Subfamily relationships and clustering of rabbit C repeats

C repeats constitute the predominant family of short interspersed repeats (SINEs) in the rabbit genome. Determination of the nucleotide sequence 5' to rabbit zeta-globin genes reveals clusters of C repeats, and analysis of these and other sequenced regions of rabbit chromosomes shows that the C repeats have a strong tendency to insert within or in close proximity to other C repeats. An alignment of 44 members of the C repeat family shows that they are composites of different sequences, including a tRNA-like sequence, a conserved central core, a stretch of repeating CT dinucleotides, and an A-rich tract. Cladograms generated by both parsimony and cluster analysis subdivide the C repeats into at least three distinct subfamilies. Nucleotides at sites diagnostic for subfamilies appear to have changed in a punctuated and progressive manner during evolution, indicating that a limited number of progenitors have given rise to new repeats in waves of dispersion. C repeats that insert into preexisting C repeats belong to subfamilies that are proposed to have been propagated more recently; hence, these data support the model of dispersion in successive waves. The divergence among the oldest group of C repeats is greater than that observed for the analogous Alu repeats in humans, indicating that rabbit C repeats have been propagating longer than human Alu repeats. The improved consensus sequence for these repeats is similar to that of the predominant artiodactyl SINE in both the tRNA-like region and a central region. Because members of different subfamilies cross-hybridize very poorly, hybridization data with representatives of each subfamily provide a new minimal estimate, 234,000, for the copy number of C repeats in the rabbit haploid genome, although it is likely that the actual value is closer to 1 million.     

Sequence and comparative analysis of the rabbit alpha-like globin gene cluster reveals a rapid mode of evolution in a G + C-rich region of mammalian genomes

A sequence of 10,621 base-pairs from the alpha-like globin gene cluster of rabbit has been determined. It includes the sequence of gene zeta 1 (a pseudogene for the rabbit embryonic zeta-globin), the functional rabbit alpha-globin gene, and the theta 1 pseudogene, along with the sequences of eight C repeats (short interspersed repeats in rabbit) and a J sequence implicated in recombination. The region is quite G + C-rich (62%) and contains two CpG islands. As expected for a very G + C-rich region, it has an abundance of open reading frames, but few of the long open reading frames are associated with the coding regions of genes. Alignments between the sequences of the rabbit and human alpha-like globin gene clusters reveal matches primarily in the immediate vicinity of genes and CpG islands, while the intergenic regions of these gene clusters have many fewer matches than are seen between the beta-like globin gene clusters of these two species. Furthermore, the non-coding sequences in this portion of the rabbit alpha-like globin gene cluster are shorter than in human, indicating a strong tendency either for sequence contraction in the rabbit gene cluster or for expansion in the human gene cluster. Thus, the intergenic regions of the alpha-like globin gene clusters have evolved in a relatively fast mode since the mammalian radiation, but not exclusively by nucleotide substitution. Despite this rapid mode of evolution, some strong matches are found 5' to the start sites of the human and rabbit alpha genes, perhaps indicating conservation of a regulatory element. The rabbit J sequence is over 1000 base-pairs long; it contains a C repeat at its 5' end and an internal region of homology to the 3'-untranslated region of the alpha-globin gene. Part of the rabbit J sequence matches with sequences within the X homology block in human. Both of these regions have been implicated as hot-spots for recombination, hence the matching sequences are good candidates for such a function. All the interspersed repeats within both gene clusters are retroposon SINEs that appear to have inserted independently in the rabbit and human lineages.     

Comparative analysis of sequence characteristics of imprinted genes in human, mouse, and cattle

Genomic imprinting is an epigenetic mechanism that results in monoallelic expression of genes depending on parent-of-origin of the allele. Although the conservation of genomic imprinting among mammalian species has been widely reported for many genes, there is accumulating evidence that some genes escape this conservation. Most known imprinted genes have been identified in the mouse and human, with few imprinted genes reported in cattle. Comparative analysis of genomic imprinting across mammalian species would provide a powerful tool for elucidating the mechanisms regulating the unique expression of imprinted genes. In this study we analyzed the imprinting of 22 genes in human, mouse, and cattle and found that in only 11 was imprinting conserved across the three species. In addition, we analyzed the occurrence of the sequence elements CpG islands, C + G content, tandem repeats, and retrotransposable elements in imprinted and in nonimprinted (control) cattle genes. We found that imprinted genes have a higher G + C content and more CpG islands and tandem repeats. Short interspersed nuclear elements (SINEs) were notably fewer in number in imprinted cattle genes compared to control genes, which is in agreement with previous reports for human and mouse imprinted regions. Long interspersed nuclear elements (LINEs) and long terminal repeats (LTRs) were found to be significantly underrepresented in imprinted genes compared to control genes, contrary to reports on human and mouse. Of considerable significance was the finding of highly conserved tandem repeats in nine of the genes imprinted in all three species. Electronic supplementary material The online version of this article (doi: ) contains supplementary material, which is available to authorized users.     

A novel abundant family of retroposed elements (DAS-SINEs) in the nine-banded armadillo (Dasypus novemcinctus)

About half of the mammalian genome is composed of retroposons. Long interspersed elements (LINEs) and short interspersed elements (SINEs) are the most abundant repetitive elements and account for about 21% and 13% of the human genome, respectively. SINEs have been detected in all major mammalian lineages, except for the South American order Xenarthra, also termed Edentata (armadillos, anteaters, and sloths). Investigating this order, we discovered a novel high-copy-number family of tRNA derived SINEs in the nine-banded armadillo Dasypus novemcinctus, a species that successfully crossed the Central American land bridge to North America in the Pliocene. A specific computer algorithm was developed, and we detected and extracted 687 specific SINEs from databases. Termed DAS-SINEs, we further divided them into six distinct subfamilies. We extracted tRNA(Ala)-derived monomers, two types of dimers, and three subfamilies of chimeric fusion products of a tRNA(Ala) domain and an approximately 180-nt sequence of thus far unidentified origin. Comparisons of secondary structures of the DAS-SINEs' tRNA domains suggest selective pressure to maintain a tRNA-like D-arm structure in the respective founder RNAs, as shown by compensatory mutations. By analysis of subfamily-specific genetic variability, comparison of the proportion of direct repeats, and analysis of self-integrations as well as key events of dimerization and deletions or insertions, we were able to delineate the evolutionary history of the DAS-SINE subfamilies.     

Novel SINEs families in Medicago truncatula and Lotus japonicus: bioinformatic analysis

Although short interspersed elements (SINEs) were discovered nearly 30 years ago, the studies of these genomic repeats were mostly limited to animal genomes. Very little is known about SINEs in legumes--one of the most important plant families. Here we report identification, genomic distribution and molecular features of six novel SINE elements in Lotus japonicus (named LJ_SINE-1, -2, -3) and Medicago truncatula (MT_SINE-1, -2, -3), model species of legume. They possess all the structural features commonly found in short interspersed elements including RNA polymerase III promoter, polyA tail and flanking repeats. SINEs described here are present in low to moderate copy numbers from 150 to 3000. Bioinformatic analyses were used to searched public databases, we have shown that three of new SINE elements from M. truncatula seem to be characteristic of Medicago and Trifolium genera. Two SINE families have been found in L. japonicus and one is present in both M. truncatula and L. japonicus. In addition, we are discussing potential activities of the described elements.     

Artiodactyl interspersed DNA repeats in cetacean genomes

Interspersed repeats that emerged at different evolutionary times are informative in mammalian phylogeny. Here we show that the ancient short interspersed elements (SINEs) ARE1 and ARE2 are abundantly present in the genomes of artiodactyls and cetaceans but not in other mammalian genomes. This supports the classification of the cetaceans with the artiodactyls by a shared character that is unlikely to be the result of convergence. Received: 16 October 1996 / Accepted: 13 December 1996     

Ubiquitous mammalian-wide interspersed repeats (MIRs) are molecular fossils from the mesozoic era.

Short interspersed elements (SINEs) are ubiquitous in mammalian genomes. Remarkable variety of these repeats among placental orders indicates that most of them amplified in each lineage independently, following mammalian radiation. Here, we present an ancient family of repeats, whose sequence divergence and common occurrence among placental mammals, marsupials and monotremes indicate their amplification during the Mesozoic era. They are called MIRs for abundant Mammalian-wide Interspersed Repeats. With approximately 120,000 copies still detectable in the human genome (0.2-0.3% DNA), MIRs represent a 'fossilized' record of a major genetic event preceding the radiation of placental orders.     

Evolutionary applications of MIRs and SINEs

It is believed that short interspersed elements (SINEs) are irreversibly inserted into genomes. We use this concept to try to deduce the evolution of whales using sequence and hybridization studies. The observation that microsatellites are associated with SINEs lead us to screen sequences surrounding cetacean microsatellites for artiodactyl-derived SINEs. Two sequences that were thought to be cetacean SINEs and the bovine SINE were aligned for comparison to sequences flanking microsatellites from ungulates. The bovine SINE was observed only in ruminants while CetSINE1 and 2 were found in mammals. Hybridization studies using these three SINEs revealed that CetSINE1 was found in all ungulates and cetaceans with the strongest hybridization signal observed in the hippopotamus and beluga; CetSINE2 hybridized to all ungulate suborders, while the bovine SINE was only observed in Ruminantia. It is proposed that these putative SINEs are not 'generic' SINEs but mammalian-wide interspersed repeats (MIRs). Caution is urged: what initially appears to be a SINE may instead be a MIR and have reduced evolutionary resolving power.     

Conserved nucleotide differences and subfamily structure of porcine short interspersed elements

Interspersed elements are ubiquitous in the genomes of higher eukaryotes and account for over a third of the genomic DNA (Smit 1996). In swine the short interspersed elements, SINEs or PREs (porcine repetitive elements), have been found in a number of introns and 3' untranslated regions of different genes. However, compared to human Alu repeats the number of available PRE DNA sequences is still limited. In this study we have compared 85 PREs selected from DNA sequence database entries. The PREs were aligned and for each nucleotide position the relative frequencies of the four bases were calculated. A consensus sequence was derived from the first base usage. Similar to studies of SINEs in other species, the analysis showed that most mutations in PREs occur at CpG dinucleotide hot spots. The position variability for the two most frequent bases shows a bimodal distribution. The analysis suggests that the porcine SINEs can be divided into three major subfamilies sharing conserved nucleotide similarities.     

MyrSINEs: a novel SINE family in the anteater genomes

Recent rapid generation of genomic sequence data has allowed many researchers to perform comparative analyses in various mammalian species. However, characterization of transposable elements, such as short interspersed repetitive elements (SINEs), has not been reported for several mammalian groups. Because SINEs occupy a large portion of the mammalian genome, they are believed to have contributed to the constitution and diversification of the host genomes during evolution. In the present study, we characterized a novel SINE family in the anteater genomes and designated it the MyrSINE family. Typical SINEs consist of a tRNA-related, a tRNA-unrelated and an AT-rich (or poly-A) region. MyrSINEs have only tRNA-related and poly-A regions; they are included in a group called t-SINE. The tRNA-related regions of the MyrSINEs were found to be derived from tRNA^Gly. We demonstrate that the MyrSINE family can be classified into three subfamilies. Two of the MyrSINE subfamilies are distributed in the genomes of both giant anteater and tamandua, while the other is present only in the giant anteater. We discuss the evolutionary history of MyrSINEs and their relationship to the evolution of anteaters. We also speculate that the simple structure of t-SINEs may be a potential evolutionary source for the generation of the typical SINE structure.     

Statistical evidence for ancestral correlation patterns

Statistical correlations in DNA sequences are an important source of information for processes of genome evolution. As a special case of such correlations and building up on our previous work, here we study, how short-range correlations in Eukaryotic genomes change under elimination of various classes of repetitive DNA. Our main result is that a residual correlation pattern, common to most mammalian species, emerges under elimination of all repetitive DNA, suggesting features of an ancestral correlation signature. Furthermore, using this general framework, we find classes of repeats, which upon deletion move the correlation pattern towards this residual pattern (simple repeats and SINEs) or away from this residual pattern (LINEs). These findings suggest that the common correlation pattern visible in the mammalian species after repeat elimination can be associated with a common mammalian ancestor.     

Replication time of interspersed repetitive DNA sequences in hamsters

The replication time of 34 hamster genomic DNA segments containing interspersed repeat sequences was determined by probing the cloned segments with nick-translated early- and late-replicating hamster DNA. One-third of these cloned families replicated early, one-third replicated late, and one-third replicated without temporal bias. 19 different inserts from these clones along with the SINE, Alu, and the LINE, A36Fc, were used to probe Southern blots of early- and late-replicating hamster or human DNA. We report long interspersed repeats, LINEs, are selectively partitioned into late-replicating DNA and are often concertedly hypomethylated, while short interspersed repeats, SINEs, are selectively partitioned into early-replicating DNA. For some interspersed repeat families, this partitioning is complete or almost complete. The CCGG frequency is very low in late-replicating DNA. The mammalian chromosome's pattern of early-replicating R-bands and late-replicating G-bands reflects a differential distribution of LINEs and SINEs.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

A Newly Isolated Family of Short Interspersed Repetitive Elements (Sines) in Coregonid Fishes (Whitefish) with Sequences That Are Almost Identical to Those of the Smai Family of Repeats: Possible Evidence for the Horizontal Transfer of Sines

The SmaI family of repeats is present only in the chum salmon and the pink salmon, and it is not present in five other species in the same genus or in other species in closely related genera. In the present study, we showed that another short interspersed repetitive elements (SINEs) family, which is almost identical to the SmaI family, is present in all fishes in the subfamily Coregoninae, being regarded as the most primitive salmonids. This new family of SINEs was designated the SmaI-cor family (SmaI family of repeats in coregonids). The consensus sequence of the SmaI-cor family was found to be 98.6% homologous to that of the SmaI family. Accordingly, it is difficult to explain the high degree of homology between these two families of SINEs by any mechanism other than the horizontal transfer of SINEs. The estimates of the rate of neutral mutation of nuclear genes, comparing chum salmon and European whitefish, confirmed this possibility. Our results strongly suggest that a member(s) of the SmaI-cor family might have been transferred horizontally from one coregonid species to a common ancestor of chum and pink salmon or to these two species independently, to allow subsequent amplification of the SmaI family in their respective genomes.     

Bov-B-mobilized SINEs in vertebrate genomes

Two new short retroposon families (SINEs) have been found in the genome of springhare Pedetes capensis (Rodentia). One of them, Ped-1, originated from 5S rRNA, while the other one, Ped-2, originated from tRNA-derived SINE ID. In contrast to most currently active mammalian SINEs mobilized by L1 long retrotransposon (LINE), Ped-1 and Ped-2 are mobilized by Bov-B, a LINE family of the widely distributed RTE clade. The 3' part of these SINEs originates from two sequences in the 5' and 3' regions of Bov-B. Such bipartite structure of the LINE-derived part has been revealed in all Bov-B-mobilized SINEs known to date (AfroSINE, Bov-tA, Mar-1, and Ped-1/2), which distinguishes them from other SINEs with only a 3' LINE-derived part. Structural analysis and the distribution of Bov-B LINEs and partner SINEs supports the horizontal transfer of Bov-B, while the SINEs emerged independently in lineages with this LINE.     

SINEs in mammalian genomes can serve as additional signals in formation of facultative heterochromatin

Using computer-based methods we determined the global distribution of short interspersed nuclear elements (SINEs) in the human and mouse X chromosomes. It has been shown that this distributions is similar to the distributions of CpG islands and genes but is different from the distribution of LINE1 elements. Since SINEs (human Alu and mouse B2) may have binding sites for Polycomb protein YY1, we suggest that these repeats can serve as additional signals ("boosters") in Polycomb-dependent silencing of gene rich segments during X inactivation.