Photochemical cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to rabbit globin messenger RNA

Antisense oligodeoxyribonucleoside methylphosphonates targeted against various regions of mRNA or precursor mRNA are selective inhibitors of mRNA expression both in cell-free systems and in cells in culture. The efficiency with which methylphosphonate oligomers interact with mRNA, and thus inhibit translation, can be considerably increased by introducing photoactivatable psoralen derivatives capable of cross-linking with the mRNA. Oligonucleoside methylphosphonates complementary to coding regions of rabbit alpha- or beta-globin mRNA were derivatized with 4'-(aminoalkyl)-4,5',8-trimethylpsoralens by attaching the psoralen group to the 5' end of the oligomer via a nuclease-resistant phosphoramidate linkage. The distance between the psoralen group and the 5' end of the oligomer can be adjusted by changing the number of methylene groups in the aminoalkyl linker arm. The psoralen-derivatized oligomers specifically cross-link to their complementary sequences on the targeted mRNA. For example, an oligomer complementary to nucleotides 56-67 of alpha-globin mRNA specifically cross-linked to alpha-globin mRNA upon irradiation of a solution of the oligomer and rabbit globin mRNA at 4 degrees C. Oligomers derivatized with 4'-[[N-(2-amino-ethyl)amino]methyl]-4,5',8-trimethylpsoralen gave the highest extent of cross-linking to mRNA. The extent of cross-linking was also determined by the chain length of the oligomer and the structure of the oligomer binding site. Oligomers complementary to regions of mRNA that are sensitive to hydrolysis by single-strand-specific nucleases cross-linked to an approximately 10-30-fold greater extent than oligomers complementary to regions that are insensitive to nuclease hydrolysis.(ABSTRACT TRUNCATED AT 250 WORDS)     

Preparation of oligodeoxyribonucleoside methylphosphonates on a polystyrene support.

An efficient procedure is described for synthesizing deoxyribonucleoside methylphosphonates on polystyrene polymer supports which involves condensing 5'-dimethoxytrityldeoxynucleoside 3'-methylphosphonates. The oligomers are removed from the support and the base protecting groups hydrolyzed by treatment with ethylenediamine in ethanol, which avoids hydrolysis of the methylphosphonate linkages. Two types of oligomers were synthesized: those containing only methylphosphonate linkages, d-Np(Np)nN, and those which terminate with a 5' nucleotide residue, dNp (Np)nN. The latter oligomers can be phosphorylated by polynucleotide kinase, and are separated by polyacrylamide gel electrophoresis according to their chain length. Piperdine randomly cleaves the oligomer methylphosphonate linkages and generates a series of shorter oligomers whose number corresponds to the length of the original oligomer. Apurinic sites introduced by acid treatment spontaneously hydrolyze to give oligomers which terminate with free 3' and 5' OH groups. These reactions may be used to characterize the oligomers.     

Control of ribonucleic acid function by oligonucleoside methylphosphonates

Oligodeoxyribonucleoside methylphosphonates contain nonionic 3'-5' linked methylphosphonate internucleotide bonds in place of the normal charged phosphodiester linkage of natural nucleic acids. These oligomers are resistant to nuclease hydrolysis, can pass through the membranes of mammalian cells in culture and can form stable hydrogen-bonded complexes with complementary nucleotide sequences of cellular RNAs such as mRNA. The oligomers are readily synthesized on insoluble polymer supports. Their chainlength and nucleotide sequence can be determined by chemical sequencing procedures. Oligonucleoside methylphosphonates which are complementary to the 5'-end, initiation codon region, or coding region of rabbit globin mRNA inhibit translation of the mRNA in rabbit reticulocyte lysates and globin synthesis in rabbit reticulocytes. This inhibition is due to the interaction of the oligomers with mRNA and the extent of inhibition is influenced by the secondary structure of the mRNA and the location of oligomer binding site on the mRNA. Oligomers complementary to the initiation codon regions of N, NS and G protein mRNAs of Vesicular stomatitis virus (VSV) inhibit virus protein synthesis in VSV-infected Mouse L-cells. These oligomers do not affect L-cell protein synthesis or growth. Virus protein synthesis and growth can also be selectively inhibited by oligonucleoside methylphosphonates which are complementary to the donor or acceptor splice junctions of virus pre mRNA. An oligomer complementary to the donor splice junction of SV40 large T antigen mRNA inhibits T-antigen synthesis in SV40-infected African green monkey kidney cells but does not inhibit overall cellular protein synthesis.(ABSTRACT TRUNCATED AT 250 WORDS)     

Interaction of psoralen-derivatized oligodeoxyribonucleoside methylphosphonates with single-stranded DNA

Oligodeoxyribonucleoside methylphosphonates derivatized at the 5' end with 4'-(amino-alkyl)-4,5',8-trimethylpsoralen were prepared. The interaction of these psoralen-derivatized methylphosphonate oligomers with synthetic single-stranded DNAs 35 nucleotides in length was studied. Irradiation of a solution containing the 35-mer and its complementary methylphosphonate oligomer at 365 nm gave a cross-linked duplex produced by cycloaddition between the psoralen pyrone ring of the derivatized methylphosphonate oligomer and a thymine base of the DNA. Photoadduct formation could be reversed by irradiation at 254 nm. The rate and extent of cross-linking were dependent upon the length of the aminoalkyl linker between the trimethylpsoralen group and the 5' end of the methylphosphonate oligomer. Methylphosphonate oligomers derivatized with 4'-[[N-(2-aminoethyl)amino]methyl]- 4,5',8-trimethylpsoralen gave between 70% and 85% cross-linked product when irradiated for 20 min at 4 degrees C. Further irradiation did not increase cross-linking, and preirradiation of the psoralen-derivatized methylphosphonate oligomer at 365 nm reduced or prevented cross-linking. These results suggest that the methylphosphonate oligomers undergo both cross-linking and deactivation reactions when irradiated at 365 nm. The extent of cross-linking increased up to 10 microM oligomer concentration and dramatically decreased at temperatures above the estimated Tm of the methylphosphonate oligomer-DNA duplex. The cross-linking reaction was dependent upon the fidelity of base-pairing interactions between the methylphosphonate oligomers and the single-stranded DNA. Noncomplementary oligomers did not cross-link, and the extent of cross-linking of oligomers containing varying numbers of noncomplementary bases was greatly diminished or eliminated.(ABSTRACT TRUNCATED AT 250 WORDS)     

Solid-phase syntheses of oligodeoxyribonucleoside methylphosphonates

Oligodeoxyribonucleoside methylphosphonates of defined sequence of the type d-Np(NP)nN, where n is 6-13, are readily prepared on insoluble polystyrene supports by use of protected 5'-(dimethoxytrityl)deoxyribonucleoside 3'-(methylphosphonic imidazolides) as synthetic intermediates. The imidazolides are prepared in situ by reaction of protected 5'-(dimethoxytrityl)deoxyribonucleoside with methylphosphonic bis(imidazolide) and can be stores in the reaction solution for up to 2 weeks at 4 degrees C with no loss in activity. The condensation reaction is accelerated by the presence of tetrazole, which appears to act as an acid catalyst. The half-life for dimer formation on the polystyrene support is 5 min, and the reaction is 95% complete after 60 min. Although similar kinetics are observed when controlled pore glass is used as the support, the extent of the reaction does not go beyond 78%, even after prolonged incubation. In order to simplify purification and sequence analysis of the oligomer, the 5'-terminal nucleoside unit is linked via a phosphodiester bond. This linkage may be introduced by either an o-chlorophenyl phosphotriester method or a cyanoethyl phosphoramidite method. The latter procedure simplifies the deprotection step, since the cyanoethyl group is readily cleaved by ethylenediamine, which also removes the base protecting groups and cleaves the oligomer from the support. The singly charged oligomers are easily purified by affinity chromatography on DEAE-cellulose. The chain lengths of the oligomers were confirmed after 5'-end labeling with polynucleotide kinase by partial hydrolysis of the methylphosphonate linkages with 1 M aqueous piperidine followed by polyacrylamide gel electrophoresis of the hydrolysate.(ABSTRACT TRUNCATED AT 250 WORDS)     

Syntheses of alternating oligo-2'-O-methylribonucleoside methylphosphonates and their interactions with HIV TAR RNA

Oligonucleotide analogues 15-20 nucleotides in length have been prepared, whose sequences are complementary to nucleotides in the upper hairpin of HIV TAR RNA. These alternating oligonucleoside methylphosphonates, mr-AOMPs, contain 2'-O-methylribonucleosides and alternating methylphosphonate and phosphodiester internucleotide linkages. The methylphosphonate and phosphodiester linkages of these oligomers are highly resistant to hydrolysis by exonuclease activity found in mammalian serum and to endonucleases, such as S1 nuclease. The oligomers were prepared using automated phosphoramidite chemistry and terminate with a 5'-phosphate group, which provides an affinity handle for purification by strong anion exchange HPLC. A 15-mer mr-AOMP, 1676, that is complementary to the 5'-side of the TAR RNA hairpin, including the 3-base bulge and 6-base loop region, forms a 1:1 duplex with a complementary RNA 18-mer, mini-TAR RNA. The T(m) of this duplex is 71 degrees C, which is similar to that of the duplex formed by the corresponding all phosphodiester 15-mer. Introduction of two mismatched bases reduces the T(m) by 17 degrees C. The apparent dissociation constant, K(d), for the 1676/mini-TAR RNA duplex as determined by an electrophoretic mobility shift assay at 37 degrees C is 0.3 nM. Oligomer 1676 also binds tightly to the full length TAR RNA target under physiological conditions (K(d) = 20 nM), whereas no binding was observed by the mismatched oligomer. A 19-mer that is complementary to the entire upper hairpin also binds to TAR RNA with a K(d) that is similar to that of 1676, a result that suggests only part of the oligomer binds. When two of the methylphosphonate linkages in the region complementary to the 6-base loop are replaced with phosphodiester linkages, the K(d) is reduced by approximately a factor of 10. This result suggests that interactions between TAR RNA and the oligomer occur initially with nucleotides in the 6-base loop, and that these interactions are sensitive to presence and possibly the chirality of the methylphosphonate linkages in the oligomer. The high affinities of mr-AOMPs for TAR RNA and their resistance to nuclease hydrolysis suggests their potential utility as antisense agents in cell culture.     

Antisense oligodeoxynucleoside methylphosphonate inhibition of mouse c-myc p65 protein expression in E mu-c-myc transgenic mice.

In transgenic mice bearing a murine immunoglobulin enhancer/c-myc fusion transgene (E mu-myc), it was found that methylphosphonates do not induce acute toxicity following intravenous administration of a 300 nmol dose. In addition, recovery of methylphosphonates from the blood plasma of treated mice indicated that the oligomers remained intact up to 3 hours, while their concentrations decreased rapidly for the first hour, then slowly decreased over the next two hours. Finally, methylphosphonate oligomers targeted against c-myc mRNA inhibited production of c-myc p65 protein in peripheral and splenic lymphocytes, relative to a scrambled sequence oligomer, 4 hours after injection of a 300 nmol dose, as indicated by immunofluorescence of fixed cells stained with an anti-c-myc antiserum.     

Reactivity of oligonucleotide derivatives, containing a methylphosphate group. Affinity modification of target DNA by 4-N-(methyl-N-2-chlorethylamino)benzyl 3'- and 5'-phosphamide derivatives of octathymidylate containing methylphosphonate residues

Modification of 5'-32P-labelled octadecadeoxyribonucleotide d(pC5A8C5) (III) with octathymidylate methylphosphonate derivatives bearing both 3'- and 5'-terminal alkylating 4-(N-2-chloroethyl-N-methylamino)benzylphosphoamide residue has been investigated. Yield in the modification depends on configuration of methylphosphonate fragment, in case of Rp-isomer it may amount to 90%. Specificity of alkylation of nucleic acide target (III) by reagents based on the oligonucleotide methylphosphonates is almost the same as by reagents based on the oligonucleotides having phosphodiester internucleotide bonds.     

Preparation of trimers and tetramers of mixed sequence oligodeoxynucleoside methylphosphonates and assignment of configurations at the chiral phosphorus.

Synthesis of stereoregular DNA methylphosphonates has been accomplished for homo-oligomers, but remains a formidable problem for oligomers of a defined antisense target sequence. In this work, four trimer and tetramer deoxynucleoside methylphosphonates of mixed sequence (dACA, dCCAA, dAGGG, and dGCAT) were prepared by block coupling of diastereomerically pure dimers with either monomers or other diastereomerically pure dimers. These oligomers were separated chromatographically into individual diastereomers, and the configurations of the chiral methylphosphonate linkages were assigned. Three types of methods were used to assign configuration of a new methylphosphonate linkage: preparation of the same diastereomer through multiple synthetic pathways, base hydrolysis, and acid hydrolysis. Hydrolysis of the diastereomerically pure oligomers into component dimers and monomers was followed by chromatographic comparison with control dimers of known configuration. In all cases studied, oligomers with R configurations displayed faster elution from silica gel than did oligomers with the respective S configuration. NMR spectra of individual diastereomers of dACA were studied, revealing characteristic differences in chemical shifts which may prove useful in configurational assignments of longer oligomers. Thus, these data provide a methodological basis for synthesis and configurational assignment of longer methylphosphonate oligomers to use as antisense probes.     

Sequence dependent effects in methylphosphonate deoxyribonucleotide double and triple helical complexes.

Deoxyribooligonucleotides containing 19 repeating bases of A, T or U were prepared with normal phosphodiester (dA19, dT19, dU19) or methylphosphonate (dA*19, dT*19, dU*19) linkages. Complexes of these strands have been investigated at 1:1 and 1:2 molar ratios (purine:pyrimidine) by thermal melting and gel electrophoresis. There are dramatic sequence dependent differences in stabilities of complexes containing methylphosphonate strands. Duplexes of dA*19 with dT19 or dU19 have sharp melting curves, increased Tm values, and slopes of Tm versus log (sodium ion activity) plots reduced by about one half relative to their unmodified 'parent' duplexes. Duplexes of dA19 with either dT*19 or dU*19, however, have broader melting curves, reduced Tm values at most salt concentrations and slopes of less than one tenth the values for the unmodified duplexes. Duplex stabilization due to reduced phosphate charge repulsion is offset in the pyrimidine methylphosphonate complexes by steric and other substituent effects. Triple helical complexes with dA19 + 2dT19 and dA19 + 2dU19, which can be detected by biphasic melting curves and gel electrophoresis, are stable at increased Na+ or Mg+2 concentrations. Surprisingly, however, no triple helix forms, even at very high salt concentrations, when any normal strand(s) is replaced by a methylphosphonate strand. Since triple helical complexes with methylphosphonates have been reported for shorter oligomers, inhibition with larger oligomers may vary due to their length and extent of substitution.     

Photo-cross-linking of psoralen-derivatized oligonucleoside methylphosphonates to single-stranded DNA.

The preparation of oligodeoxyribonucleoside methylphosphonates derivatized with 3-[(2-aminoethyl)carbamoyl]psoralen [(ae)CP] is described. These derivatized oligomers are capable of cross-linking with single-stranded DNA via formation of a photoadduct between the furan side of the psoralen ring and a thymidine of the target DNA when the oligomer-target duplex is irradiated with 365-nm light. The photoreactions of (ae)CP-derivatized methylphosphonate oligomers with single-stranded DNA targets in which the position of the psoralen-linking site is varied are characterized and compared to results obtained with oligomers derivatized with 4'-[[N-(aminoethyl)amino]methyl]-4,5',8-trimethylpsoralen [(ae)AMT]. It appears that the psoralen ring can stack on the terminal base pair formed between the oligomer and its target DNA or can intercalate between the last two base pairs of the oligomer-target duplex. Oligomers derivatized with (ae)CP cross-link efficiently to a thymidine located in the last base pair (n position) or 3' to the last base pair (n + 1 position) of the target, whereas the (ae)AMT-derivatized oligomers cross-link most efficiently to a thymidine located in the n + 1 position. The results show that both the extent and kinetics of cross-linking are influenced by the location of the psoralen-linking site in the oligomer-target duplex.     

Heterogeneity of the 3'' end of minus-strand RNA in the poliovirus replicative form.

The 3' terminus of the strand (minus strand) complementary to poliovirion RNA (plus strand) has been examined to see whether this sequence extends to the 5'-nucleotide terminus of the plus strand, or whether minus-strand synthesis terminates prematurely, perhaps due to the presence of a nonreplicated nucleotide primer for initiation of plus-strand synthesis. The 3' terminus was labeled with 32P using [5'-32P]pCp and RNA ligase, and complete RNase digests were performed with RNases A, T1, and U2. 32P-oligonucleotides were analyzed for size by polyacrylamide-urea gel electrophoresis. The major oligonucleotide products formed were consistent with the minus strand containing 3' ends complementary and flush with the 5' end of the plus strand. However, a variable proportion of the isolated minus strands from different preparations were heterogeneous in length and appeared to differ from each other by the presence of one, two, or three 3'-terminal A residues.     

Solid-phase synthesis of oligo-2-pyrimidinone-2'-deoxyribonucleotides and oligo-2-pyrimidinone-2'-deoxyriboside methylphosphonates.

A synthetic method was developed for the synthesis of oligodeoxyribonucleotides and oligodeoxyribonucleoside methylphosphonates comprised exclusively of the fluorescent 2-pyrimidinone base for the first time. The method utilized the solid-phase 2-cyanoethylphosphoramidite and methylphosphonamidite chemistry for internucleotide couplings and a baselabile oxalyl linkage to anchor the oligomers onto the CPG support. Cleavage of the oligomers from the support was effected by a short treatment of the support with 5% ammonium hydroxide in methanol at room temperature, without any degradation of the base-sensitive 2-pyrimidinone residues or the base-sensitive methylphosphonate backbone.     

3'-methylphosphonate-modified oligo-2'-O-methylribonucleotides and their Tat peptide conjugates: uptake and stability in mouse fibroblasts in culture

Antisense oligo-2'-O-methylribonucleotides and their methylphosphonate derivatives show high binding affinities for their complementary targets under essentially physiological conditions. Additionally, the methylphosphonate linkage is resistant to nuclease hydrolysis. Here we show that a single methylphosphonate internucleotide linkage at the 3'-end of an oligo-2'-O-methylribonucleotide is sufficient to prevent degradation by the 3'-exonuclease activity found in mammalian serum. Complexes formed between a cationic lipid, Oligofectamine, and 5'-[(32)P]-labeled methylphosphonate modified oligo-2'-O-methylribonucleotides are taken up by mouse L(929) fibroblasts in culture. The extent of uptake appears to be dependent upon the sequence of the oligonucleotide. Examination of lysates of oligonucleotide treated cells by polyacrylamide gel electrophoresis showed that no degradation of the oligonucleotide occurred, even after incubation for 24 h. A fluorescein-derivatized oligomer was shown to localize mainly in the cell nucleus as monitored by fluorescence microscopy. Covalent conjugates of fluorescein-derivatized 3'-methylphosphonate modified oligo-2'-O-methylribonucleotides with Tat peptide, a cell permeating peptide, were also prepared. The Tat peptide was coupled to the 5'-end of the oligonucleotide using either disulfide coupling chemistry or conjugation of a keto derivative of the Tat peptide via a 4-(2-aminooxyethoxy-2-(ethylureido)quinoline group at the 5'-end of the oligonucleotide. Although formation of the Tat peptide conjugates was confirmed by mass spectrometry, the propensity of these oligonucleotides to form aggregates and their apparent high affinity for plastic and glass made the conjugates unsuitable for studies of uptake by cells in culture.     

DNA triplex formation of oligonucleotide analogues consisting of linker groups and octamer segments that have opposite sugar-phosphate backbone polarities

The DNA oligomer analogues 3'd(CTTTCTTT)5'-P4-5'd(TTCTTCTT)3' (IV), 5'd-(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5' (V), and 5'd(TTTCTTTC)3'-P2-3'd(CTTTCTTT)5'-P4-5'd-(TTCTTCTT)3' (VI) (P2 = P*P and P4 = P*P*P*P, where P = phosphate and * = 1,3-propanediol) have been synthesized. These oligomers consist of a linker group or groups and homopyrimidine oligonucleotides which have opposite sugar-phosphate backbone polarities. These oligomer analogues are designed to form triplexes with a duplex, 5'd(AAAGAAAGCCCTTTCTTTAAGAAGAA)3'.5'd(TTCTTCTTAAA- GAAAGGGCTTTCTTT)3' (I), which contains small homopurine clusters alternately located in both strands. The length of the linker groups, P2 and P4, was based upon a computer modeling analysis. Triplex formation by the unlinked octamers 5'd(TTCTTCTT)3' (II) and 5'd(TTTCTTTC)3' (III) and the linked oligomer analogues IV-VI with the target duplex was studied by thermal denaturation at pH 5.2. The order of stabilities of triplex formation by these oligomers was I-V much much greater than I-IV greater than I-(II, III). The mixture of I and VI showed two transitions corresponding to the dissociation of the third strand. The higher transition corresponded to the dissociation of 3'-3'-linked octamer segments, and the lower one corresponded to the dissociation of 5'-5'-linked octamer segments. The Tm of the latter transition was higher than that of the I-IV triplex; thus the triplex formed by the 5'-5'-linked octamer segment was stabilized by the triplex formed by the 3'-3'-linked octamer segments in the I-VI triplex. Triplex formation of this system was also studied in the presence of ethidium bromide.(ABSTRACT TRUNCATED AT 250 WORDS)     

Triplex formation by psoralen-conjugated chimeric oligonucleoside methylphosphonates

Interactions between nuclease-resistant, 5'-psoralen-conjugated, chimeric methylphosphonate oligodeoxyribo- or oligo-2'-O-methylribo-triplex-forming oligomers (TFOs) and a purine tract found in the envelope gene of HIV proviral DNA (env-DNA) were investigated by gel mobility shift assays or by photo-cross-linking experiments. These chimeric TFOs contain mixtures of methylphosphonate and phosphodiester internucleotide bonds. A pyrimidine chimeric TFO composed of thymidine and 5-methyl-2'-deoxycytidine (C), d-PS-TpCpTpCpTpCpTpTpTpTpTpTpCpTpC (1mp) where PS is trimethylpsoralen and p is methylphosphonate, forms a stable triplex with env-DNA whose dissociation constant is 1. 3 microM at 22 degrees C and pH 7.0. The dissociation constant of chimeric TFO 2mp, d-PS-UpCpTpCpTpCpTpUpTpUpTpUpCpTpC, decreased to 400 nM when four of the thymidines in 1mp were replaced by 5-propynyl-2'-deoxyuridines (U), a result consistent with the increased stacking interactions and hydrophobic nature of 5-propynyl-U. An even greater decrease, 470 -50 nM, was observed for the all-phosphodiester versions of 1mp and 2mp. The differences in behavior of the chimeric versus the all-phosphodiester oligomers may be related to differences in the conformations between the propynyl-U-substituted versus the nonsubstituted TFOs. Thus, in the chimeric oligomer, the stabilizing effect of the propynyl-U's may be offset by the reduced ability of the methylphosphonate backbone to assume an A-type conformation, a conformation that appears to be preferred by propynyl-U-containing TFOs. A chimeric oligo-2'-O-methylribopyrimidine with the same sequence as 1mp also formed a stable triplex, K(d) = 1.4 microM, with env-DNA. In contrast to the behavior of the pyrimidine TFOs, antiparallel A/G oligomers and parallel or antiparallel T/G oligomers did not form triplexes with env-DNA, even at oligomer concentrations of 10 microM. This lack of binding may be a consequence of the low G content (33%) of the triplex binding site. Irradiation of triplexes formed between the pyrimidine TFOs and env-DNA resulted in formation of photoadducts with either the upper-strand C or the lower-strand T at the 5'-CpA-3' duplex/triplex junction. No interstrand cross-links were observed. The presence of a 5-propynyl-U at the 5'-end of the oligomer caused a reduction in the amount of upper-strand photoadduct but had no effect on photoadduct formation with the lower strand, suggesting that increased stacking interactions caused by the presence of the 5-propynyl-U change the orientation of psoralen with respect to the upper-strand C. The ability of chimeric methylphosphonate TFOs to bind to DNA, combined with their resistance to degradation by serum 3'-exonucleases, suggests that they may have utility in biological experiments.     

Use of EDTA derivatization to characterize interactions between oligodeoxyribonucleoside methylphosphonates and nucleic acids

EDTA-derivatized oligonucleoside methylphosphonates were prepared and used to characterize hybridization between the oligomers and single-stranded DNA or RNA. The melting temperatures of duplexes formed between an oligodeoxyribonucleotide 35-mer and complementary methylphosphonate 12-mers were 4-12 degrees C higher than those of duplexes formed by oligodeoxyribonucleotide 12-mers as determined by spectrophotometric measurements. Derivatization of the methylphosphonate oligomers with EDTA reduced the melting temperature by 5 degrees C. Methylphosphonate oligomer-nucleic acid complexes were stabilized by base stacking interactions between the terminal bases of the two oligomers binding to adjacent binding sites on the target. In the presence of Fe2+ and DTT, the EDTA-derivatized oligomers produce hydroxyl radicals that cause degradation of the sugar-phosphate backbone of both targeted DNA and RNA. Degradation occurs specifically in the region of the oligomer binding site and is approximately 20-fold more efficient for single-stranded DNA than for RNA. In comparison to the presence of one oligomer, the extent of target degradation was increased considerably by additions of two oligomers that bind at adjacent sites on the target. For example, the extent of degradation of a single-stranded DNA 35-mer caused by two contiguously binding oligomers, one of which was derivatized by EDTA, was approximately 2 times greater than that caused by the EDTA-derivatized oligomer alone. Although EDTA-derivatized oligomers are stable for long periods of time in aqueous solution, they undergo rapid autodegradation in the presence of Fe2+ and DTT with half-lives of approximately 30 min. This autodegradation reaction renders the EDTA-derivatized oligomers unable to cause degradation of their complementary target nucleic acids.(ABSTRACT TRUNCATED AT 250 WORDS)     

Chemical synthesis of DNA oligomers containing cytosine arabinoside.

The solid phase phospite triester synthesis of oligodeoxynucleotides containing cytosine arabinoside (araC) is described. A protected araC phosphoramadite was prepared for the introduction of araC residues at 5'termini and internucleotide positions in DNA oligomers. These oligomers were utilized to demonstrate the formation of correct 3'-5' linkages, to test for alkaline lability at the araC site, and to study the stability of duplexes containing araC-G base pairs. For the introduction of araC residues at 3' terminal positions, a protected derivative of araC was coupled to functionalized silica. This material was used to prepare a test oligomer which was characterized enzymatically.     

Sequence analysis of 5''[32P] labeled mRNA and tRNA using polyacrylamide gel electrophoresis.

Sequence analysis of 5'-[32P] labeled tRNA and eukaryotic mRNA using an adaptation of a method recently described by Donis-Keller, Maxam and Gilbert for mapping guanines, adenines and pyrimidines from the 5'-end of an RNA is described. In addition, a technique utilizing two-dimensional polyacrylamide gel electrophoresis for identification of pyrimidines within a sequence is described. 5'-[32P] Labeled rabbit beta-globin mRNA and N. crassa mitochondrial initiator tRNA were partially digested with T1- RNase for cleavage at G residues, with U2-RNase for cleavage at A residues, with an extracellular RNase from B. cereus for cleavage at pyrimidine residues and with T2-RNase or with alkali for cleavage at all four residues. The 5'-[32P] labeled partial digestion products were separated according to their size, by electrophoresis in adjacent lanes of a polyacrylamide slab gel and the location of G's, A's and of pyrimidines extending 60-80 nucleotides from the 5'-end of the RNA determined. Two-dimensional polyacrylamide gel electrophoresis was used to separate the 5'-[32P] labeled fragments present in partial alkali digests of a 5'-[32P] labeled mRNA. The mobility shifts corresponding to the difference of a C residue were distinct from those corresponding to a U residue and this formed the basis of a method for distinguishing between the pyrimidines.