The nucleotide sequence of 5S rRNA from bovine liver.

We have determined the nucleotide sequence of ribosomal 5S RNA from bovine liver. The comparison of this sequence with those from other eukaryotic sources shows that a common secondary structure model for all eukaryotic 5S rRNAs may exist. Analysis of the evolutionary conserved nucleotides in metazoan 5S rRNAs suggests that the tertiary interactions, proposed earlier for plant 5S rRNA, are also possible.     

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.     

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).     

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).     

5' LTR complete nucleotide sequence of Chinese hamster intracisternal A-particle.

Retrovirus like sequences homologous to mouse IAP are present in Chinese hamster genome (Lueders K.K. and Kuff, E.L., 1981, 1983, Servenay et al., 1990). Murine IAP long terminal repeats (LTRs) can function as effective promoters in different cell types (Horowitz M. et al., 1984, Howe, C.C. et al., 1986). Thus CHO IAP sequences could act as retrotransposons in the cellular genome, and in this way affect the expression of other genes at the target sites. We had sequenced previously a Chinese hamster IAP genomic region corresponding mainly to the gag gene and including 57 nucleotides of U5 5' LTR (Servenay et al., 1988). In this paper, we present the 5' LTR complete nucleotide sequence of the Chinese hamster IAP element and its comparison with those of mouse and Syrian hamster.     

The nucleotide sequence of the 5S ribosomal RNA from a photobacterium

Comparative sequencing studies provide powerful insights into molecular function and evolution. The sequence for 5S ribosomal RNA from Photobacter strain 8265 is eighteen base replacements removed from that of Escherichia coli. Of these, the vast majority involve a G or C becoming an A or U. These variations also define unequivocally a hexanucleotide base paired region, which appears to be a universal feature of the 5S RNA molecule. The base composition of this helix seems to be under rather stringent, and so unusual, energetic constraints. The possible implications of this are discussed - in particular the prospect of a 5S RNA molecule that undergoes conformational transitions as a part of the overall state changes that constitute the function of the ribosome.     

The 5'-terminal sequence of Q 6S RNA

[γ-³²P]GTP-Labeled Qβ 6S RNA yielded only one major radioactive oligonucleotide after digestion with pancreatic ribonuclease. Nearest neighbor analysis of this 5′-oligonucleotide demonstrated that approximately 95% of the molecules terminate with the same sequence, pppGpGpCp. This sequence is the complement of the only major 3′-sequence found in this RNA. Both strands of 6S RNA therefore appear to have identical 3′- and 5′-terminal trinucleotide sequences.     

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. II. The GC-rich region

The primary sequence of the GC-rich half of the repeating unit in X. laevis 5S DNA has been determined in both a single plasmid-cloned repeating unit and in the total population of repeatig units. The GC-rich half of the repeating unit contains a single long duplication of 174 nucleotides. The duplicated segment commences 73 nucleotides preceding the 5' end of the gene and terminates at nucleotide 101 of the gene. The duplicated portion of the gene, termed the pseudogene, differs by 10 nucleotides from the corresponding portion of the gene, and the remaining duplicated sequence of 73 nucleotides differs by 13 nucleotides. The plasmid-cloned repeating unit differs from the dominant sequence in the total population repeating units by 6 nucleotides in the GC-rich region. Evidence is provided that most of the CpG dinucleotides in 5S DNA are at least partially methylated.     

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.     

The 5S ribosomal genes in the Drosophila melanogaster species subgroup. Nucleotide sequence of a 5S unit from Drosophila simulans and Drosophila teissieri

The 5S genes of the eight species of the D. melanogaster subgroup have been mapped. The spacers, in contrast with coding regions, differ markedly between most species. One 5S gene unit has been sequenced for both D. simulans and D. teissieri. The mature 5S RNA region in these two species is identical to the corresponding region of D. melanogaster. Only 5 nucleotide variations occur between the D. melanogaster and D. simulans 5S gene spacers. The spacer in D. teissieri is very different. Only two segments, located one at each side of the coding region, are clearly homologous to corresponding sequences of D. melanogaster and D. simulans.     

The 5'-flanking sequence and regulatory elements of the cystatin S gene.

The gene encoding rat cystatin S (Cys S), a salivary gland-specific secretory protein, has CAAT and TATA boxes upstream of the inititation codon (Cox and Shaw, 1992), and contains regions that resemble those of other hormonally responsive eukaryotic genes. The 5'-flanking sequence of the rat Cys S gene has a potential CREB/AP-1 binding site (Rupp et al., 1990; Trejo et al., 1992), two potential glucocorticoid responsive elements (GREs, Drouin et al., 1989), and a possible GR/PR (glucocorticoid/progesterone) responsive element (Forman and Samuels, 1990). One of these potential GREs is adjacent to a potential AP-2 binding site, and another is typical of the glucocorticoid and progesterone receptor binding site. In this report, we have identified three regions in the 5'-flanking region of the Cys S gene that are found in salivary gland-specific genes (Ting et al., 1992) with a GT-rich region located between conserved elements II and III. Transfection experiments described in this paper suggest that a 281-bp DNA fragment from the Cys S gene promoter region with conserved elements II and III, the GT-rich region, and a possible GR/PR responsive element contains a negative regulatory element. In addition, our experiments suggest that the GT-rich region by itself is acting as a positive regulatory element.     

The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach.

Spinacia oleracia cholorplast 5S ribosomal RNA was end-labeled with [32P] and the complete nucleotide sequence was determined. The sequence is: pUAUUCUGGUGUCCUAGGCGUAGAGGAACCACACCAAUCCAUCCCGAACUUGGUGGUUAAACUCUACUGCGGUGACGAU ACUGUAGGGGAGGUCCUGCGGAAAAAUAGCUCGACGCCAGGAUGOH. This sequence can be fitted to the secondary structural model proposed for prokaryotic 5S ribosomal RNAs by Fox and Woese (1). However, the lengths of several single- and double-stranded regions differ from those common to prokaryotes. The spinach chloroplast 5S ribosomal RNA is homologous to the 5S ribosomal RNA of Lemna chloroplasts with the exception that the spinach RNA is longer by one nucleotide at the 3' end and has a purine base substitution at position 119. The sequence of spinach chloroplast 5S RNA is identical to the chloroplast 5S ribosomal RNA gene of tobacco. Thus the structures of the chloroplast 5S ribosomal RNAs from some of the higher plants appear to be almost totally conserved. This does not appear to be the case for the higher plant cytoplasmic 5S ribosomal RNAs.