共查询到20条相似文献,搜索用时 15 毫秒
1.
The RNA PK5 (GCGAUUUCUGACCGCUUUUUUGUCAG) forms a pseudoknotted structure at low temperatures and a hairpin containing an A.C opposition at higher temperatures (J. Mol. Biol. 214, 455-470 (1990)). CD and absorption spectra of PK5 were measured at several temperatures. A basis set of spectra were fit to the spectra of PK5 using a method that can provide estimates of the numbers of A.U, G.C, and G.U base pairs as well as the number of each of 11 nearest-neighbor base pairs in an RNA (Biopolymers 31, 373-384 (1991)). The fits were close, indicating that PK5 retained the A conformation in the pseudoknot structure and that the fitting technique is not hindered by pseudoknots or A.C oppositions. The results from the analysis were consistent with the pseudoknotted structure at low temperatures and with the hairpin structure at higher temperatures. We concluded that the method of spectral analysis should be useful for determining the secondary structures of other RNAs containing pseudoknots and A.C oppositions. 相似文献
2.
Mg2+ efflux from Mg2+-preloaded chicken erythrocytes is caused by an electroneutral Na+/Mg2+ antiport. It depends specifically on extracellular Na+, according to Michaelis-Menten kinetics (Km = 25 mM), and is reversibly noncompetitively inhibited by amiloride (Ki = 0.59 mM). In contrast to Na+/H+ antiport, Li+, Ca2+ and N-ethylmaleimide do not interfere with Na+/Mg2+ antiport. The Na+/Mg2+ antiport is driven by the intracellular/extracellular Mg2+ gradient. 相似文献
3.
Conformation of an RNA pseudoknot. 总被引:15,自引:0,他引:15
The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al. 相似文献
4.
Many nonenveloped virus particles are stabilized by calcium ions bound in the interfaces between the protein subunits. These ions may have a role in the disassembly process. The small RNA phages of the Leviviridae family have T = 3 quasi-symmetry and are unique among simple viruses in that they have a coat protein with a translational repressor activity and a fold that has not been observed in other viruses. The crystal structure of phage PRR1 has been determined to 3.5 Å resolution. The structure shows a tentative binding site for a calcium ion close to the quasi-3-fold axis. The RNA-binding surface used for repressor activity is mostly conserved. The structure does not show any significant differences between quasi-equivalent subunits, which suggests that the assembly is not controlled by conformational switches as in many other simple viruses. 相似文献
5.
Juan S. Jiménez María J. Benítez Carmen G. Lechuga Manuel Collado Josefa González-Nicólas Francisco J. Moreno 《Molecular and cellular biochemistry》1995,152(1):1-6
In order to elucidate the relationship between hypertension and hypertrophy in the production of heat shock proteins, we studied the induction of the HSP72 synthesis by the heart and gracilis muscles of normo (WKY) and hypertensive (SHR) rats subjected to hyperthermia (42°C±0.5 for 15 min). Two age groups were investigated in each strain: young (2 months, with developing cardiac hypertrophy) and old (18 months, with fully developed chronic cardiac hypertrophy). The gracilis muscle never developed hypertrophy, independently of hypertension or aging. 72 kDa inducible protein was determined by Western blot analysis using a specific monoclonal antibody. We also used a commercial standard, loaded on each blot, to quantitate densitometrically the signal.The heart of young SHR responds to heat shock more than their normotensive age-matched control (298.8±24.7% vs 88.3 ±8.5%, p<0.001). This response is not maintained during aging as we did not find any significant difference between normo-and hypertensive old rats after exposure to hyperthermia (43.6±5.3% vs 65.3±10.4%).Unlike the heart, the gracilis muscle shows a basal spontaneous HSP72 synthesis in both the SHR (71.4±10.8%) and WKY (40.6±11.7%) animals. There was a significant increase in HSP72 synthesis in the gracilis muscle of young SHR with respect to their control (186.2±18.7% vs 115.8±9.9%, p<0.02) which was maintained also during aging (171.9±17.3% vs 95.2±10.5%, p<0.01).In conclusion, these data show that hypertension results in an increased synthesis of HSP72 both in cardiac and gracilis muscle in response to heat shock. This abnormal response is attenuated by aging in the heart but not in the gracilis muscle. Thus, the abnormality seems to be independent from hypertrophy and linked to genetic determination of the disease. 相似文献
6.
Cations‐induced DNA aggregation can modify the local structure of oligonucleotides and has potential applications in medicine and biotechnology. Here, we used atomic force microscopy to investigate λ‐DNA aggregation on Mg2+‐treated glass (Mg2+/glass) and in Mg2+ solution. Atomic force microscopy topography images showed that some DNA fragments were slightly stacked together on 10 mM Mg2+/glass and stacked stronger on ≥50 mM Mg2+/glass. They also showed that DNA aggregated stronger in Mg2+ solution than on Mg2+/glass, ie, DNAs are strongly stacked and twisted at 10 mM Mg2+, rolled together at 50 mM Mg2+, and slightly aggregated to form small particles at 100 mM Mg2+. At a specific condition, ie, heating λ‐DNA to 92°C, cooling down to 75°C, adding Mg2+, and vortexing the resulting solution, DNA strongly aggregated and formed pancake‐like shapes at 10 and 50 mM or a large aggregate at 100 mM Mg2+ solutions. Our results may be helpful for medical applications and gene therapy using cation‐DNA technology. 相似文献
7.
Cap-independent translation of tobacco etch virus is conferred by an RNA pseudoknot in the 5'-leader
The tobacco etch virus (TEV) 5'-leader promotes cap-independent translation in a 5'-proximal position and promotes internal initiation when present in the intercistronic region of a dicistronic mRNA, indicating that the leader contains an internal ribosome entry site. The TEV 143-nucleotide 5'-leader folds into a structure that contains two domains, each of which contains an RNA pseudoknot. Mutational analysis of the TEV 5'-leader identified pseudoknot (PK) 1 within the 5'-proximal domain and an upstream single-stranded region flanking PK1 as necessary to promote cap-independent translation. Mutations to either stem or to loops 2 or 3 of PK1 substantially disrupted cap-independent translation. The sequence of loop 3 in PK1 is complementary to a region in 18 S rRNA that is conserved throughout eukaryotes. Mutations within L3 that disrupted its potential base pairing with 18 S rRNA reduced cap-independent translation, whereas mutations that maintained the potential for base pairing with 18 S rRNA had little effect. These results indicated that the TEV 5'-leader functionally substitutes for a 5'-cap and promotes cap-independent translation through a 45-nucleotide pseudoknot-containing domain. 相似文献
8.
N A Kos'ianenko G Selman-Housein Sosa V N Uverski? E V Frisman 《Molekuliarnaia biologiia》1987,21(1):140-146
The DNA conformation was studied at different relation between Na+ and Me2+ (Mn2+ or Mg2+) ions in solution at the fixed total ionic strength mu. At low mu the intrinsic viscosity of DNA [eta] decreased to the limited fixed value with the increasing of Mn2+ or Mg2+ concentration (CMe2+). At higher mu greater than or equal to 0.1 M [eta] doesn't depend on CMe2+. The presence of Mn2+ in solution caused a decrease of the optical anisotropy of DNA and the value of epsilon 260 (p) independent on ionic strengths. In contrary, these parameters of DNA didn't change in solution with Mg2+-concentration. The observed differences in the effects of Mn2+ and Mg2+ on the optical properties of the macromolecule suggest that there are different modes of binding of these ions to DNA. It has been concluded, that Mn2+ interacts with bases and phosphate groups of DNA, but Mg2+--only with phosphates. The persistence length of DNA doesn't depend on Me2+ concentration under the conditions of the experiment (mu greater than or equal to 0.005 M). 相似文献
9.
Inhibition of muscle cell fusion in vitro by Mg2+ and K+ ions 总被引:2,自引:0,他引:2
10.
11.
Studies on RNA motifs capable of binding metal ions have largely focused on Mg(2+)-specific motifs, therefore information concerning interactions of other metal ions with RNA is still very limited. Application of the in vitro selection approach allowed us to isolate two RNA aptamers that bind Co(2+) ions. Structural analysis of their secondary structures revealed the presence of two motifs, loop E and "kissing" loop complex, commonly occurring in RNA molecules. The Co(2+)-induced cleavage method was used for identification of Co(2+)-binding sites after the determination of the optimal cleavage conditions. In the aptamers, Co(2+) ions seem to bind to N7 atoms of purines, inducing cleavage of the adjacent phosphodiester bonds, similarly as is the case with yeast tRNA(Phe). Although the in vitro selection experiment was carried out in the presence of Co(2+) ions only, the aptamers displayed broader metal ions specificity. This was shown by inhibition of Co(2+)-induced cleavages in the presence of the following transition metal ions: Zn(2+), Cd(2+), Ni(2+), and Co(NH(3))(6)(3+) complex. On the other hand, alkaline metal ions such as Mg(2+), Ca(2+), Sr(2+), and Ba(2+) affected Co(2+)-induced cleavages only slightly. Multiple metal ions specificity of Co(2+)-binding sites has also been reported for other in vitro selected or natural RNAs. Among many factors that influence metal specificity of the Co(2+)-binding pocket, chemical properties of metal ions, such as their hardness as well as the structure of the coordination site, seem to be particularly important. 相似文献
12.
Ferapontova EE Mountford CP Crain J Buck AH Dickinson P Beattie JS Ghazal P Terry JG Walton AJ Mount AR 《Biosensors & bioelectronics》2008,24(3):422-428
The molecular conformation of a synthetic branched, 4-way DNA Holliday junction (HJ) was electrochemically switched between the open and closed (stacked) conformers. Switching was achieved by electrochemically induced quantitative release of Mg2+ ions from the oxidised poly(N-methylpyrrole) film (PPy), which contained polyacrylate as an immobile counter anion and Mg2+ ions as charge compensating mobile cations. This increase in the Mg2+ concentration screened the electrostatic repulsion between the widely separated arms in the open HJ configuration, inducing switching to the closed conformation. Upon electrochemical reduction of PPy, entrapment of Mg2+ ions back into the PPy film induced the reverse HJ switching from the closed to open state. The conformational transition was monitored using fluorescence resonance energy transfer (FRET) between donor and acceptor dyes each located at the terminus of one of the arms. The demonstrated electrochemical control of the conformation of the used probe-target HJ complex, previously reported as a highly sequence specific nanodevice for detecting of unlabelled target [Buck, A.H., Campbell, C.J., Dickinson, P., Mountford, C.P., Stoquert, H.C., Terry, J.G., Evans, S.A.G., Keane, L., Su, T.J., Mount, A.R., Walton, A.J., Beattie, J.S., Crain, J., Ghazal, P., 2007. Anal. Chem., 79, 4724–4728], allows the development of electronically addressable DNA nanodevices and label-free gene detection assays. 相似文献
13.
The structure of thrombin-binding DNA aptamer complexed with a single Sr2+ ion (Sr2+:TBA complex) has been determined using NMR spectroscopy and restrained molecular dynamics simulations. The quadruplex structure for the Sr2+:TBA complex is similar in topology, but distinct in structure, from that previously reported for the K+:TBA complex. The inter-tetrad distance of the Sr2+:TBA complex is 3.8 angstroms, or 0.7 angstroms larger than in the K+:TBA complex. This substantial difference can be attributed to a different binding site for Sr2+ in the Sr2+:TBA complex than for K+ in the K+:TBA complex. The Sr2+:TBA complex assumes a 1:1 stoichiometry, and it is very likely that the Sr2+ ion simultaneously interacts with the eight O6 atoms of the two G-tetrads. The results indicate that quadruplex DNA structures are highly sensitive to the presence of specific metal ions. The binding of specific metal ions may modulate the biological activity of quadruplex DNA structures in vivo. 相似文献
14.
Unusual mRNA pseudoknot structure is recognized by a protein translational repressor 总被引:27,自引:0,他引:27
Translation of ribosomal proteins in the alpha operon of E. coli is repressed by one of the encoded proteins, S4; it specifically recognizes an RNA fragment containing the translational initiation site for the first gene in the operon. RNA structure mapping experiments have suggested a pseudoknot structure for the S4 binding site: the loop of a hairpin is base paired to sequences downstream of the hairpin. Here, we systematically test this proposed structure by measuring S4 binding to an extensive set of site-directed mutations that create compensatory base pair changes in potential helices. The pseudoknot folding is confirmed, and two additional, unexpected interactions within the pseudoknot are also detected. The overall structure is an unusual "double pseudoknot" linking a hairpin upstream of the ribosome binding site with sequences 2-10 codons downstream of the initiation codon. Stabilization of this structure by S4 could account for translational repression. 相似文献
15.
The genomic RNA of the coronavirus infectious bronchitis virus contains an efficient ribosomal frameshift signal which comprises a heptanucleotide slippery sequence followed by an RNA pseudoknot structure. The presence of the pseudoknot is essential for high-efficiency frameshifting, and it has been suggested that its function may be to slow or stall the ribosome in the vicinity of the slippery sequence. To test this possibility, we have studied translational elongation in vitro on mRNAs engineered to contain a well-defined pseudoknot-forming sequence. Insertion of the pseudoknot at a specific location within the influenza virus PB1 mRNA resulted in the production of a new translational intermediate corresponding to the size expected for ribosomal arrest at the pseudoknot. The appearance of this protein was transient, indicating that it was a true paused intermediate rather than a dead-end product, and mutational analysis confirmed that its appearance was dependent on the presence of a pseudoknot structure within the mRNA. These observations raise the possibility that a pause is required for the frameshift process. The extent of pausing at the pseudoknot was compared with that observed at a sequence designed to form a simple stem-loop structure with the same base pairs as the pseudoknot. This structure proved to be a less effective barrier to the elongating ribosome than the pseudoknot and in addition was unable to direct efficient ribosomal frameshifting, as would be expected if pausing plays an important role in frameshifting. However, the stem-loop was still able to induce significant pausing, and so this effect alone may be insufficient to account for the contribution of the pseudoknot to frameshifting. 相似文献
16.
Kinetics of dissociation of the complexes of bovine alpha-lactalbumin with Ca2+ and Mg2+ ions induced by mixing of the Ca2+- or Mg2+-loaded protein with the chelator of divalent cations EDTA has been studied by means of intrinsic fluorescence stopped flow method. Within the temperature region from 10 to approximately 37 degrees C the fluorescence kinetics curves for the Ca2+ removal are well fitted by one exponent with the rate constant ranging from 6.10(-3) to 1 s-1. Taking into account rather low rate of the fluorescence changes, one can assume that the limiting stage in this case is the dissociation of the single bound Ca2+ ion from the protein but not a conformational change which occurs after the Ca2+ dissociation. At temperatures above 37 degrees C the kinetics curves are best fitted by two exponents. The second exponent seems to be due to the denaturation of the apo-form of alpha-lactalbumin which takes place at these temperatures. The values of the dissociation rate constants of Mg2+ practically coincide with the values for Ca2+. 相似文献
17.
Poly(ADP-ribosyl)ation of nuclear proteins is responsible for major changes in the high-order chromatin structure. The effects of this post-translation modification on nuclear architecture were examined at different Mg2+ concentrations using scanning force microscopy. A quantitative analysis of the internucleosomal distance, the width, and the volume of chromatin fibers imaged in tapping mode reveals that poly(ADP-ribosyl)ation induces a complete relaxation and decondensation of the chromatin structure. Our data, on the center-to-center distance between adjacent nucleosomes and on the fiber width, indicate that the poly(ADP-ribosyl)ated fibers remain significantly decondensed even in the presence of Mg2+. Our results also show that the Mg2+ assumes an important role in the folding of chromatin structure, but Mg2+ is not able to restore the native feature of chromatin, when the fibers are depleted of H1/H5 histones. The combined effect of post-translation modification and cation ions on the chromatin structure shows that poly(ADP-ribosyl)ation could promote accessibility to DNA even in those nuclear processes that require Mg2+. 相似文献
18.
Y Shahak 《European journal of biochemistry》1986,154(1):179-185
The involvement of Mg2+ ions in the light-dependent regulation of the chloroplast H+-ATPase was studied in both type C and osmotically shocked type A chloroplasts. The following results were obtained. ATPase activity measured under dark, partially uncoupling conditions, following light activation with dithiothreitol and pyocyanine, was markedly enhanced by the presence of Mg2+ in the activation stage. This Mg2+ effect required concentrations in the millimolar range, was rather slow (time range of minutes), reversible, rather unspecific and did not involve changes in the affinity to dithiothreitol. Dark deactivation of the ATPase in the absence of substrate was accelerated by Mg2+. The dark effect of Mg2+ also required millimolar concentrations, but was fast (time range of seconds), highly specific for Mg2+, and did not involve thiol oxidation. The major effect of the absence of Mg2+ from the light-activation stage or of its presence in the dark interval between activation and assay was the induction of an 'abnormal' sensitivity to uncouplers: after these treatments ATP hydrolysis was not stimulated but rather inhibited by NH4Cl or other uncouplers. The pretreatments in the light without Mg2+ or dark with Mg2+ did not affect the membrane proton permeability, nor the proton pumping coupled to ATPase activity. The results are discussed in terms of Mg2+-dependent regulation of the enzyme complex at the level of subunit interaction and its effect on the affinity to protons. 相似文献
19.
20.
RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na(+)]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg(2+) salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. 相似文献