Unique antibiotic sensitivity of an in vitro polypeptide synthesis system from the archaebacterium Thermoplasma acidophilum. Phylogenetic implications

Summary The susceptibility of Thermoplasma acidophilum (an extremely acidophilic, moderately thermophilic, wall-less sulphur-oxidizing archaebacterium) to 50 ribosome-specific inhibitors of polypeptide elongation was surveyed using efficient poly(U)-and poly(UG)-directed cell-free systems and comparable reference systems derived from eubacterial (Bacillus stearothermophilus, Escherichia coli) and eukaryotic (Saccharomyces cerevisiae) species. Under optimum temperature (58° C) and ionic conditions for polypeptide synthesis Thermoplasma ribosomes are only sensitive to the 70 S/80 S ribosome-directed aminoglycoside neomycin, and to five 80 S ribosome-directed inhibitors all of which (-sarcin, mitogillin, restrictocin, dianthin and gelonin) impair the functioning of the large (60 S) ribosomal subunit. Sensitivity of the three structurally related compounds -sarcin, mitogillin and restrictocin and susceptibility to neomycin place Thermoplasma ribosomes between those of Sulfolobus solfataricus (only sensitive to -sarcin) and Methanococcus vannielli (sensitive to -sarcin, mitogillin, restrictocin and neomycin but also affected by a variety of 70 S ribosome-directed drugs). The phylogenetic significance of the greatly diversified antibiotic sensitivity spectra displayed by archaebacteria in general, as opposed to the uniform ones exhibited by eubacteria and eukaryotes, is discussed.     

The nucleotide sequence of the tRNAMMet from the archaebacterium Thermoplasma acidophilum.

Using in vitro labelling techniques, a tRNAMMet from Thermoplasma acidophilum, a member of the Archaebacteriae, has been shown to have the sequence: pGCCGGG Gs4UGGCUCANCUGGAGGAGC m2(2)GCCGGACmUCAUt6AAUCCGGAGGUCUCGGG psi psi CmGAUCCCCGAUCCCGGCACCAOH. Despite the small genome size of this non-parasitic organism, eight modified nucleosides are present, one of which is typically eubacterial, one of which is typically eukaryotic and some of which appear to be unique to the archaebacteria. There is no close sequence homology between this tRNA and that of any other methionine tRNA so far sequenced (less than 70%) but it has almost 90% homology with the nucleotide sequence proposed by Eigen and Oswatitsch for the ancestral quasi-species.     

Organization of rRNA structural genes in the archaebacterium Thermoplasma acidophilum.

In the archaebacterium Thermoplasma acidophilum, each of the structural genes for 5S, 16S and 23S rRNA occur once per genome. In contrast to those of eubacteria and eukaryotes, they appear unlinked. The distance between the 16S and the 23S rDNA is at least 7.5 Kb, that between 23S and 5S rDNA at least 6 Kb and that between 16S and 5S rDNA at least 1.5 Kb. No linkage between those genes has been found by the analysis of recombinant plasmids carrying Bam HI and Hind III rDNA fragments as by hybridizing those plasmids to fragments of Thermoplasma DNA generated by 6 individual restriction endonucleases, recognizing hexanucleotide sequences.     

Purification and characterization of glucose dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Glucose dehydrogenase was purified to homogeneity from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme is a tetramer of polypeptide chain Mr 38,000 +/- 3000, it is catalytically active with both NAD+ and NADP+ cofactors, and it is thermostable and remarkably resistant to a variety of organic solvents. The amino acid composition was determined and compared with those of the glucose dehydrogenases from the archaebacterium Sulfolobus solfataricus and the eubacteria Bacillus subtilis and Bacillus megaterium. The N-terminal amino acid sequence of the Thermoplasma acidophilum enzyme was determined to be: (S/T)-E-Q-K-A-I-V-T-D-A-P-K-G-G-V-K-Y-T-T-I-D-M-P-E.     

Purification and properties of malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum

Malate dehydrogenase from the thermoacidophilic archaebacterium Thermoplasma acidophilum is purified 50-fold to electrophoretic homogeneity. The purified enzyme crystallizes readily. Native malate dehydrogenase shows a relative molecular mass of 144 000. It is a tetramer of identical subunits with a relative molecular mass of 36 600. Malate dehydrogenase from Thermoplasma uses both NADH and NADPH as coenzyme to reduce oxaloacetate. The enzyme shows A-side (pro-R) stereospecificity for both coenzymes. The pH optimum for the reduction of oxaloacetate in the presence of NADH is found to be at pH 8.1. At pH 7.4 the Km value for oxaloacetate is found to be 5.6 microM while for NADH a value of 11.7 microM is found. The homogeneous enzyme shows a turnover number of kcat = 108 s-1.     

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUAAGCCUGCUGCGUAUUGCGUUGUACU GUAUGCCGCGAGGGUACGGGAAGCGCAAUAUGCUGUUACCAC(U)OH. The homology with the 55 rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 55 rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.     

Purification and characterization of a DNA polymerase from the archaebacterium Thermoplasma acidophilum

A thermophilic DNA polymerase has been purified to near homogeneity from the archaebacterium Thermoplasma acidophilum. Analysis of the purified enzyme by sodium dodecyl sulfate gel electrophoresis revealed a single polypeptide of 88 kDa which co-sediments with the DNA polymerase activity on sucrose gradients. Combination of sedimentation and gel filtration analyses indicates that this DNA polymerase is an 88-kDa monomeric enzyme in its native form. The DNA polymerase is resistant to aphidicolin, slightly sensitive to 2',3'-dideoxyribosylthymine triphosphate and inhibited by N-ethylmaleimide when preincubation with this reagent is performed at 65 degrees C. We find that a 3'----5' exonuclease activity is associated with the purified DNA polymerase; the two activities of the enzyme are optimal at 65 degrees C but the exonuclease activity is active in a broader range of lower temperatures and is more thermostable than the DNA polymerase activity.     

Crystallization and preliminary crystallographic study of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum

Single crystals of glucose dehydrogenase from the archaebacterium Thermoplasma acidophilum were obtained using the hanging-drop vapour diffusion method and polyethylene glycol as a precipitant in the presence of NADP+ at pH 5.4. The crystals belong to the hexagonal space group P6122 or P6522, with unit cell dimensions a = b = 121.9 angstrom, c = 229.6 angstrom and with two molecules in the asymmetric unit.     

Purification and enzymic characterization of the cytoplasmic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

Cytoplasmic pyrophosphatase has been isolated from the thermoacidophilic archaebacterium Thermoplasma acidophilum. The enzyme was purified to electrophoretic homogeneity by combining ion-exchange and affinity-chromatographic separations. This soluble pyrophosphatase probably consists of six identical subunits, since SDS/PAGE gave an estimate of about 22 kDa for a single subunit and size-exclusion chromatography under non-denaturing conditions indicates a molecular mass of 110 +/- 5 kDa. The two most prominent catalytic features of this enzyme are the absolute requirement for divalent cations for catalytic action, Mg2+ conferring the highest activity, and the pronounced specificity for PPi. The catalytic behavior apparently follows simple Michaelis-Menten kinetics with a Km of about 7 microM for PPi and a specific activity of about 1200 U/mg at 56 degrees C. Surprisingly, maximum activity could be observed at 85 degrees C which is more than 20 degrees C above the temperature for optimal growth. Several cytoplasmic extracts of eubacteria and archaebacteria have been probed with a polyclonal antiserum raised against the purified archaebacterial protein. The only noticeable cross-reactivity could be detected with an extract from the methanogen Methanosarcina barkeri although this probably does not reflect the inferred phylogenetic relationship between methanogens and Thermoplasma acidophilum.     

The plasmids found in isolates of the acidothermophilic archaebacterium Thermoplasma acidophilum

Abstract Plasmids were detected in isolates of an acidothermophilic archaebacterium Thermoplasma acidophilum . One of the plasmids, pTA1, was characterized. The plasmid was a circular DNA of 15.2 kbp. A physical map was constructed using three restriction endonucleases. A copy number of this plasmid was estimated to be 7–13 per cell. The homologous sequence was not found in the chromosomal DNA of the host cell.     

Preliminary X-ray diffraction studies on a ferredoxin from the thermophilic archaebacterium,Thermoplasma acidophilum

A ferredoxin from the thermophilic archaebacterium, Thermoplasmaacidophilum, is supposed to contain two (4Fe-4S) active centers; one center could be linked by four cysteine residues to the protein and the other bonded with three cysteines and an unknown group. This ferredoxin has been crystallized by salting-out against 2.3 m-ammonium sulfate solution. The space group is P2₁2₁2 with cell dimensions of $\text{a = 59.20}\text{A}\text{?}\text{, b = 52.77}\text{A}\text{?}\text{and}\text{c = 41.28}\text{A}\text{?}$. Four molecules pack in the unit cell with $\text{V}{}_{\mathrm{<mtext>m</mtext>}}\text{= 2.03}\text{A}\text{?}{}^3\text{/dalton}$.     

Unique antibiotic sensitivity of archaebacterial polypeptide elongation factors.

The antibiotic sensitivity of the archaebacterial factors catalyzing the binding of aminoacyl-tRNA to ribosomes (elongation factor Tu [EF-Tu] for eubacteria and elongation factor 1 [EF1] for eucaryotes) and the translocation of peptidyl-tRNA (elongation factor G [EF-G] for eubacteria and elongation factor 2 [EF2] for eucaryotes) was investigated by using two EF-Tu and EF1 [EF-Tu(EF1)]-targeted drugs, kirromycin and pulvomycin, and the EF-G and EF2 [EF-G(EF2)]-targeted drug fusidic acid. The interaction of the inhibitors with the target factors was monitored by using polyphenylalanine-synthesizing cell-free systems. A survey of methanogenic, halophilic, and sulfur-dependent archaebacteria showed that elongation factors of organisms belonging to the methanogenic-halophilic and sulfur-dependent branches of the "third kingdom" exhibit different antibiotic sensitivity spectra. Namely, the methanobacterial-halobacterial EF-Tu(EF1)-equivalent protein was found to be sensitive to pulvomycin but insensitive to kirromycin, whereas the methanobacterial-halobacterial EF-G(EF2)-equivalent protein was found to be sensitive to fusidic acid. By contrast, sulfur-dependent thermophiles were unaffected by all three antibiotics, with two exceptions; Thermococcus celer, whose EF-Tu(EF1)-equivalent factor was blocked by pulvomycin, and Thermoproteus tenax, whose EF-G(EF2)-equivalent factor was sensitive to fusidic acid. On the whole, the results revealed a remarkable intralineage heterogeneity of elongation factors not encountered within each of the two reference (eubacterial and eucaryotic) kingdoms.     

Cloning and sequencing of the gene for the cytoplasmic inorganic pyrophosphatase from the thermoacidophilic archaebacterium Thermoplasma acidophilum.

The gene (ppa) from the thermoacidophilic archaebacterium Thermoplasma acidophilum, encoding the cytoplasmic pyrophosphatase, has been cloned. Two degenerate oligonucleotide probes, synthesized according to the N-terminal amino acid sequence of the isolated protein, were used to screen subgenomic libraries. The DNA-derived amino acid sequence of the archaebacterial enzyme allows, for the first time, comparative studies of cytoplasmic pyrophosphatases to be extended to all three urkingdoms. The archaebacterial pyrophosphatase more closely resembles the eubacterial enzymes on the basis of sequence similarity and subunit size. The majority of amino acid residues considered to be essential for hydrolysis of pyrophosphate seem to have been conserved throughout evolution, as inferred from the results of an alignment of sequences from all three urkingdoms.     

Ultrastructure of lipopolysaccharide isolated from Thermoplasma acidophilum.

The fine structure of lipopolysaccharide isolated from Thermoplasma acidophilum was examined by electron microscopy. Negative staining of the lipopolysaccharide revealed long, ribbon-like structures with some branching. The average width of the lipopolysaccharide ribbons was 5 nm. Treatment of the lipopolysaccharide with 0.5% sodium dodecyl sulfate resulted in the dissociation of the ribbon-like structures to spherical- and vesicular-shaped particles and some short, rodlike structures. Results suggest that the lipopolysaccharide from T. acidophilum is morphologically similar to lipopolysaccharide isolated from gram-negative bacteria.     

Biochemical properties of the proteasome from Thermoplasma acidophilum.

We have purified proteasomes to apparent homogeneity from the archaebacterium Thermoplasma acidophilum. This proteinase has a molecular mass of about 650 kDa and an isoelectric point of 5.6. The proteasome hydrolyses peptide substrates containing an aromatic residue adjacent to the reporter group, as well as [14C]methylated casein optimally at pH 8.5 and 90 degrees C. The enzyme activity is enhanced severalfold by Mg2+ and Ca2+ at 25-500 mM. This increase in activity results primarily from a change in Km. The serine-proteinase inhibitors diisopropylfluorophosphate and 3,4-dichloroisocoumarin irreversibly inhibit the enzyme, obviously by modification of both the alpha and beta subunits in the proteasome. The inhibition of proteasomal activity by the peptidylchloromethanes, Cbz-Leu-Leu-CH2Cl and Cbz-Ala-Ala-Phe-CH2Cl (Cbz, benzyloxycarbonyl), is reversible and predominantly of a competitive type. The enzyme is not activated by any of the compounds that typically stimulate the activities of the eukaryotic proteasome.     

Histone-like protein in the prokaryote Thermoplasma acidophilum.

The DNA of the prokaryote Thermoplasma acidophilum is associated with a histone-like protein that has the following properties: it has a high content (23%) of basic amino acids, is positively charged at neutral pH, is soluble in acid, and can stabilize DNA against thermal denaturation. In polyacrylamide gel electrophoresis, in the presence of either sodium dodecylsulfate or urea, it migrates at the same rate as histone IV (F2a1) of calf thymus. The amino acid composition, however, it unusually rich in the amides of acidic amino acids (16-20%), and it does not appear to be closely homologous to any of the classes of eukaryotic histones. Escherichia coli DNA, on the other hand, was associated with no detectable acid-soluble proteins, and the nucleoprotein thermally denatured at a lower temperature than pure DNA.     

Black lipid membranes of tetraether lipids from Thermoplasma acidophilum.

Black lipid membranes were formed of tetraether lipids from Thermoplasma acidophilum and compared to the bilayer forming lipids diphytanoylphosphatidylcholine and diphythanylglucosylglycerol. Bilayer-forming lipids varied in thickness of black lipid membranes due to the organic solvent used. Measurements of the specific membrane capacitance (Cm = 0.744 microF/cm2) showed that the membrane-spanning tetraether lipids from Thermoplasma acidophilum form a monolayer of a constant thickness of 2.5-3.0 nm no matter from which solvent. This finding corresponds to the results of Gliozzi et al. for the lipids of another archaebacterium, Sulfolobus solfataricus. Black lipid membranes were formed at room temperature with a torus from bilayer-forming lipids, however, the torus could also be formed by the tetraether-lipid itself at room temperature and at defined concentration. In these stable black lipid membranes, conductance was measured in the presence of valinomycin, nonactin, and gramicidin. At 10(-7) M concentration, valinomycin mediated higher conductance in membranes from tetraether lipids (200-1200 microS/cm2) than from bilayer-forming lipids (125-480 microS/cm2). Nonactin, at 10(-6) M concentration, mediated a 6-fold higher conductance in a tetraether lipid membrane than in a bilayer, whereas conductance, in the presence of 5 x 10(-11) M gramicidin could reach higher values in bilayers than in tetraether lipid monolayers of comparable thickness. Monensin did not increase the conductance of black lipid membranes from tetraether lipids under all conditions applied in our experiments. Poly(L-lysine) destroyed black lipid membranes. Lipopolysaccharides from Thermoplasma acidophilum were not able to form stable black lipid membranes by themselves. The lipopolysaccharide complexes from Thermoplasma acidophilum and from Escherichia coli decreased the valinomycin-mediated conductance of monolayer and bilayer membranes. This influence was stronger than that of the polysaccharide dextran.     

Subunit stoichiometry and three-dimensional arrangement in proteasomes from Thermoplasma acidophilum.

The proteasome or multicatalytic proteinase from the archaebacterium Thermoplasma acidophilum is a 700 kDa multisubunit protein complex. Unlike proteasomes from eukaryotic cells which are composed of 10-20 different subunits, the Thermoplasma proteasome is made of only two types of subunit, alpha and beta, which have molecular weights of 25.8 and 22.3 kDa, respectively. In this communication we present a three-dimensional stoichiometric model of the archaebacterial proteasome deduced from electron microscopic investigations. The techniques which we have used include image analysis of negatively stained single particles, image analysis of metal decorated small three-dimensional crystals after freeze-etching and STEM mass measurements of freeze-dried particles. The archaebacterial and eukaryotic proteasomes are almost identical in size and shape; the subunits are arranged in four rings which are stacked together such that they collectively form a barrel-shaped complex. According to a previous immunoelectron microscopic investigation, the alpha-subunits form the two outer rings of the stack, while the two rings composed of beta-subunits, which are supposed to carry the active sites, are sandwiched between them. Each of the alpha- and beta-rings contains seven subunits; hence the stoichiometry of the whole proteasome is alpha 14 beta 14 and the symmetry is 7-fold. Image simulation experiments indicate that the alpha- and beta-subunits are not in register along the cylinder axis; rather it appears that the beta-rings are rotated with respect to the alpha-rings by approximately 25 degrees. In contrast to some previous reports we have not been able to find stoichiometric amounts of RNA associated with highly purified proteolytically active proteasome preparations.