The insertion of D-beta-hydroxybutyrate apodehydrogenase into phospholipid monolayers and phospholipid vesicles

The strong interaction of D-beta-hydroxybutyrate dehydrogenase with phospholipid monomolecular films is demonstrated by the surface pressure increase of a film compressed up to 33 mN/m. Although the D-beta-hydroxybutyrate apodehydrogenase was able to penetrate many phospholipid monolayers, it interacted preferentially with negatively charged monolayers such as those made from diphosphatidylglycerol. The weakest interaction was found with phosphatidylcholine, which is the reactivating phospholipid for the enzyme. These interactions were dependent on the phospholipid chain length, ionic strength, and pH. At basic pH the apoenzyme lost its specificity for negatively charged phospholipids, suggesting the deprotonation of a cationic amino acid residue of the enzyme polypeptide chain. The charge effects are in agreement with results obtained using phospholipid vesicles. Beside the electrostatic interactions, the influence of phospholipid chain length and the ionic strength indicate that D-beta-hydroxybutyrate apodehydrogenase penetrates into the hydrophobic part of the lipid interface.     

Interfacial interactions of ceramide with dimyristoylphosphatidylcholine: impact of the N-acyl chain

The mixing behavior of dimyristoylphosphatidylcholine (DMPC) with either N-palmitoyl-sphingosine (C16:0-ceramide) or N-nervonoyl-sphingosine (C24:1-ceramide) was examined using monomolecular films. While DMPC forms highly elastic liquid-expanded monolayers, both neat C16:0-ceramide and C24:1-ceramide yield stable solid condensed monomolecular films with small areas and low interfacial elasticity. Compression isotherms of mixed C16:0-ceramide/DMPC films exhibit an apparent condensation upon increasing X(cer16:0) at all surface pressures. The average area isobars, coupled with the lack of a liquid-expanded to condensed phase transition as X(cer16:0) is increased, are indicative of immiscibility of the lipids at all surface pressures. In contrast, isobars for C24:1-ceramide/DMPC mixtures show surface pressure-dependent apparent condensation or expansion and surface pressure-area isotherms show a composition and surface pressure-dependent phase transition. This suggests miscibility, albeit non-ideal, of C24:1-ceramide and DMPC in both liquid and condensed surface phases. The above could be verified by fluorescence microscopy of the monolayers and measurements of surface potential, which revealed distinctly different domain morphologies and surface potential values for the DMPC/C16:0- and DMPC/C24:1-ceramide monolayers. Taken together, whereas C16:0-ceramide and DMPC form immiscible pseudo-compounds, C24:1-ceramide and DMPC are partially miscible in both the liquid-expanded and condensed phases, and a composition and lateral pressure-dependent two-phase region is evident between the liquid-expanded and condensed regimes. Our results provide novel understanding of the regulation of membrane properties by ceramides and raise the possibility that ceramides with different acyl groups could serve very different functions in cells, relating to their different physicochemical properties.     

Metastability of a supercompressed fluid monolayer

Previous studies showed that monomolecular films of extracted calf surfactant collapse at the equilibrium spreading pressure during quasi-static compressions but become metastable at much higher surface pressures when compressed faster than a threshold rate. To determine the mechanism by which the films become metastable, we studied single-component films of 1-palmitoyl-2-oleoyl phosphatidylcholine (POPC). Initial experiments confirmed similar metastability of POPC if compressed above a threshold rate. Measurements at different surface pressures then showed that rates of collapse, although initially increasing above the equilibrium spreading pressure, reached a sharply defined maximum and then slowed considerably. When heated, rapidly compressed films recovered their ability to collapse with no discontinuous change in area, arguing that the metastability does not reflect transition of the POPC film to a new phase. These observations indicate that in several respects, the supercompression of POPC monolayers resembles the supercooling of three-dimensional liquids toward a glass transition.     

Deacylated pulmonary surfactant protein SP-C transforms from alpha-helical to amyloid fibril structure via a pH-dependent mechanism: an infrared structural investigation

Bovine pulmonary surfactant protein C (SP-C) is a hydrophobic, alpha-helical membrane-associated lipoprotein in which cysteines C4 and C5 are acylated with palmitoyl chains. Recently, it has been found that the alpha-helix form of SP-C is metastable, and under certain circumstances may transform from an alpha-helix to a beta-strand conformation that resembles amyloid fibrils. This transformation is accelerated when the protein is in its deacylated form (dSP-C). We have used infrared spectroscopy to study the structure of dSP-C in solution and at membrane interfaces. Our results show that dSP-C transforms from an alpha-helical to a beta-type amyloid fibril structure via a pH-dependent mechanism. In solution at low pH, dSP-C is alpha-helical in nature, but converts to an amyloid fibril structure composed of short beta-strands or beta-hairpins at neutral pH. The alpha-helix structure of dSP-C is fully recoverable from the amyloid beta-structure when the pH is once again lowered. Attenuated total reflectance infrared spectroscopy of lipid-protein monomolecular films showed that the fibril beta-form of dSP-C is not surface-associated at the air-water interface. In addition, the lipid-associated alpha-helix form of dSP-C is only retained at the surface at low surface pressures and dissociates from the membrane at higher surface pressures. In situ polarization modulation infrared spectroscopy of protein and lipid-protein monolayers at the air-water interface confirmed that the residual dSP-C helix conformation observed in the attenuated total reflectance infrared spectra of transferred films is randomly or isotropically oriented before exclusion from the membrane interface. This work identifies pH as one of the mechanistic causes of amyloid fibril formation for dSP-C, and a possible contributor to the pathogenesis of pulmonary alveolar proteinosis.     

The transition of pre-BI to pre-BII cells is dependent on the VH structure of the mu/surrogate L chain receptor.

We have demonstrated previously that the majority ( > 90%) of VH12 B cells are absent from the adult peripheral repertoire, and that most that remain have the fourth position at the D-J function (designated 10/G4). We report here that most VH 12-expressing pre-B cells are lost during the transition from the pre-BI to the pre-BII cell stage in normal mice, and that pre-BII cell productive (P) rearrangements ar enriched in 10/G4 CDR3. This coincides with the initial expression of H chain and the generation of the mu/surrogate L chain (SL) receptor. In contrast, there is not enrichment for 10/G4 CDR3 in mu MT mice, and the frequency of P rearrangements is as expected from a random rearrangement mechanism, ruling out a biased rearrangement mechanism unique to VH12. We have also demonstrated that non-10/G4 mu chains can associate with SL and be expressed on the cell surface, suggesting that they are available on the cell surface for selection. Thus, transition of pre-BI to pre-BII cells is dependent on the structure of the VH domain.     

Effect of pH and monovalent cations on the ionization state of phosphatidylglycerol in monolayers. An experimental (surface potential) and theoretical (Gouy-Chapman) approach

Ionization of the acidic phospholipid phosphatidylglycerol has been studied by measuring the surface potential of monomolecular films of the lipid as a function of the aqueous subphase pH and the concentration of monovalent cations (Li, Na, Cs). It is shown that the experimental data can be interpreted by means of the Gouy-Chapman theory in its simplest formulation, provided an adsorption of cations at the membrane surface is accounted for. This allows us to predict the ionization state of the lipid for given ionic conditions in the subphase. Above pH 4, for subphase ion concentration higher than 10 mM, or for ion concentrations above 0.1 mM at pH 5.6, phosphatidylglycerol is fully deprotonated. Within the limits of our theoretical approach, association constants of the cations to the lipid lie around 0.1-0.6 M-1.     

Galactolipase activity of Talaromyces thermophilus lipase on galactolipid micelles,monomolecular films and UV-absorbing surface-coated substrate

Talaromyces thermophilus lipase (TTL) was found to hydrolyze monogalactosyl diacylglycerol (MGDG) and digalactosyl diacylglycerol (DGDG) substrates presented in various forms to the enzyme. Different assay techniques were used for each substrate: pHstat with dioctanoyl galactolipid-bile salt mixed micelles, barostat with dilauroyl galactolipid monomolecular films spread at the air-water interface, and UV absorption using a novel MGDG substrate containing α-eleostearic acid as chromophore and coated on microtiter plates. The kinetic properties of TTL were compared to those of the homologous lipase from Thermomyces lanuginosus (TLL), guinea pig pancreatic lipase-related protein 2 and Fusarium solani cutinase. TTL was found to be the most active galactolipase, with a higher activity on micelles than on monomolecular films or surface-coated MGDG. Nevertheless, the UV absorption assay with coated MGDG was highly sensitive and allowed measuring significant activities with about 10?ng of enzymes, against 100?ng to 10?μg with the pHstat. TTL showed longer lag times than TLL for reaching steady state kinetics of hydrolysis with monomolecular films or surface-coated MGDG. These findings and 3D-modelling of TTL based on the known structure of TLL pointed out to two phenylalanine to leucine substitutions in TTL, that could be responsible for its slower adsorption at lipid-water interface. TTL was found to be more active on MGDG than on DGDG using both galactolipid-bile salt mixed micelles and galactolipid monomolecular films. These later experiments suggest that the second galactose on galactolipid polar head impairs the enzyme adsorption on its aggregated substrate.     

On the propensity of phosphatidylglycerols to form interdigitated phases

We have determined the phase behavior of disaturated phosphatidylglycerols (PGs) of chain lengths n(CH2) = 14-18 at high pH and ionic strength using calorimetry, dilatometry, as well as x-ray diffraction. PGs with n(CH2) = 14 and 16 show thermotropic behavior similar to that of phosphatidylcholines (PCs). The area/lipid obtained in the gel phase is smaller than that reported for PCs despite the expected larger effective headgroup size. This can be explained by the tilting of the PG headgroup out of the bilayer plane, and we provide experimental evidence for a headgroup tilt transition. For distearoyl PG, we further find that the "usual" gel phase coexists with an interdigitated phase, which exhibits a transition from an orthorhombic into a hexagonal chain packing. The total amount of the interdigitated phase depends significantly on the temperature but is found to be largely independent of temperature equilibration time and different sample preparation protocols. Thus, the development of the interdigitated phase appears to be kinetically trapped. The formation of interdigitated phases in PGs at much smaller chain lengths than in PCs is of high relevance to interaction studies with antimicrobial peptides, as it provides a mechanism for the discrimination of membranes composed of different lipid species.     

Surface properties of monomolecular films of oxidized and reduced cytochrome c and f.

The surface properties of monomolecular films of oxidized and reduced cytochromes f and c were measured at an air-water interface. Area/molecular (A) and surface potential (deltaV) for oxidized and reduced forms of the cytochromes were measured as a function of pH. Oxidized cyt f has a maximum for both A and deltaV at pH 7.5. At a surface pressure of 6 dyn/cm the maximum A equals 2600 plus or minus 50 A2 and the maximum deltaV equals 200 plus or minus 10 mV. Reduced cyt f as a function of pH has a minimum value for both A (2200 A2) and deltaV (95 mV). Oxidized cyt c as a function of pH has minima for A (140 A2) and deltaV (188 mV) at pH 7.0 and 7.3, respectively. On the other hand, reduced cyt has maximum values for A (220 A2) and deltaV (260 mV) at pH 7.0 and 7.3, respectively.     

Inhibition of human gastric and pancreatic lipases by chiral alkylphosphonates. A kinetic study with 1,2-didecanoyl-sn-glycerol monolayer

Enantiomerically pure alkylphosphonate compounds RR′P(O)PNP (R=C_nH_2n+1, R′=OY with Y=C_n′H_2n′+1 with n=n′ or n≠n′; PNP=p-nitrophenoxy) noted (RY), mimicking the transition state occurring during the carboxyester hydrolysis were synthesized and investigated as potential inhibitors of human gastric lipase (HGL) and human pancreatic lipase (HPL). The inhibitory properties of each enantiomer have been tested with the monomolecular films technique in addition to an enyzme linked immunosorbent assay (ELISA) in order to estimate simultaneously the residual enzymatic activity as well as the interfacial lipase binding. With both lipases, no obvious correlation between the inhibitor molar fraction (₅₀) leading to half inhibition, and the chain length, R or Y was observed. (R₁₁Y₁₆)s were the best inhibitor of HPL and (R₁₀Y₁₁)s were the best inhibitors of HGL. We observed a highly enantioselective discrimination, both with the pure enantiomeric alkylphosphonate inhibitors as well as a scalemic mixture. We also showed, for the first time, that this enantioselective recognition can occur either during the catalytic step or during the initial interfacial adsorption step of the lipases. These experimental results were analyzed with two kinetic models of covalent as well as pseudo-competitive inhibition of lipolytic enzymes by two enantiomeric inhibitors.     

Surfactant protein B inhibits secretory phospholipase A2 hydrolysis of surfactant phospholipids

Hydrolysis of surfactant phospholipids (PL) by secretory phospholipases A(2) (sPLA(2)) contributes to surfactant damage in inflammatory airway diseases such as acute lung injury/acute respiratory distress syndrome. We and others have reported that each sPLA(2) exhibits specificity in hydrolyzing different PLs in pulmonary surfactant and that the presence of hydrophilic surfactant protein A (SP-A) alters sPLA(2)-mediated hydrolysis. This report tests the hypothesis that hydrophobic SP-B also inhibits sPLA(2)-mediated surfactant hydrolysis. Three surfactant preparations were used containing varied amounts of SP-B and radiolabeled tracers of phosphatidylcholine (PC) or phosphatidylglycerol (PG): 1) washed ovine surfactant (OS) (pre- and postorganic extraction) compared with Survanta (protein poor), 2) Survanta supplemented with purified bovine SP-B (1-5%, wt/wt), and 3) a mixture of dipalmitoylphosphatidylcholine (DPPC), 1-palmitoyl-2-oleoyl-phosphatidylcholine (POPC), and 1-palmitoyl-2-oleoyl-phosphatidylglycerol (POPG) (DPPC:POPC:POPG, 40:40:20) prepared as vesicles and monomolecular films in the presence or absence of SP-B. Hydrolysis of PG and PC by Group IB sPLA(2) (PLA2G1A) was significantly lower in the extracted OS, which contains SP-B, compared with Survanta (P = 0.005), which is SP-B poor. Hydrolysis of PG and PC in nonextracted OS, which contains all SPs, was lower than both Survanta and extracted OS. When Survanta was supplemented with 1% SP-B, PG and PC hydrolysis by PLA2G1B was significantly lower (P < 0.001) than in Survanta alone. When supplemented into pure lipid vesicles and monomolecular films composed of PG and PC mixtures, SP-B also inhibited hydrolysis by both PLA2G1B and Group IIA sPLA2 (PLA2G2A). In films, PLA2G1B hydrolyzed surfactant PL monolayers at surface pressures ≤30 mN/m (P < 0.01), and SP-B lowered the surface pressure range at which hydrolysis can occur. These results suggest the hydrophobic SP, SP-B, protects alveolar surfactant PL from hydrolysis mediated by multiple sPLA(2) in both vesicles (alveolar subphase) and monomolecular films (air-liquid interface).     

Studies on the Critical Micellar Concentration and Phase Transitions of Stearoylcarnitine

The critical micellar concentration (CMC) of stearoylcarnitine was determined at different pH values at room temperature by fluorescence spectroscopy, monitoring the spectral changes of 8-anilinonaphthalene-1-sulfonate (ANS). The CMC was found to vary with pH, increasing from about 10 μM at pH 3.0 to ca. 25 μM at pH 7.0, but decreasing slightly with further increase in pH to approximately 19 μM at pH 10.0. Differential scanning calorimetry (DSC) shows that stearoylcarnitine dispersed in water at low concentration undergoes a broad thermotropic phase transition at 44.5°C, with a transition enthalpy of 15.0 kcal/mol. The transition temperature (T _t) shifts to ca. 50.5°C in the presence of 1 mM EDTA or when the concentration is increased significantly. The turbidity of aqueous dispersions of stearoylcarnitine was found to be considerably high at low temperatures, which decreases quite abruptly over a short temperature range, indicating that a transition occurs from a phase of large aggregates to one of much smaller aggregates, most likely micelles. The phase transition temperature was determined as 29.1°C at pH 3.0, which increased with increasing pH up to a value of 55.3°C at pH 8.6 and remains nearly constant thereafter up to pH 11.2. The pH dependence of CMC and T _t suggest that the pK _a of the carboxyl group of long chain acylcarnitines shifts to higher temperatures upon aggregation (micelles or bilayer membranes).     

The interaction of bacterial lipopolysaccharide with phospholipid bilayers and monolayers

The association of bacterial lipopolysaccharide with artificial membranes was studied in an attempt to understand the mechanism of binding of lipopolysaccharide to cell surfaces and to look for an effect on membrane stability. The membrane models used were phospholipid bilayers and monolayers. As measured by survival time, lipopolysaccharide was found to decrease the stability of bilayers at a concentration of 300 μg/ml. When assayed by dielectric breakdown, an effect of lipopolysaccharide was noticeable at concentrations of 50 μg/ml. In studies involving the penetration of monomolecular films of various phospholipids, native and alkali-treated lipopolysaccharide both caused increases in surface pressure, and therefore penetrated the films. However, alkali-treated lipopolysaccharide was at least ten times more efficient than the native product in penetration. Alkali-treated lipopolysaccharide had a greater degree of surface activity than native lipopolysaccharide, since alkali-treated lipopolysaccharide formed monomolecular films by itself, whereas native lipopolysaccharide did not. The changes in the surface pressure and surface potential of phospholipid films produced by lipopolysaccharide in the subsolution suggested that the interaction of lipopolysaccharide with phospholipid monolayers was by a combination of penetration and adsorption to the undersurface.     

An investigation into the effect of potassium ions on the folding of silk fibroin studied by generalized two-dimensional NMR-NMR correlation and Raman spectroscopy

We used generalized two-dimensional NMR-NMR correlation to examine the effect of potassium ions on the conformation transition in silk fibroin to investigate the possibility that the fairly high K+ ion content found in the distal end of silk-secreting ducts in the silkworms could have a bearing on natural formation of the silk fiber. This has enabled us to propose a detailed mechanism for the transition process. Our evidence indicates that increasing the [K+] from 0 to 3.7 mg.g(-1) in the silk fibroin, as is thought to occur as the silk fibroin moves through the secretory pathway to the spigot, produces a sequence of secondary structural changes: helix and/or random coil-->helix-like-->beta-sheet-like-->beta-sheet. The sequence is the same as that produced in silk fibroin films by decreasing the pH of fibroin from 6.8 to 4.8. In addition, we used Raman spectroscopy to study the effect of K+ ions on the Fermi doublet resonance of the tyrosyl phenolic ring at 850 and 830 cm(-1). The intensity ratio I(850)/I(830) at these wave numbers indicated that the hydrogen bonding formed by the tyrosyl phenolic-OH becomes more stable with an increase in the K+ ion concentration as above. Our investigation on the effect of K+ ions on fibroin may help provide a theoretical basis for understanding the natural silk-spinning process and the conditions required for biomimetic spinning. It may also have relevance to the aggregation of other beta-sheet proteins, including prion proteins, neurofibrillary proteins and amyloid plaques.     

Interactions of phospholipid monolayers with carbohydrates

Surface pressure studies of phospholipid monomolecular films of dimyristoylphosphatidylcholine (DMPC) and dipalmitoylphosphatidylcholine (DPPC) formed at an air/water interface have been made and the effects on the films studied when various carbohydrates are present in the subphase. The results obtained show that at a given temperature, the area per molecule of DPPC increases with increasing concentration of the carbohydrate in the subphase. The carbohydrate which has the greatest expanding effect on the phospholipid monolayer is glycerol, followed in turn by trehalose, sucrose, glucose, raffinose, and inositol. The mechanism of monolayer expansion by glycerol is different from that observed in other carbohydrates, as the following experiments demonstrate. Below the phase transition temperature of DPPC, the area per molecule of DPPC at a pressure of 12.5 dyn/cm is the same with and without glycerol in the subphase. However, when the monolayer is heated to a temperature above the phase transition temperature for DPPC, the area/molecule on glycerol is considerably greater than the area/molecule on water at the same surface pressure. Cooling the monolayer back to the lower temperature produces an area/molecule of DPPC which is identical on both water and glycerol subphases. Glycerol therefore has no effect on the low-temperature (condensed) monolayers but causes expansion of the high-temperature (expanded) monolayers. By contrast with glycerol, both trehalose and sucrose interact with the DPPC monolayer producing an increased area/molecule over that observed on water, both with low-temperature (condensed) monolayers and with the high-temperature (expanded) monolayers. The efficiency of these carbohydrates at expanding the monolayer films (with the exception of glycerol) shows a strong correlation with their ability to stabilize membrane structure and function at low water contents.     

A novel extracellular esterase from Bacillus subtilis and its conversion to a monoacylglycerol hydrolase.

A novel gene lipB, which encodes an extracellular lipolytic enzyme, was identified in the Bacillus subtilis genomic DNA sequence. We have cloned and overexpressed lipB in B. subtilis and Escherichia coli and have also purified the enzyme from a B. subtilis culture supernatant to electrophoretic homogeneity. Four different lipase assays were used to determine its catalytic activity: pH-stat, spectrophotometry, fluorimetry and the monomolecular film technique. LipB preferentially hydrolysed triacylglycerol-esters and p-nitrophenyl-esters of fatty acids with short chain lengths of 相似文献   

Equilibrium and kinetics of the reaction of Aplysia myoglobin with azide.

The present paper reports a study on the equilibria and kinetics of the acid-alkaline transition and the azide binding reaction by ferric Aplysia myoglobin. A single completely reversible spectrophotometric titration curve is found over the pH range from similar to 5 to similar to 9, with an apparent pK equals to 7.5 for the acid-alkaline transition. The kinetics of the process, followed by the temperature-jump method, gives, at pH values close to the pK of the transition, one single, well-resolved, relaxation independent of protein concentration and of type of buffer used. The pattern accords to a simple pH dependent reaction, in buffered medium, between the two forms of the protein. The results of the azide binding reaction show that the process conforms to simple equilibrium as expected for a single site protein. The méasured association constant is reported as a function of pH. The kinetics of the reaction of Aplysia metMb with N3- minus shows, on the other hand, a complex behavior. The relaxation pattern is found to strongly depend on pH and ligand concentration in such a way to suggest a linkage between ligand binding and acid-alkaline transition. The system is discussed on the basis of two simplifying conditions, i.e., at low and higher pH with respect to the pK of the acid-alkaline transition. At acid pH the reaction corresponds to a single bimolecular process as expected for a simple binding reaction; at alkaline pH, the dependence of relaxation time on ligand concentration implies the existence of a rate-limiting monomolecular step. On the basis of a reaction scheme implying that binding of the ligand can only occur through the acid (aquomet) form of the protein via the displacement of the water molecule, the experimental data are quantitatively accounted for.     

Chemical syntheses of novel fluorescent-labelled fatty acids, phosphatidylcholines and cholesterol esters.

The synthesis of a novel class of fluorescent-labelled fatty acids of different chain lengths and unsaturation, phospholipids and cholesterol esters has been developed. The following omega-anthracene-labelled cis-unsaturated fatty acids have been synthesized: omega-(9-anthryl)-6c-octenoic, -7c-nonenoic, -10c-dodecenoic, -6c,9c-undecadienoic, -10c,13c-pentadecadienoic acid. They have been introduced into the 2-position of 1-stearoyl- and 1-linoleoyl-3-sn-glycerophosphocholine and cholesterol. Mass spectroscopy, 1H-NMR, IR and fluorescence spectroscopy and different chromatographic procedures have been applied to confirm and characterize their structures. The properties of the different fluorescent-labelled phosphatidylcholines in monomolecular films have been determined by the Langmuir technique.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Identification of the ligands to the ferric heme of Chlamydomonas chloroplast hemoglobin: evidence for ligation of tyrosine-63 (B10) to the heme

We have studied the unusual heme ligand structure of the ferric forms of a recombinant Chlamydomonas chloroplast hemoglobin and its several single-amino acid mutants by EPR, optical absorbance, and resonance Raman spectroscopy. The helical positions of glutamine-84, tyrosine-63, and lysine-87 are suggested to correspond to E7, B10, and E10, respectively, in the distal heme pocket on the basis of amino acid sequence comparison of mammalian globins. The protein undergoes a transition with a pK of 6.3 from a six-coordinate high-spin aquomet form at acidic pH to a six-coordinate low-spin form. The EPR signal of the low-spin form for the wild-type protein is absent for the Tyr63Leu mutant, suggesting that the B10 tyrosine in the wild-type protein ligates to the heme as tyrosinate. For the Tyr63Leu mutant, a new low-spin signal resembling that of alkaline cytochrome c (a His-heme-Lys species) is resolved, suggesting that the E10 lysine now coordinates to the heme. In the wild-type protein, the oxygen of the tyrosine-63 side chain is likely to share a proton with the side chain of lysine-87, suggested by the observation of a H/D sensitive resonance Raman line at 502 cm(-)(1) that is tentatively assigned as a vibrational mode of the Fe-O bond between the iron and the tyrosinate. We propose that the transition from the high-spin to the low-spin form of the protein occurs by deprotonation and ligation to the heme of the B10 tyrosine oxygen, facilitated by strong interaction with the E10 lysine side chain.