共查询到20条相似文献,搜索用时 0 毫秒
1.
Jean-François F Khemtémourian L Odaert B Castano S Grélard A Manigand C Bathany K Metz-Boutigue MH Dufourc EJ 《European biophysics journal : EBJ》2007,36(8):1019-1027
Cateslytin (bCGA 344RSMRLSFRARGYGFR358), a five positively charged 15 amino-acid residues arginine-rich antimicrobial peptide, was synthesized using a very efficient
procedure leading to high yields and to a 99% purity as determined by HPLC and mass spectrometry. Circular dichroism, polarized
attenuated total reflectance fourier transformed infrared, polarization modulation infrared reflection Absorption spectroscopies
and proton two-dimensional NMR revealed the flexibility of such a peptide. Whereas being mostly disordered as a dry powder
or in water solution, the peptide acquires a α-helical character in the “membrane mimicking” solvent trifuoroethanol. In zwitterionic
micelles of dodecylphophatidylcholine the helical character is retained but to a lesser extent, the peptide returning mainly
to its disordered state. A β-sheet contribution of almost 100% is detected at the air–water interface. Such conformational
plasticity is discussed regarding the antimicrobial action of Cateslytin.
Presented at the joint biannual meeting of the SFB-GEIMM-GRIP, Anglet France, 14–19 October, 2006. 相似文献
2.
The processes of dehydration and rehydration of β-cyclodextrin were studied by analysis of the (1)H NMR (nuclear magnetic resonance) line shape. Dehydration was carried in an open ampoule as a function of temperature and above 400 K total dehydration of β-cyclodextrin was observed. This result was confirmed by the thermogravimetry (TG) measurements. Rehydration was studied as a function of time at room temperature. After 40 days, β-cyclodextrin was found to absorb eight water molecules. The analysis of temperature changes in the shape of the (1)H NMR line of β-cyclodextrin kept in a closed ampoule and its dielectric measurements provided information on the mobility of water molecules. The water molecules were found to perform complex molecular motions, that is, reorientational jumps below 200K and additionally, translational motion (diffusion) above 200K. 相似文献
3.
Jarvet J Danielsson J Damberg P Oleszczuk M Gräslund A 《Journal of biomolecular NMR》2007,39(1):63-72
NMR spectroscopy combined with paramagnetic relaxation agents was used to study the positioning of the 40-residue Alzheimer
Amyloid β-peptide Aβ(1–40) in SDS micelles. 5-Doxyl stearic acid incorporated into the micelle or Mn2+ ions in the aqueous solvent were used to determine the position of the peptide relative to the micelle geometry. In SDS solvent,
the two α-helices induced in Aβ(1–40), comprising residues 15–24, and 29–35, respectively, are surrounded by flexible unstructured
regions. NMR signals from these unstructured regions are strongly attenuated in the presence of Mn2+ showing that these regions are positioned mostly outside the micelle. The central helix (residues 15–24) is significantly
affected by 5-doxyl stearic acid however somewhat less for residues 16, 20, 22 and 23. This α-helix therefore resides in the
SDS headgroup region with the face with residues 16, 20, 22 and 23 directed away from the hydrophobic interior of the micelle.
The C-terminal helix is protected both from 5-doxyl stearic acid and Mn2+, and should be buried in the hydrophobic interior of the micelle. The SDS micelles were characterized by diffusion and 15N-relaxation measurements. Comparison of experimentally determined translational diffusion coefficients for SDS and Aβ(1–40)
show that the size of SDS micelle is not significantly changed by interaction with Aβ(1–40).
Electronic supplementary material The online version of this article (doi:) contains supplementary material, which is available to authorized users. 相似文献
4.
Summary The 15N relaxation rates of the -aminoisobutyric acid (Aib)-rich peptide alamethicin dissolved in methanol at 27°C and 5°C, and dissolved in aqueous sodium dodecylsulfate (SDS) at 27°C, were measured using inverse-detected one-and two-dimensional 1H–15N NMR spectroscopy. Measurements of 15N longitudinal (RN(Nz)) and transverse (RN(Nx,y)) relaxation rates and the {1H} 15N nuclear Overhauser enhancement (NOE) at 11.7 Tesla were used to calculate (quasi-) spectral density values at 0, 50, and 450 MHz for the peptide in methanol and in SDS. Spectral density mapping at 0, 50, 450, 500, and 550 MHz was done using additional measurements of the 1H–15N lingitudinal two-spin order, RNH(2H
infZ
supN
NZ), two-spin antiphase coherence, RNH(2H
infN
supZ
Nx,y), and the proton longitudinal relaxation rate, RH(H
infN
supZ
), for the peptide dissolved in methanol only. The spectral density of motions was also modeled using the three-parameter Lipari-Szabo function. The overall rotational correlation times were determined to be 1.1, 2.5, and 5.7 ns for alamethicin in methanol at 27°C and 5°C, and in SDS at 27°C, respectively. From the rotational correlation time determined in SDS the number of detergent molecules associated with the peptide was estimated to be about 40. The average order parameter was about 0.7 and the internal correlation times were about 70 ps for the majority of backbone amide 15N sites of alamethicin in methanol and in SDS. The relaxation data, spectral densities, and order parameters suggest that the peptide N-H vectors of alamethicin are not as highly constrained as the core regions of folded globular proteins. However, the peptide backbone is clearly not as mobile as the most unconstrained regions of folded proteins, such as those found in the frayed C-and N-termini of some proteins, or in randomcoil peptides. The data also suggest significant mobility at both ends of the peptide dissolved in methanol. In SDS the mobility in the middle and at the ends of the peptide is reduced. The implications of the results with respect to the sterically hindered Aib residues and the biological activities of the peptide are discussed.To whom correspondence should be addressed. 相似文献
5.
Alessandro Grottesi Marco Sette Anna Teresa Palamara Giuseppe Rotilio Enrico Garaci Maurizio Paci 《Peptides》1998,19(10):1731-1738
The 28-residue peptide thymosin α1 was studied by circular dichroism and two-dimensional NMR. Circular dichroism indicates that thymosin α1 in water solution does not assume a preferred conformation, while in the presence of small unilamellar vesicles of dimiristoylphosphatidylcholine and dimiristoylphosphatidic acid (10:1) and in sodium dodecyl sulphate, it assumes a partly structured conformation. Presence of zinc ions produces similar effects. In a more hydrophobic environment like a solution of a mixed solvent water-2,2,2 trifluoroethanol, it adopts a structured conformation. NMR spectra indicated that in this mixture as solvent, thymosin α1 has a structure characterized by two regions. A β-turn is present between residue 5 and residue 8, while the region between residues 17 and 24 shows an α helix conformation. These changes of conformation in different environments may be considered structural requirements in the steps of its interaction with the lymphocyte membrane. In fact, these conformational changes may correspond to the first event of the mechanism of lymphocyte activation in the immune response modulation by thymosin α1. 相似文献
6.
HETex-SOFAST NMR (Schanda et al. in J Biomol NMR 33:199–211, 2006) has been proposed some years ago as a fast and sensitive method for semi-quantitative measurement of site-specific amide-water hydrogen exchange effects along the backbone of proteins. Here we extend this concept to BEST readout sequences that provide a better resolution at the expense of some loss in sensitivity. We discuss the theoretical background and implementation of the experiment, and demonstrate its performance for an intrinsically disordered protein, 2 well folded globular proteins, and a transiently populated folding intermediate state. We also provide a critical evaluation of the level of accuracy that can be obtained when extracting quantitative exchange rates from HETex NMR measurements. 相似文献
7.
Singarapu KK Tonelli M Chow DC Frederick RO Westler WM Markley JL 《The Journal of biological chemistry》2011,286(50):43447-43453
Hsp12 (heat shock protein 12) belongs to the small heat shock protein family, partially characterized as a stress response, stationary phase entry, late embryonic abundant-like protein located at the plasma membrane to protect membrane from desiccation. Here, we report the structural characterization of Hsp12 by NMR and biophysical techniques. The protein was labeled uniformly with nitrogen-15 and carbon-13 so that its conformation could be determined in detail both in aqueous solution and in two membrane-mimetic environments, SDS and dodecylphosphocholine (DPC) micelles. Secondary structural elements determined from assigned chemical shifts indicated that Hsp12 is dynamically disordered in aqueous solution, whereas it gains four helical stretches in the presence of SDS micelles and a single helix in presence of DPC. These conclusions were reinforced by circular dichroism spectra of the protein in all three environments. The lack of long range interactions in NOESY spectra indicated that the helices present in SDS micelles do not pack together. R(1) and R(2), relaxation and heteronuclear NOE measurements showed that the protein is disordered in aqueous solution but becomes more ordered in presence of detergent micelles. NMR spectra collected in presence of paramagnetic spin relaxation agents (5DSA, 16DSA, and Gd(DTPA-BMA)) indicated that the amphipathic α-helices of Hsp12 in SDS micelles lie on the membrane surface. These observations are in agreement with studies suggesting that Hsp12 functions to protect the membrane from desiccation. 相似文献
8.
《Gene》1996,170(1):107-112
An α-factor leader/insulin precursor fusion protein was produced in Saccharomyces cerevisiae and metabolically labeled in order to analyse the efficiency of maturation and secretion. A substantial fraction of the secreted material was found in a hyperglycosylated unprocessed form, indicating incomplete Kex2p endopeptidase maturation. Introduction of a spacer peptide (EAEAEAK) after the dibasic Kex2p site, creating a N-terminal extension of the insulin precursor, greatly increased the Kex2p catalytic efficiency and the fermentation yield of insulin precursor. The N-terminal extension features a Lys to allow subsequent proteolytic removal by trypsin or the Achromobacter lyticus Lys-specific protease. Dipeptidyl aminopeptidase A (DPAPA) activity removing Glu-Ala dipeptides from the extension was inhibited by adding a Glu N-terminally to the extension. Unexpectedly, this modified N-terminal extension (EEAEAEAK) was partially cleaved after the Lys during fermentation. This monobasic proteolytic activity was demonstrated to be associated with Yap3p. Yap3p cleavage could be prevented by insertion of a Pro before the Lys (EEAEAEAPK) 相似文献
9.
Pramodh Vallurupalli D. Flemming Hansen Patrik Lundström Lewis E. Kay 《Journal of biomolecular NMR》2009,45(1-2):45-55
Carr-Purcell-Meiboom-Gill (CPMG) relaxation dispersion NMR experiments are extremely powerful for characterizing millisecond time-scale conformational exchange processes in biomolecules. A large number of such CPMG experiments have now emerged for measuring protein backbone chemical shifts of sparsely populated (>0.5%), excited state conformers that cannot be directly detected in NMR spectra and that are invisible to most other biophysical methods as well. A notable deficiency is, however, the absence of CPMG experiments for measurement of 1Hα and 13Cα chemical shifts of glycine residues in the excited state that reflects the fact that in this case the 1Hα, 13Cα spins form a three-spin system that is more complex than the AX 1Hα–13Cα spin systems in the other amino acids. Here pulse sequences for recording 1Hα and 13Cα CPMG relaxation dispersion profiles derived from glycine residues are presented that provide information from which 1Hα, 13Cα chemical shifts can be obtained. The utility of these experiments is demonstrated by an application to a mutant of T4 lysozyme that undergoes a millisecond time-scale exchange process facilitating the binding of hydrophobic ligands to an internal cavity in the protein. 相似文献
10.
11.
Tran HT Nimick M Uhrig RG Templeton G Morrice N Gourlay R DeLong A Moorhead GB 《The Plant journal : for cell and molecular biology》2012,71(2):263-272
It is now emerging that many proteins are regulated by a variety of covalent modifications. Using microcystin-affinity chromatography we have purified multiple protein phosphatases and their associated proteins from Arabidopsis thaliana. One major protein purified was the histone deacetylase HDA14. We demonstrate that HDA14 can deacetylate α-tubulin, associates with α/β-tubulin and is retained on GTP/taxol-stabilized microtubules, at least in part, by direct association with the PP2A-A2 subunit. Like HDA14, the putative histone acetyltransferase ELP3 was purified on microcystin-Sepharose and is also enriched at microtubules, potentially functioning in opposition to HDA14 as the α-tubulin acetylating enzyme. Consistent with the likelihood of it having many substrates throughout the cell, we demonstrate that HDA14, ELP3 and the PP2A A-subunits A1, A2 and A3 all reside in both the nucleus and cytosol of the cell. The association of a histone deacetylase with PP2A suggests a direct link between protein phosphorylation and acetylation. 相似文献
12.
T. Kimura N. Kitamoto Y. Kito Y. Iimura T. Shirai T. Komiyama Y. Furuichi K. Sakka K. Ohmiya 《Molecular & general genetics : MGG》1997,254(2):139-147
The HM-1 killer toxin from Hansenula mrakii is known to inhibit cell wall β-1,3-glucan synthase of Saccharomyces cerevisiae and other sensitive strains of yeast. A number of mutants of Saccharomyces cerevisiae that show resistance to this toxin were isolated in order to clarify the killing mechanism of the toxin. These mutants, designated
rhk (resistant to Hansenula killer), were classified into three complementation groups. A novel gene RHK1, which complements the killer-resistant phenotype of the largest complementation group rhk1, was isolated. DNA sequence analysis revealed an open reading frame that encodes a hydrophobic protein composed of 458 amino
acids. Gene disruption followed by tetrad analysis showed that RHK1 is not essential and loss of RHK1 function endowed S. cerevisiae cells with complete killer resistance. A biochemical analysis suggested that RHK1 does not participate directly in the synthesis of β-1,3-glucan but is involved in the synthesis of the receptor for the HM-1
killer toxin.
Received: 27 June 1996 / Accepted: 14 October 1996 相似文献
13.
Role of white radish peroxidase has been investigated in the treatment of water contaminated with phenols, particularly α-naphthol.
Water polluted with α-naphthol was treated with white radish peroxidase under various experimental conditions. The treatment
of α-naphthol polluted water by this enzyme in presence of polyethylene glycol enhanced its removal. Studies carried out in
absence of polyethylene glycol showed only 36% of α-naphthol removal however, 96% of it was removed in presence of 0.1 mg/mL
of polyethylene glycol in 100 mM sodium phosphate buffer, pH 6.5, and 0.75 mM H2O2 at 40°C. The other phenols oxidized and removed from waste water under similar experimental conditions were 18%, m-cresol; 30%, p-chlorophenol; 62%, p-bromophenol; 20%, benzyl alcohol; 21%, quinol; 38%, 2,6-dichlorophenol; 13%, 2,4-dichlorophenol; and 2%, native phenol. Mixtures
of different phenolic compounds removed under identical treatment conditions were 63%, A; 40%, B; 52%, C; 41%, D; 72%, E;
66%, F; and 72%, G. Thus, peroxidase in presence of an additive, polyethylene glycol could be a suitable tool for the removal
of phenolic compounds from industrial effluents. 相似文献
14.
Sequence-specific 1H NMR assignments are presented for a non-selfcomplementary 23-base-pair DNA duplex of molecular weight 15,000 daltons, containing the OR3 repressor binding site of bacteriophage as the central core. The NMR techniques used were mainly phase-sensitive two-dimensional NOE and 2Q spectroscopy, the latter to overcome overlap problems within the spectral region of the deoxyribose spin-systems. Direct sequential NOE connectivities are observed between adenine 2H and deoxyribose 1 protons. We propose the use of these connectivities as a check of the assignments of C1 and A2 protons, which have independently been derived via other assignment pathways.Abbreviation COSY
2-dimensional correlated spectroscopy
- NOESY
2-dimensional nuclear-Overhauser-enhancement spectroscopy
- RELAYED-COSY
2-dimensional relayed coherence transfer spectroscopy
- 2Q
two-quantum
- ppm
parts per million
- 23-bp DNA
d-(ATCTATCACCGCAAGGGATAAAT) · d-(ATTTATCCCTTGCGGTGATAGAT)
- 17-bp DNA (OR3)
d-(TATCACCGCAAGGGATA) · d-(TATCCCTTGCGGTGATA)
- di(X;Y)
intra-residue distance between protons X and Y
- ds(X;Y)
sequential distance between protons X and Y located in sequentially neighbouring nucleotides, where the direction from X to Y is always from 5 to 3 相似文献
15.
Hennig J Bresell A Sandberg M Hennig KD Wahren-Herlenius M Persson B Sunnerhagen M 《Journal of molecular biology》2008,377(2):431-449
Ro52 is a major autoantigen that is targeted in the autoimmune disease Sjögren syndrome and belongs to the tripartite motif (TRIM) protein family. Disease-related antigenic epitopes are mainly found in the coiled-coil domain of Ro52, but one such epitope is located in the Zn2 +-binding region, which comprises an N-terminal RING followed by a B-box, separated by a ∼ 40-residue linker peptide. In the present study, we extend the structural, biophysical, and immunological knowledge of this RING-B-box linker (RBL) by employing an array of methods. Our bioinformatic investigations show that the RBL sequence motif is unique to TRIM proteins and can be classified into three distinct subtypes. The RBL regions of all three subtypes are as conserved as their known flanking domains, and all are predicted to comprise an amphipathic helix. This helix formation is confirmed by circular dichroism spectroscopy and is dependent on the presence of the RING. Immunological studies show that the RBL is part of a conformation-dependent epitope, and its antigenicity is likewise dependent on a structured RING domain. Recombinant Ro52 RING-RBL exists as a monomer in vitro, and binding of two Zn2 + increases its stability. Regions stabilized by Zn2 + binding are identified by limited proteolysis and matrix-assisted laser desorption/ionization mass spectrometry. Furthermore, the residues of the RING and linker that interact with each other are identified by analysis of protection patterns, which, together with bioinformatic and biophysical data, enabled us to propose a structural model of the RING-RBL based on modeling and docking experiments. Sequence similarities and evolutionary sequence patterns suggest that the results obtained from Ro52 are extendable to the entire TRIM protein family. 相似文献
16.
17.
18.
《Phytomedicine》2015,22(6):641-647
BackgroundCurrently, more than one-third of the global population is overweight or obese, which is a risk factor for major causes of death including cardiovascular disease, numerous cancers, and diabetes. Kinsenoside, a major active component of Anoectochilus formosanus exhibits antihyperglycemic, antihyperliposis, and hepatoprotective effects and can be used to prevent and manage obesity.PurposeThis study examined the catabolic effects of kinsenoside on lipolysis in adipocytes transformed from C3H10T1/2 cells.Study design/methodsThe lipolytic effect of kinsenoside in C3H10T1/2 adipocytes was evaluated by oil-red O staining and glycerol production. The underlying mechanisms were assessed by Western blots, chromatin immunoprecipitation (IP), Co-IP, EMSA and siRNAs verification.ResultsWe demonstrated that kinsenoside increased both adipose triglyceride lipase (ATGL)-mediated lipolysis, which was upregulated by AMP-activated protein kinase (AMPK) activation, and the hydrolysis of triglycerides to glycerol and fatty acids that require transportation into mitochondria for further β-oxidation. We also demonstrated that kinsenoside increased the phosphorylation of peroxisome proliferator-activated receptor alpha (PPARα) and CRE-binding protein (CREB), and the protein levels of silent information regulator T1 (SIRT1), peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α) and carnitine palmitoyltransferase I (CPT1) through an AMPK-dependent mechanism. SIRT1 deacetylated PGC-1α, facilitating AMPK-mediated PGC-1α phosphorylation and increasing the interaction of PPARα with its coactivator, PGC-1α. This interaction elevated the expression of CPT1, a shuttle for the mitochondrial transport of fatty acids, in kinsenoside-treated cells. In addition, AMPK-phosphorylation-mediated CREB activation caused kinsenoside-mediated PGC-1α upregulation.ConclusionAMPK activation not only elevated ATGL expression for lipolysis but also induced CPT1 expression for further mitochondrial translocation of fatty acids. The results suggested that the mechanism underlying the catabolic effects of kinsenoside on lipolysis and increased CPT1 induction was mediated through an AMPK-dependent pathway. 相似文献
19.