Heparin cofactor II: cDNA sequence, chromosome localization, restriction fragment length polymorphism, and expression in Escherichia coli

Heparin cofactor II (HCII) is an inhibitor of thrombin in plasma that is activated by dermatan sulfate or heparin. An apparently full-length cDNA for HCII was isolated from a human liver lambda gt11 cDNA library. The cDNA consisted of 2215 base pairs (bp), including an open-reading frame of 1525 bp, a stop codon, a 3'-noncoding region of 654 bp, and a poly(A) tail. The deduced amino acid sequence contained a signal peptide of 19 amino acid residues and a mature protein of 480 amino acids. The sequence of HCII demonstrated homology with antithrombin III and other members of the alpha 1-antitrypsin superfamily. Blot hybridization of an HCII probe to DNA isolated from sorted human chromosomes indicated that the HCII gene is located on chromosome 22. Twenty human leukocyte DNA samples were digested with EcoRI, PstI, HindIII, KpnI, or BamHI, and Southern blots of the digests were probed with HCII cDNA fragments. A restriction fragment length polymorphism was identified with BamHI. A slightly truncated form of the cDNA, coding for Met-Ala instead of the N-terminal 18 amino acids of mature HCII, was cloned into the vector pKK233-2 and expressed in Escherichia coli. The resultant protein of apparent molecular weight 54,000 was identified on an immunoblot with 125I-labeled anti-HCII antibodies. The recombinant HCII formed a complex with 125I-thrombin in a reaction that required the presence of heparin or dermatan sulfate.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Gene for selenium-dependent glutathione peroxidase maps to human chromosomes 3, 21 and X

A human glutathione peroxidase cDNA has been used as a probe to hybridize to DNAs isolated from human - rodent somatic cell hybrids that have segregated human chromosomes. A 609 bp probe which contains the entire coding region hybridizes to human chromosomes 3, 21 and Xp. Fragments of the cDNA coding sequence and of the 3' untranslated region were also used as probes. These fragments hybridized to each of the three chromosomes with the same efficiency, suggesting similarity between the loci, whereas an intronic probe detected only the gene on chromosome 3. The general organization of each gene was determined from the hybridization data. The data suggest that the locus on chromosome 3 is a functional gene containing a single intron and a pattern of restriction sites identical to those found in the cDNA coding sequence. The data also suggest that the sequences on chromosomes X and 21 have equal conservation of the 3' untranslated and coding sequences but do not contain introns, providing evidence that the latter two sequences are processed pseudogenes. A simple two allele polymorphism in PvuII digests was detected at the locus on chromosome 21.     

Opal suppressor phosphoserine tRNA gene and pseudogene are located on human chromosomes 19 and 22, respectively

An opal suppressor phosphoserine tRNA gene and pseudogene have been isolated from a human DNA library and sequenced (O'Neill, V., Eden, F., Pratt, K., and Hatfield, D. (1985) J. Biol. Chem. 260, 2501-2508). Southern hybridization of human genomic DNA with an opal suppressor tRNA probe suggested that the gene and pseudogene are present in single copy. In this study, we have determined the chromosome location of the human gene and pseudogene by utilizing a 193-base pair fragment encoding the opal suppressor phosphoserine tRNA gene as probe to examine DNAs isolated from human-rodent somatic cell hybrids that have segregated human chromosomes. These studies show that the probe hybridized with two regions in the human genome; one is located on chromosome 19 and the second on chromosome 22. By comparing the restriction sites within these two regions to those previously determined for the human opal suppressor phosphoserine tRNA gene and pseudogene, we tentatively assigned the gene to chromosome 19 and the pseudogene to chromosome 22. These assignments were confirmed by utilizing a 350-base pair fragment which was isolated from the 5'-flanking region of the human gene as probe. This fragment hybridized only to chromosome 19, demonstrating unequivocally that the opal suppressor phosphoserine tRNA gene is located on chromosome 19. The flanking probe hybridized to a single homologous band in hamster and in mouse DNA to which the gene probe also hybridized, demonstrating that the 5'-flanking region of the opal suppressor tRNA gene is conserved in mammals. Restriction analysis of DNAs obtained from the white blood cells of 10 separate individuals demonstrates that the gene is polymorphic. This study provides two additional markers for the human genome and constitutes only the second set of two tRNA genes assigned to human chromosomes.     

Structure of the human prealbumin gene

Using cloned human prealbumin cDNA as a probe, Southern blot hybridization of human genomic DNA revealed that the prealbumin gene consists of an unique, single-copy DNA. The nucleotide sequences of the entire human prealbumin gene, including both 581 base pairs of the 5'- and 95 base pairs of the 3'-flanking sequences, were determined. The gene spans about 7.0 kilobase pairs and consists of four exons and three introns. As in most eukaryotic genes, the consensus TATA and CAAT sequences are found 30 and 101 nucleotides, respectively, upstream from the putative cap site, and a polyadenylation signal sequence AA-TAAA is found in the 3'-untranslated region. Unexpectedly, two independent open reading frames provided with respective regulatory sequences were found within the gene: one in the first intron and the other in the third intron.     

Primary structure of human salivary alpha-amylase gene

A recombinant clone which covers the human salivary alpha-amylase gene in a single insert has been isolated from a human genomic DNA library using a human salivary alpha-amylase cDNA as a probe. Restriction mapping and nucleotide (nt) sequence analysis revealed that this gene is approx. 10 kb long and is separated into eleven exons by ten introns. Its 5'-flanking region has some sequence homology with that of mouse salivary alpha-amylase gene [Schibler et al., J. Mol. Biol. 155 (1982) 247-266].     

Organization and structure of the mouse interleukin-2 gene.

We have cloned a chromosomal DNA segment which covers the entire sequence for the murine interleukin-2 gene and analysed the structure of the gene. The coding regions are separated into four blocks by three introns each of which is located similarly to the corresponding human gene. The exon sequences can be aligned perfectly with the previously cloned cDNA sequence. Of particular interests is the presence of sequences within the 5'-flanking region which are highly conserved between mouse and man. The conserved region which spans more than 400 base pairs may play a role in the regulation of IL-2 gene expression.     

A novel centromeric repetitive DNA from human chromosome 22

A recombinant DNA clone localized in the centromeric region of chromosome 22 was isolated from a flow-sorted human chromosome 22 DNA library. When the original insert of about 1.9 kb was used to probe Southern blots of EcoRI-digested genomic DNA it revealed at least 40 fragments. A comparable pattern was obtained with each of the three subclones (800, 700, and 380 bp). In situ hybridization showed signals clustered in the region 22cen. DNA sequence analysis using the 380 bp fragment subcloned in pTZ18/19 (p22hom48.4) revealed eight copies of a 48 bp repeat and the size of hybridizing restriction fragments indicated that this tandemly repeated sequence is spread over a region of a few hundred kilobases. Whereas this novel DNA, termed D22Z3, displayed no sequence homology to rodent and monkey genomes cross-homology was discernible for DNA from two great ape species.     

Structure of the human gene for the proliferating cell nuclear antigen

The proliferating cell nuclear antigen (PCNA, cyclin) was originally defined as a nuclear protein whose appearance correlated with the proliferative state of the cell. It is now known to be a co-factor of DNA polymerase delta and to be necessary for DNA synthesis and cell cycle progression. cDNA clones of human PCNA have been isolated and, using one of these cDNA, we have now obtained from a lambda phage library a clone containing the entire human PCNA gene and flanking sequences. The human PCNA gene is a unique copy gene and has 6 exons. It spans, from the cap site to the poly(A) signal 4961 base pairs. We have identified, in the 5'-flanking sequence, a region with promoter activity, a well as other structural elements common to other promoters. An interesting feature of the PCNA gene is the presence of extensive sequence similarities among introns and between introns and exons.