IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.     

Poly(A) nuclease interacts with the C-terminal domain of polyadenylate-binding protein domain from poly(A)-binding protein

The poly(A)-binding protein (PABP) is an essential protein found in all eukaryotes and is involved in an extensive range of cellular functions, including translation, mRNA metabolism, and mRNA export. Its C-terminal region contains a peptide-interacting PABC domain that recruits proteins containing a highly specific PAM-2 sequence motif to the messenger ribonucleoprotein complex. In humans, these proteins, including Paip1, Paip2, eRF3 (eukaryotic release factor 3), Ataxin-2, and Tob2, are all found to regulate translation through varying mechanisms. The following reports poly(A) nuclease (PAN) as a PABC-interacting partner in both yeast and humans. Their interaction is mediated by a PAM-2 motif identified within the PAN3 subunit. This site was identified in various fungal and animal species suggesting that the interaction is conserved throughout evolution. Our results indicate that PABP is directly involved in recruiting a deadenylase to the messenger ribonucleoprotein complex. This demonstrates a novel role for the PABC domain in mRNA metabolic processes and gives further insight into the function of PABP in mRNA maturation, export, and turnover.     

Solution structure of the C-terminal domain from poly(A)-binding protein in Trypanosoma cruzi: a vegetal PABC domain

PABC is a phylogenetically conserved peptide-binding domain primarily found within the C terminus of poly(A)-binding proteins (PABPs). This domain recruits a series of translation factors including poly(A)-interacting proteins (Paip1 and Paip2) and release factor 3 (RF3/GSPT) to the initiation complex on mRNA. Here, we determine the solution structure of the Trypanosoma cruzi PABC domain (TcPABC), a representative of the vegetal class of PABP proteins. TcPABC is similar to human PABC (hPABC) and consists of five alpha-helices, in contrast to the four helices observed in PABC domains from yeast (yPABC) and hyper plastic disk proteins (hHYD). A mobile N-terminal helix is observed in TcPABC that does not pack against the core of the protein, as found in hPABC. Characteristic to all PABC domains, the last four helices of TcPABC fold into a right-handed super coil. TcPABC demonstrates high-affinity binding to PABP interacting motif-2 (PAM-2) and reveals a peptide-binding surface homologous to that of hPABC. Our results demonstrate the last four helices in TcPABC are sufficient for peptide recognition and we predict a similar binding mode in PABC domains. Furthermore, these results point to the presence of putative PAM-2 site-containing proteins in trypanosomes.     

Identification of a human cytoplasmic poly(A) nuclease complex stimulated by poly(A)-binding protein

The poly(A) tail shortening in mRNA, called deadenylation, is the first rate-limiting step in eukaryotic mRNA turnover, and the polyadenylate-binding protein (PABP) appears to be involved in the regulation of this step. However, the precise role of PABP remains largely unknown in higher eukaryotes. Here we identified and characterized a human PABP-dependent poly(A) nuclease (hPAN) complex consisting of catalytic hPan2 and regulatory hPan3 subunits. hPan2 has intrinsically a 3' to 5' exoribonuclease activity and requires Mg2+ for the enzyme activity. On the other hand, hPan3 interacts with PABP to simulate hPan2 nuclease activity. Interestingly, the hPAN nuclease complex has a higher substrate specificity to poly(A) RNA upon its association with PABP. Consistent with the roles of hPan2 and hPan3 in mRNA decay, the two subunits exhibit cytoplasmic co-localization. Thus, the human PAN complex is a poly(A)-specific exoribonuclease that is stimulated by PABP in the cytoplasm.     

Structure and RNA binding of the third KH domain of poly(C)-binding protein 1

Poly(C)-binding proteins (CPs) are important regulators of mRNA stability and translational regulation. They recognize C-rich RNA through their triple KH (hn RNP K homology) domain structures and are thought to carry out their function though direct protection of mRNA sites as well as through interactions with other RNA-binding proteins. We report the crystallographically derived structure of the third domain of alphaCP1 to 2.1 A resolution. alphaCP1-KH3 assumes a classical type I KH domain fold with a triple-stranded beta-sheet held against a three-helix cluster in a betaalphaalphabetabetaalpha configuration. Its binding affinity to an RNA sequence from the 3'-untranslated region (3'-UTR) of androgen receptor mRNA was determined using surface plasmon resonance, giving a K(d) of 4.37 microM, which is indicative of intermediate binding. A model of alphaCP1-KH3 with poly(C)-RNA was generated by homology to a recently reported RNA-bound KH domain structure and suggests the molecular basis for oligonucleotide binding and poly(C)-RNA specificity.     

The RNA binding domains of the nuclear poly(A)-binding protein

The nuclear poly(A)-binding protein (PABPN1) is involved in the synthesis of the mRNA poly(A) tails in most eukaryotes. We report that the protein contains two RNA binding domains, a ribonucleoprotein-type RNA binding domain (RNP domain) located approximately in the middle of the protein sequence and an arginine-rich C-terminal domain. The C-terminal domain also promotes self-association of PABPN1 and moderately cooperative binding to RNA. Whereas the isolated RNP domain binds specifically to poly(A), the isolated C-terminal domain binds non-specifically to RNA and other polyanions. Despite this nonspecific RNA binding by the C-terminal domain, selection experiments show that adenosine residues throughout the entire minimal binding site of approximately 11 nucleotides are recognized specifically. UV-induced cross-links with oligo(A) carrying photoactivatable nucleotides at different positions all map to the RNP domain, suggesting that most or all of the base-specific contacts are made by the RNP domain, whereas the C-terminal domain may contribute nonspecific contacts, conceivably to the same nucleotides. Asymmetric dimethylation of 13 arginine residues in the C-terminal domain has no detectable influence on the interaction of the protein with RNA. The N-terminal domain of PABPN1 is not required for RNA binding but is essential for the stimulation of poly(A) polymerase.     

Solution structure of the PABC domain from wheat poly (A)-binding protein: an insight into RNA metabolic and translational control in plants

In animals, the PABC domain from poly (A)-binding protein recruits proteins containing a specific interacting motif (PAM-2) to the mRNP complex. These proteins include Paip1, Paip2, and eukaryotic release factor 3 (eRF3), all of which regulate PABP function in translation. The following reports the solution structure of PABC from Triticum avestium (wheat) poly (A)-binding protein determined by NMR spectroscopy. Wheat PABC (wPABC) is an alpha-helical protein domain, which displays a fold highly similar to the human PABC domain and contains a PAM-2 peptide binding site. Through a bioinformatics search, several plant proteins containing a PAM-2 site were identified including the early response to dehydration protein (ERD-15), which was previously shown to regulate PABP-dependent translation. The plant PAM-2 proteins contain a variety of conserved sequences including a PABP-interacting 1 motif (PAM-1), RNA binding domains, an SMR endonuclease domain, and a poly (A)-nuclease regulatory domain, all of which suggest a function in either translation or mRNA metabolism. The proteins identified are well conserved throughout plant species but have no sequence homologues in metazoans. We show that wPABC binds to the plant PAM-2 motif with high affinity through a conserved mechanism. Overall, our results suggest that plant species have evolved a distinct regulatory mechanism involving novel PABP binding partners.     

The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex

Repression of poly(A)-binding protein (PABP) mRNA translation involves the binding of PABP to the adenine-rich autoregulatory sequence (ARS) in the 5′-untranslated region of its own mRNA. In this report, we show that the ARS forms a complex in vitro with PABP, and two additional polypeptides of 63 and 105 kDa. The 63 and 105 kDa polypeptides were identified, as IMP1, an ortholog of chicken zip-code binding polypeptide, and UNR, a PABP binding polypeptide, respectively, by mass spectrometry of the ARS RNA affinity purified samples. Using a modified ribonucleoprotein (RNP) immunoprecipitation procedure we further show that indeed, both IMP1 and UNR bind to the ARS containing reporter RNA in vivo. Although both IMP1 and UNR could bind independently to the ARS RNA in vitro, their RNA-binding ability was stimulated by PABP. Mutational analyses of the ARS show that the presence of four of the six oligo(A) regions of the ARS was sufficient to repress translation and the length of the conserved pyrimidine spacers between the oligo(A) sequences was important for ARS function. The ability of mutant ARS RNAs to form the PABP, IMP1 and UNR containing RNP complex correlates well with the translational repressor activity of the ARS. There is also a direct relationship between the length of the poly(A) RNAs and their ability to form a trimeric complex with PABP, and to repress mRNA translation. UV crosslinking studies suggest that the ARS is less efficient than a poly(A) RNA of similar length, to bind to PABP. We show here that the ARS cannot efficiently form a trimeric complex with PABP; therefore, additional interactions with IMP1 and UNR to form a heteromeric RNP complex may be required for maximal repression of PABP mRNA translation under physiological conditions.     

Stimulation of picornavirus replication by the poly(A) tail in a cell-free extract is largely independent of the poly(A) binding protein (PABP)

Picornavirus infectivity is dependent on the RNA poly(A) tail, which binds the poly(A) binding protein (PABP). PABP was reported to stimulate viral translation and RNA synthesis. Here, we studied encephalomyocarditis virus (EMCV) and poliovirus (PV) genome expression in Krebs-2 and HeLa cell-free extracts that were drastically depleted of PABP (96%-99%). Although PABP depletion markedly diminished EMCV and PV internal ribosome entry site (IRES)-mediated translation of a polyadenylated luciferase mRNA, it displayed either no (EMCV) or slight (PV) deleterious effect on the translation of the full-length viral RNAs. Moreover, PABP-depleted extracts were fully competent in supporting EMCV and PV RNA replication and virus assembly. In contrast, removing the poly(A) tail from EMCV RNA dramatically reduced RNA synthesis and virus yields in cell-free reactions. The advantage conferred by the poly(A) tail to EMCV synthesis was more pronounced in untreated than in nuclease-treated extract, indicating that endogenous cellular mRNAs compete with the viral RNA for a component(s) of the RNA replication machinery. These results suggest that the poly(A) tail functions in picornavirus replication largely independent of PABP.     

Identification of a novel Xenopus laevis poly (A) binding protein

Poly (A) binding proteins are intimately implicated in controlling a number of events in mRNA metabolism from nuclear polyadenylation to cytoplasmic translation and stability. The known poly(A) binding proteins can be divided into three distinct structural groups (prototypes PABP1, PABPN1/PABP2 and Nab2p) and two functional families, showing that similar functions can be accomplished by differing structural units. This has prompted us to perform a screen for novel poly(A) binding proteins using Xenopus laevis. A novel poly(A) binding protein of 32 kDa (p32) was identified. Sequence analysis showed that p32 has about 50% identity to the known nuclear poly(A) binding proteins (PABPN1) but is more closely related to a group of mammalian proteins of unknown function. The expression of Xenopus laevis ePABP2 is restricted to early embryos. Accordingly, we propose that p32 is the founder member of a novel class of poly(A) binding proteins named ePABP2.     

A single domain of yeast poly(A)-binding protein is necessary and sufficient for RNA binding and cell viability.

The poly(A)-binding protein (PAB) gene of Saccharomyces cerevisiae is essential for cell growth. A 66-amino acid polypeptide containing half of a repeated N-terminal domain can replace the entire protein in vivo. Neither an octapeptide sequence conserved among eucaryotic RNA-binding proteins nor the C-terminal domain of PAB is required for function in vivo. A single N-terminal domain is nearly identical to the entire protein in the number of high-affinity sites for poly(A) binding in vitro (one site with an association constant of approximately 2 X 10(7) M-1) and in the size of the binding site (12 A residues). Multiple N-terminal domains afford a mechanism of PAB transfer between poly(A) strands.     

Identification of a novel human Acyl-CoA binding protein isoform with a unique C-terminal domain

Seven isoforms of the multifunctional human Acyl-coenzyme A binding protein (ACBP) have been characterized so far. Through ab initio analysis of expressed sequence tag (ESTs), we identified a novel high-abundant ACBP splice variant ACBP1e encoding an ACBP isoform with a unique C-terminus of 81 amino acid residues. Bioinformatic analysis shows that this domain is evolutionary conserved and shares no significant homology with other known proteins, and its function is not known. Quantitative RT-polymerase chain reaction (PCR) revealed that ACBP1e is predominantly expressed in adipose tissue and hippocampus. Protein expression studies showed perinuclear clustering of ACBP1e. These clusters were not seen in ACBP1e mutants with an altered putative subtilisin/kexin isozyme-1 cleavage site within the C-terminus, indicating that this domain is required for proper localization of ACBP1e. Conclusively, we identified a novel ACBP isoforms with an unique C-terminal domain encoded by a high-abundant splice variant.     

The multifunctional poly(A)-binding protein (PABP) 1 is subject to extensive dynamic post-translational modification, which molecular modelling suggests plays an important role in co-ordinating its activities

PABP1 [poly(A)-binding protein 1] is a central regulator of mRNA translation and stability and is required for miRNA (microRNA)-mediated regulation and nonsense-mediated decay. Numerous protein, as well as RNA, interactions underlie its multi-functional nature; however, it is unclear how its different activities are co-ordinated, since many partners interact via overlapping binding sites. In the present study, we show that human PABP1 is subject to elaborate post-translational modification, identifying 14 modifications located throughout the functional domains, all but one of which are conserved in mouse. Intriguingly, PABP1 contains glutamate and aspartate methylations, modifications of unknown function in eukaryotes, as well as lysine and arginine methylations, and lysine acetylations. The latter dramatically alter the pI of PABP1, an effect also observed during the cell cycle, suggesting that different biological processes/stimuli can regulate its modification status, although PABP1 also probably exists in differentially modified subpopulations within cells. Two lysine residues were differentially acetylated or methylated, revealing that PABP1 may be the first example of a cytoplasmic protein utilizing a 'methylation/acetylation switch'. Modelling using available structures implicates these modifications in regulating interactions with individual PAM2 (PABP-interacting motif 2)-containing proteins, suggesting a direct link between PABP1 modification status and the formation of distinct mRNP (messenger ribonucleoprotein) complexes that regulate mRNA fate in the cytoplasm.     

A specific role for the C-terminal region of the Poly(A)-binding protein in mRNA decay

mRNA poly(A) tails affect translation, mRNA export and mRNA stability, with translation initiation involving a direct interaction between eIF4G and the poly(A)-binding protein Pab1. The latter factor contains four RNA recognition motifs followed by a C-terminal region composed of a linker and a PABC domain. We show here that yeast mutants lacking the C-terminal domains of Pab1 display specific synthetic interactions with mutants in the 5′-3′ mRNA decay pathway. Moreover, these mutations impair mRNA decay in vivo without significantly affecting mRNA export or translation. Inhibition of mRNA decay occurs through slowed deadenylation. In vitro analyses demonstrate that removal of the Pab1 linker domain directly interferes with the ability of the Pop2–Ccr4 complex to deadenylate the Pab1-bound poly(A). Binding assays demonstrate that this results from a modulation of poly(A) packaging by the Pab1 linker region. Overall, our results demonstrate a direct involvement of Pab1 in mRNA decay and reveal the modular nature of this factor, with different domains affecting various cellular processes. These data suggest new models involving the modulation of poly(A) packaging by Pab1 to control mRNA decay.     

Crystal structure of the middle domain of human poly(A)-binding protein-interacting protein 1

This communication describes SAXS data based global structures of tetravalent antibody CD4–IgG2 and its dimeric to pentameric complexes with gp120s. Comparison of models brought forth that while the two CD4s grafted on each arm remain tightly packed in the unliganded antibody, they enable binding of first two gp120s preferentially to the same Fab arm in an asymmetric manner. Retention of residues in the CD4–Fab linker earlier reasoned to enable bi-fold collapse of gp120-bound soluble CD4, and observed asymmetry of the (CD4–IgG2)/(gp120)₂ complex suggest that encoded flexibility in CD4–Fab linker is a critical structure–function factor for this broad spectrum neutralizing antibody.