Some studies of the effects of aflatoxin B1 in vivo and in vitro on nucleic acid synthesis in rat and mouse.

The mouse compared with the rat, is more resistent to the acute toxic action of aflatoxin B1 and is refractory to its hepatocarcinogenic properties. Aflatoxin B1 inhibits DNA synthesis more strongly than RNA synthesis in the rat, and both nucleic acid syntheses more strongly in rat than in the mouse. Mouse hepatic microsomes, like those of the rat, are capable of metabolizing aflatoxin B1 in vitro in the presence of NADPH, to an active form which binds to DNA both in solution and in intact nuclei and also inhibits nuclear RNA synthesis. Non NADPH-dependent binding of aflatoxin B1 to nuclei is not effective in inhibiting RNA polymerase and is largely removed by washing with lipid solvents. Mouse nuclear RNA polymerases particularly Mn 2+ (NH4)2SO4 primed acitivity are more resistant to inhibition in vitro by activated aflatoxin B1 than are the corresponding enzyme activities in rat liver nuclei. This would appear to be due to the bound aflatoxin B1 being less efficient in the case of the mouse nucleus, in inhibiting RNA synthesis. Mouse liver slices exhibit a much lesser degree of inhibition of RNA synthesis by aflatoxin B1 than do rat liver slices. Accompanying this is a lower level of binding of aflatoxin B1 to subcellular particulate fractions in the mouse liver slice compared to the rat, this disparity being most marked in the case of the nuclear fraction. The suggestion is made that the resistance of RNA synthesis in the mouse liver, to aflatoxin B1, and perhaps also resistance to its toxicity, is dependent, not on a lower capacity to activate the toxin, but (a) on a less efficient inhibition of RNA synthesis by nuclear bound toxin, and (b) a detoxifying mechanism at least partially situated in the cytosol fraction.     

Expression of rat liver glutamine transporters in Xenopus laevis oocytes.

As a first step in attempting to isolate the Na(+)-dependent System N transporter from rat liver we have investigated the use of prophase-arrested oocytes from Xenopus laevis for the functional expression of rat liver glutamine transporters. Individual oocytes, defolliculated by collagenase treatment, were injected with 50 nl of a 1 mg.ml-1 solution of poly(A)+ RNA (mRNA) isolated from rat liver. 50 microM L-[3H]glutamine uptake was measured 1-5 days post-injection: after 48 h, poly(A)+ RNA-injected oocytes showed a 60 +/- 12% increase in Na(+)-dependent glutamine uptake compared to controls. This increased uptake showed characteristic features of hepatic System N: that is, it tolerated Li(+)-for-Na+ substitution and was inhibited by the System N substrate L-histidine (5 mM) in Li medium, unlike endogenous Na(+)-dependent glutamine transport. In subsequent experiments rat liver poly(A)+ RNA, size-fractionated by density gradient fractionation, was injected into oocytes. Injection of poly(A)+ RNA of 1.9-2.8 kilobases (kb) in size resulted in a significant stimulation of Na(+)-dependent glutamine transport to 0.362 +/- 0.080 pmol.min-1/oocyte from 0.178 +/- 0.060 pmol.min-1/oocyte in vehicle-injected oocytes (p less than 0.01). A lighter fraction, with poly(A)+ RNA of less than 1.9 kilobases size resulted in a similar increase in Na(+)-dependent glutamine uptake which was largely Li(+)-tolerant: Li(+)-stimulated glutamine uptake in oocytes injected with this fraction increased to 0.230 +/- 0.070 pmol.min-1/oocyte from 0.098 +/- 0.029 pmol.min-1/oocyte in controls (p less than 0.05). This enhanced rate of Li(+)-stimulated glutamine uptake was inhibited 28 and 70%, respectively, by 1 and 5 mM L-histidine. Na(+)-independent uptake of glutamine rose by 72 +/- 12% in oocytes injected with poly(A)+ RNA of 2.8-3.6 kb (p less than 0.001). These results demonstrate that glutamine transporters, with characteristics associated with hepatic Systems N, L, and A (or ASC), can be expressed in X. laevis oocytes injected with specific size fractions of rat liver mRNA.     

Role of endogenous regucalcin in nuclear regulation of regenerating rat liver: suppression of the enhanced ribonucleic acid synthesis activity

The role of endogenous regucalcin in the regulation of ribonucleic acid (RNA) synthesis activity in the nucleus of normal and regenerating rat livers was investigated. Nuclear RNA synthesis was measured by the incorporation of [(3)H]-uridine 5'-triphosphate into the nuclear RNA in vitro. The presence of regucalcin (0.25 or 0.5 microM) in the reaction mixture caused a significant decrease in nuclear RNA synthesis of normal rat liver. alpha-Amanitin (10(-8)-10(-6) M), an inhibitor of RNA polymerase II and III, decreased significantly nuclear RNA synthesis activity. The effect of regucalcin (0.25 microM) in decreasing nuclear RNA synthesis activity was not seen in the presence of alpha-amanitin (10(-6) M). The calcium chloride (10 microM)-increased nuclear RNA synthesis activity was significantly suppressed by the addition of regucalcin (0.25 microM). RNA synthesis activity was significantly enhanced in the nuclei of regenating rat liver obtained at 24, 48, or 72 h after partial hepatectomy. This enhancement was significantly inhibited in the presence of PD98059 (10(-5) M), staurosporine (10(-6) M), or vanadate (10(-3) M). Western analysis of the nuclei of regenerating liver obtained at 24, 48, or 72 h after partial hepatectomy showed a significant increase in regucalcin protein as compared with that of sham-operated rats. The presence of anti-regucalcin monoclonal antibody (25 or 50 ng/ml) in the reaction mixture caused a significant increase in nuclear RNA synthesis activity of normal rat liver. This increase was completely blocked by the addition of regucalcin (1.0 microM). The effect of anti-regucalcin monoclonal antibody (50 ng/ml) in increasing nuclear RNA synthesis activity was significantly enhanced in the nuclei of regenerating liver obtained at 24, 48, or 72 h after partial hepatectomy. This enhancement was significantly suppressed by the addition of alpha-amanitin (10(-6) M), PD98059 (10(-5) M), staurosporine (10(-6) M), or vanadate (10(-3) M) in the reaction mixture. The present study demonstrates that endogenous regucalcin has a suppressive effect on the enhancement of RNA synthesis activity in the nucleus of regenerating rat liver with proliferative cells.     

Comparison of polysomal and nuclear poly(A)-containing RNA populations from normal rat liver and Novikoff hepatoma.

Polysomal and nuclear poly(A)-containing RNA of normal rat liver and Novikoff hepatoma cells have been compared by cDNA.RNA hybridization kinetics. Homologous hybridization reactions revealed at total kinetic complexity of about 1.6 X 10(10) and 1.38 X 10(10) daltons for liver and Novikoff mRNA respectively. The high abundance component present in liver cannot be detected in Novikoff. It was found from heterologous reactions that about 30% by weight of mRNA sequences are specific to liver. Determination of the nuclear poly(A)-containing RNA complexities revealed that about 5.5% and 4% of the haploid genome is expressed in the liver and Novikoff respectively. In a heterologous reaction, up to 30% of the liver cDNA failed to form hybrids with Novikoff nuclear RNA. Cross hybridizations have further revealed abundance shifts in both nuclear and polysomal RNA populations. Some sequences abundant in liver are less abundant in Novikoff and some rare liver sequences are relatively abundant in Novikoff.     

Changes in nuclear and polysomal polyadenylated RNA sequences during rat-liver regeneration.

Nuclear and polysomal polyadenylated RNA populations of normal and 16 hour regenerating rat liver have been compared by mRNA-cDNA hybridisations and by unique DNA saturation experiments. It was found that nuclear polyadenylated RNA hybridises to 6.8% of unique DNA in both normal and 16 hour regenerating rat liver. However, cross-hybridisation experiments using cDNA have shown that 10-15% by weight of nuclear polyadenylated RNA sequences are specific to 16 hour regenerating rat-liver. Since both unique DNA and cDNA hybridisation have shown that normal and 16 hour regenerating rat-liver polysomal polyadenylated RNA populations are qualitatively very similar sequences specific to 16 hour regenerating rat-liver nuclear polyadenylated RNA are nucleus confined. Polysomal RNA sequences which were abundant in normal rat-liver have become less abundant in regenerating rat liver.     

Subcellular distribution of cytochrome c in rat liver. Methods for its extraction and purification

1. A method for the extraction and purification of cytochrome c from rat liver is described. The method depends on multiple chromatography on Amberlite IRC-50 with elution with ammonium phosphate buffers of differing ionic composition and pH, interspersed with gel filtration with Sephadex G-25. Conditions leading to denaturation are avoided and the product is chromatographically pure. 2. The method may be used for the quantitative analysis of cytochrome c either in unfractionated liver or in subcellular fractions. 3. Two pools of cytochrome c were detected, one extractable at pH4.0 with distilled water and the other extracted from the residues of the first extraction with 0.15m-sodium chloride. 4. For subcellular distribution studies the liver was homogenized in 0.3m-sucrose and a nuclear fraction (washed thoroughly to remove trapped mitochondria), a mitochondrial fraction, a heavy microsomal fraction, a standard microsomal fraction and the cell sap were isolated. The mitochondrial fraction was subfractionated further by density-gradient centrifugation. Each fraction was analysed for protein, RNA, DNA, succinate-neotetrazolium oxidoreductase and glucose 6-phosphatase. 5. A total of 123mug. of cytochrome c was obtained/g. wet wt. of rat liver. 6. Values for the percentage subcellular distribution of cytochrome c are: nuclear fraction, 24.4; mitochondrial fraction, 57.2; heavy microsomal fraction, 5.2; standard microsomal fraction, 10.6; cell sap, 2.7. 7. Three out of the eight mitochondrial subfractions separated by gradient centrifugation contained 76% of the cytochrome c and 85% of the succinate-neotetrazolium oxidoreductase present in the mitochondrial fraction. 8. In unfractionated liver 94% of the cytochrome c was extracted at pH4.0 with water whereas in most of the subcellular fractions the corresponding value was approx. 75-80%.     

Ontogeny of cyclic AMP-dependent protein phosphokinase during hepatic development of the rat.

The ontogeny of protein kinase (ATP: protein phosphotransferase, EC 2.7.1.37) and cyclic AMP-binding activity in subcellular fractions of liver was examined during prenatal and postnatal development of the male rat. 1. Protein kinase activity and cyclic AMP-binding activity were found in the nuclear, microsomal, lysosomal-mitochondrial, and soluble liver fractions. 2. The protein kinase activity of the soluble (105 000 X g supernatant) fraction measured with histone F1 as substrate was stimulated by cyclic AMP. Cyclic AMP did not stimulate the protein kinase activity of the particulate fractions. 3. The protein kinase activity of all subcellular fractions increased rapidly from the activity observed in prenatal liver (3-4 days before birth) to reach maximal activity in 2-day-old rats. Thereafter, the protein kinase activity declined more slowly and regained the prenatal levels at 10 days after birth. 4. Considerable latent protein kinase activity was associated with liver microsomal fractions which could be activated by treatment of microsomes with Triton X-100. The latent microsomal protein kinase activity was highest in prenatal liver, at the time of birth, and 2 days after birth. During the subsequent postnatal development the latent microsomal protein kinase activity gradually declined to insignificantly low levels. 5. During the developmental period examined (4 days before birth to age 60-90 days) marked alterations of the cyclic AMP-binding activity were determined in all subcellular fractions of rat liver. In general, cytosol, microsomal, and lysosomal-mitochondrial cyclic AMP-binding activity was highest in 10-11 day-old rats. Nuclear cyclic AMP-binding activity was highest 3-4 days before birth and declined at birth and during the postnatal period. There was no correlation between the developmental alteration of cyclic AMP-binding activity and cyclic AMP dependency of the protein kinase activity in any of the subcellular fractions. This suggests that the measured cyclic AMP-binding activity does not reflect developmental alterations of the cyclic AMP-binding regulatory subunit of cyclic AMP-dependent protein kinase.     

Fractionation of nuclear and cytoplasmic ribonucleic acids from rat tissues on the methylated albumin–kieselguhr column

1. The conformation of RNA was found to affect its behaviour on methylated albumin-kieselguhr chromatography. The less regular the secondary structure of RNA, the more tightly it binds to the methylated albumin-kieselguhr column. 2. The presence of various denaturing agents (such as urea or perchlorate) in the medium while RNA was adsorbed on the column increased the resolving power of the technique as exemplified by the separation of rat liver rRNA into two distinct peaks. A special procedure for selective adsorption of the cytoplasmic DNA-like RNA on the preparative scale has been developed. Polyribosomal mRNA (rapidly labelled RNA formed in the presence of small doses of actinomycin D) can also be adsorbed selectively by the column. 3. A type of tissue specificity was detected in nuclear RNA from rat liver, kidney, thymus and spleen by using a modified salt and temperature gradient for the chromatographic fractionation (Lichtenstein, Piker & Shapot, 1967; Shapot, Lichtenstein & Piker, 1967). It was also found that cytoplasmic RNA from the different rat tissues contained no tenaciously bound fraction at all, whereas it constituted about 50% of the nuclear RNA. The problem of the possible biological function of the tenaciously bound fraction is discussed.     

Effect of triiodothyronine on the content of phospholipids in the rat liver nuclei.

The aim of the present study was to examine the effect of triiodothyronine (T3) on the content of phospholipids and on the incorporation of blood-borne palmitic acid into the phospholipid moieties in the nuclei of the rat liver. T3 was administered daily for 7 days, 10 microg x 100 g(-1). The control rats were treated with saline. Each rat received 14C-palmitic acid, intravenously suspended in serum. 30 min after administration of the label, samples of the liver were taken. The nuclei were isolated in sucrose gradient. Phospholipids were extracted from the nuclei fraction and from the liver homogenate. They were separated into the following fractions: sphingomyelin, phosphatidylcholine, phosphatidylserine, phosphatidylinositol, phosphatidylethanolamine and cardiolipin. The content and radioactivity of each fraction was measured. It was found that treatment with T3 reduced the content of phosphatidylinositol and increased the content of cardiolipin in the nuclear fraction. In the liver homogenate, the content of phosphatidylinositol decreased and the content of phosphatidylethanolamine and cardiolipin increased after treatment with T3. The total content of phospholipids after treatment with T3 remained unchanged, both in the nuclear fraction and in the liver homogenate. T3 reduced the specific activity of phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine and cardiolipin and had no effect on the specific activity of sphingomyelin and phosphatidylinositol both in the fraction of the nuclei and the liver homogenate. It is concluded that excess of triiodothyronine affects the content of phospholipids in the nuclei. The changes in the content of phospholipids in the nuclei largely reflect changes in their content in the liver.     

Subcellular distribution of total poly (A) -containing RNA and ferritin-mRNA in the cytoplasm of rat liver.

Poly(A)-containing RNA was isolated from rat liver microsomes and from the post-microsomal supernatant fraction. Approximately 15% of total rat liver poly(A)-containing RNA was found to be present in the post-microsomal supernatant. The relative capacity for apoferritin synthesis of each poly(A)-containing RNA preparation was measured in a cell-free system derived from wheat germ. The post-microsomal supernatant fraction was found to be highly enriched with ferritin mRNA and accounted for 40–50% of the total ferritin-mRNA present in the cytoplasm of rat liver.     

Differential subnuclear distribution of polyadenylate-rich ribonuclei acid during induction of egg-yolk protein synthesis in male Xenopus liver by oestradiol-17 beta.

A 4-8-fold increase in the rate of hepatic nuclear RNA synthesis occurred within 11 h after a single injection of oestradiol-17 beta to male Xenopus to induce egg-yolk protein synthesis. 2. By using a gentle procedure for fractionating nuclei into their major structurally different components [J. R. Tata& B. Baker (1974) Exp. Cell Res. 83. 111-124], it was found that the hormone-induced increase in the total amount of newly made RNA was associated with a 2-10-fold increase in the poly(A) content of nuclear RNA. 3. When the poly (A) content of nuclear RNA was determined by hybridization to poly[3H](U) or specific binding to oligo(dT)-cellulose, most of the increase (10-fold) in poly (A) content of newly synthesized RNA was associated with the euchromatin fractions, whereas the increase was less marked in the other subnuclear fractions. 4. Resolution of nuclear RNA into poly (A)-poor and poly(A)-rich RNA species by chromatography on oligo(dT)-cellulose, followed by polyacrylamide-gel electrophoresis with sodium dodecyl sulphate or in the pressence of 99% formamide, revealed that the hormone caused a preferential enhancement of high-molecular-weight (25S-60S) poly (A)-rich HnRNA (heterogeneous nuclear RNA,) much of which was associated with euchromatin and not with the nuclear sap. 5. Induction of vitellogenin in male frogs was in particular characterized by the appearance of a high-molecular-weight polyadenylated component exhibiting a peak at 35-36S, i.e. a molecular weight of approx. 2.05x10(6)+/-0.15x10(6). Although there is no evidence as yet that such a polyadenylated high-molecular-weight nuclear RNA species contains sequences corresponding to vitellogenin mRNA, it is possible that a high proportion of the most stable form of the putative nuclear precursor to vitellogenin mRNA induced by oestrogen in male Xenopus liver may be only marginally bigger than the cytoplasmic mRNA, and may at any one time be predominantly associated with the euchromatin fraction.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.     

Chromatin fractionation according to the strength of its matrix bond

Extraction in low salt concentration followed by centrifugation allows rat liver nuclear chromatin to be divided into two fractions: the supernatant chromatin and matrix chromatin. The former fraction contains about 60-70% of initial DNA and about 15% of initial protein along with all five histones, and an insignificant amount of non-histone proteins. RNA synthesis in the matrix chromatin fraction is 2-3 times more intense than that in the original nuclei. The data on gradient centrifugation do not suggest the elongation of RNA molecules synthesized in the matrix fraction. The results obtained as compared with the literature data suggest that the matrix chromatin fraction is enriched with active genes.