct. Thus, a structural role of the nonconserved J1/2 is indicated: this sequence positions S to optimize tertiary binding interactions and to ensure cleavage at the phosphodiester bond corresponding to the 5' splice site. Substitution of sulfur for the nonbridging pro-RP oxygen atom at the normal cleavage site has no effect on (kcat/Km)S but decreases the fraction of cleavage at the normal site in reactions catalyzed by the -3A mutant ribozyme, which has all three A residues of J1/2 removed. Thus, the ribozyme chooses where to cleave S after rate-limiting binding of S, indicating that docking can change after binding and suggesting that the ribozyme could act processively. Indeed, it is shown that the +2A ribozyme cleaves at one position along an RNA substrate and then, before releasing that RNA product, cleaves it again.(ABSTRACT TRUNCATED AT 400 WORDS)     

Evidence for tertiary structural RNA-RNA interactions within the protein S4 binding site at the 5''-end of 16S ribosomal RNA of Escherichia coli.+.

Evidence is presented for tertiary structural interaction(s) (interactions(s) between two regions of an RNA molecule that are widely separated in the RNA sequence) within the 5'-one third of the 16S ribosomal RNA of Escherichia coli that constitutes the binding site of protein S4. The two main interacting RNA regions were separated by about 120 nucleotides (sections Q to M) of the 16S RNA sequence. A second, smaller gap, of 13 nucleotides, occurred within section C". The two main interacting regions contain about 150 nucleotides (sections H" to Q) and 160 nucleotides (sections M to C"). They are folded back on one another and, especially in the presence of protein S4, are strongly protected against ribonuclease digestion. The intermediate region (sections Q to M), however, is relatively accessible to ribonucleases in the S4-RNP. By partial removal of subfragments from the RNA complex it was possible to localise the two main interacting sites within sections H" - H and sections I" - C". Three main criteria for the specificity of the RNA-RNA interactions were invoked and satisfied. The possibility of other tertiary structural RNA-RNA interactions occurring in other regions of the 16S RNA is discussed. Finally, all the structural information on the S4-RNP is summarised and a tentative model is proposed.     

Structural features of Bacillus precursor 5S RNA involved in the interaction with RNAase M5.

Mature 5S (m5S) RNA from Bacillus licheniformis specifically and almost completely inhibits in vitro maturation of bacillus precursor 5S (p5S) RNA, showing that the maturation enzyme RNAase M5 can recognize Bacillus m5S RNA. E. coli m5S RNA is a much less efficient inhibitor, whereas S. carlsbergensis 5S RNA inhibits maturation by about 70%. The differences in inhibition can be correlated with the position of the sequence UAGG (residues 101-104 in B. licheniformis m5S RNA) relative to the double-helical region formed by the 5'- and 3'-terminal sequences (molecular stalk) of m5S RNA. Recent experiments by Meyhack and Pace (Biochemistry 17 (1980) 5804-5810) demonstrated this UAGG sequence to be indispensable for processing of p5S RNA. Other elements of secondary and/or tertiary structure are also required, however. The effect of artificially constructed "5S RNA" molecules having defined disturbances in the base-pairing within the molecular stalk on in vitro maturation shows that base-pairing in the immediate neighbourhood of the bonds to be cleaved during maturation is crucial to recognition of p5S RNA by RNAase M5. G.U pairs are tolerated in this region, however, without loss of efficiency in maturation. Base-pairing does not have to extend throughout the complete molecular stalk. The introduction of an A/C combination at the end of the molecular stalk removed from the bonds cleaved by RNAase M5 does not significantly impair the efficiency of maturation.     

The nucleotide sequence at the 5'' end of foot and mouth disease virus RNA.

Foot and mouth disease virus RNA has been treated with RNase H in the presence of oligo (dG) specifically to digest the poly(C) tract which lies near the 5' end of the molecule (10). The short (S) fragment containing the 5' end of the RNA was separated from the remainder of the RNA (L fragment) by gel electrophoresis. RNA ligase mediated labelling of the 3' end of S fragment showed that the RNase H digestion gave rise to molecules that differed only in the number of cytidylic acid residues remaining at their 3' ends and did not leave the unique 3' end necessary for fast sequence analysis. As the 5' end of S fragment prepared form virus RNA is blocked by VPg, S fragment was prepared from virus specific messenger RNA which does not contain this protein. This RNA was labelled at the 5' end using polynucleotide kinase and the sequence of 70 nucleotides at the 5' end determined by partial enzyme digestion sequencing on polyacrylamide gels. Some of this sequence was confirmed from an analysis of the oligonucleotides derived by RNase T1 digestion of S fragment. The sequence obtained indicates that there is a stable hairpin loop at the 5' terminus of the RNA before an initiation codon 33 nucleotides from the 5' end. In addition, the RNase T1 analysis suggests that there are short repeated sequences in S fragment and that an eleven nucleotide inverted complementary repeat of a sequence near the 3' end of the RNA is present at the junction of S fragment and the poly(C) tract.     

Detecting the coevolution of biosequences--an example of RNA interaction prediction

A probabilistic graphical model is proposed in order to detect the coevolution between different sites in biological sequences. The model extends the continuous-time Markov process of sequence substitution for single nucleic or amino acids and imposes general constraints regarding simultaneous changes on the substitution rate matrix. Given a multiple sequence alignment for each molecule of interest and a phylogenetic tree, the model can predict potential interactions within or between nucleic acids and proteins. Initial validation of the model is carried out using tRNA and 16S rRNA sequence data. The model accurately identifies the secondary interactions of tRNA as well as several known tertiary interactions. In addition, results on 16S rRNA data indicate this general and simple coevolutionary model outperforms several other parametric and nonparametric methods in predicting secondary interactions. Furthermore, the majority of the putative predictions exhibit either direct contact or proximity of the nucleotide pairs in the 3-dimensional structure of the Thermus thermophilus ribosomal small subunit. The results on RNA data suggest a general model of coevolution might be applied to other types of interactions between protein, DNA, and RNA molecules.     

Characterization of the 7S RNA and its gene from halobacteria.

The 7S RNA is an abundant nonribosomal RNA in H. halobium and other halobacteria. A specific 7S RNA gene probe shows high homology to genomic DNA of all halobacteria tested but not to those of several other archaebacteria, eubacteria and eukaryotes. All halobacterial genomes seem to carry a single copy of the 7S RNA gene. The coding region of the 7S RNA gene is highly G+C rich whereas the 5'- and 3'-noncoding regions possess a rather low G+C content. An extended double stranded structure for the 7S RNA is deduced from its nucleotide sequence. The 7S RNA of H. halobium (304 nucleotides) resembles in size and structure the 7S-L RNA from mammalian cells and shares with it a sequence homology of about 50% when arranged in a colinear fashion. The similarities in sequence are found particularly at the 3'- and 5'-termini. No similarity was detected between the 7S RNA from H. halobium and the nonribosomal 6S RNA from Escherichia coli.