Molecular organization and structural stability of beta s-crystallin from calf lens

beta s-Crystallin has been purified to homogeneity. Its structural features and conformational behavior have been studied in solution. Protein secondary structure was estimated by curve fitting of far-UV circular dichroism spectra, which gave 16% alpha-helix, 45% beta-sheet, 12% bends, and 27% remainders. This result indicates that the structural organization of beta s-crystallin is reasonably similar to that of other beta and gamma family members. A comparison assessed between beta s- and gamma 2-crystallin by the use of predictive methods (flexibility and volume plots) reveals that the two proteins differ in respect to their local flexibility and packing, although they show similar overall organization. The interdomain and the C-terminal regions were found to be more flexible in beta s-crystallin. This finding can be explained by the presence of smaller amino acid residues within these structural districts. The location of one out of four tryptophans, i.e., Trp-162, in a flexible and exposed region of the protein was found to be the origin of the fluorescence heterogeneity. In fact, the fluorescence emission maximum of the native protein, centered at 328 nm, is due to two emitting centers, whose emission maxima are located at 323 and 330 nm, respectively, as evidenced by acrylamide quenching of fluorescence. The effect of perturbing agents, such as pH and guanidine hydrochloride, on the conformational behavior of beta s has also been evaluated by numerous spectroscopic techniques. The range of pH stability was between 6.5 and 8.(ABSTRACT TRUNCATED AT 250 WORDS)     

Phosphorylation of beta-crystallin B2 (beta Bp) in the bovine lens

Three major 32P-labeled polypeptides were found in the soluble fraction of bovine lenses cultured in a medium containing [32P]orthophosphate. Two of the polypeptides corresponded to the phosphorylated A and B chains of alpha-crystallin. In this communication, the third polypeptide is now identified. This polypeptide is characterized by a molecular weight of 27,000 and a pI of 6.6, eluted exclusively in the beta Low fraction of a CL-6B gel filtration separation of lens soluble material, and could be further purified by DE52 anion exchange chromatography. The only 32P-labeled amino acid detected was phosphoserine. A single 32P-labeled peptide was observed after tryptic digestion and two-dimensional mapping. The amino acid sequence of the purified peptide is Gly-Ala-Phe-His-Pro-Ser-Ser. This sequence exactly matches the expected C-terminal tryptic fragment, residues 198-204, of the bovine beta-crystallin B2. The results of carboxypeptidase A digestion of the 32P-labeled peptide suggest that only Ser203 is phosphorylated. By using the catalytic subunit of the cAMP-dependent protein kinase, purified beta B2 was phosphorylated in vitro, generating a single 32P-labeled polypeptide with the identical pI as the phosphorylated polypeptide obtained from lens culture. On the basis of these data, the Mr 27,000 32P-labeled polypeptide is identified as the phosphorylated form of the beta-crystallin B2.     

Mutational analysis of hydrophobic domain interactions in gamma B-crystallin from bovine eye lens.

gamma B-crystallin is a monomeric member of the beta gamma-superfamily of vertebrate eye lens proteins. It consists of two similar domains with all-beta Greek key topology associating about an approximate two-fold axis. At pH 2, with urea as the denaturant, the domains show independent equilibrium unfolding transitions, suggesting different intrinsic stabilities. Denaturation experiments using recombinant one- or two-domain proteins showed that the N-terminal domain on its own exhibits unaltered intrinsic stability but contributes significantly to the stability of its C-terminal partner. It has been suggested that docking of the domains is determined by a hydrophobic interface that includes phenylalanine at position 56 of the N-terminal domain. In order to test this hypothesis, F56 was substituted by site-directed mutagenesis in both complete gamma B-crystallin and its isolated N-terminal domain. All mutations destabilize the N-terminal domain to about the same extent but affect the C-terminal domain in a different way. Replacement by the small alanine side chain or the charged aspartic acid residue results in a significant destabilization of the C-terminal domain, whereas the more bulky tryptophan residue causes only a moderate decrease in stability. In the mutants F56A and F56D, equilibrium unfolding transitions obtained by circular dichroism and intrinsic fluorescence differ, suggesting a more complex denaturation behavior than the one observed for gamma B wild type. These results confirm how mutations in one crystallin domain can affect the stability of another when they occur at the interface. The results strongly suggest that size, hydrophobicity, and optimal packing of amino acids involved in these interactions are critical for the stability of gamma B-crystallin.     

Amino acid sequence of bovine gamma E (IVa) lens crystallin.

When electrospray ionization mass spectrometry (ESMS) was used to analyze purified bovine gamma E (gamma IVa)-crystallin, it yielded a relative molecular mass (M(r)) of 20.955 +/- 5. This mass is significantly different from that calculated from the published sequence (M(r) 20.894) (White HE et al., 1989, J Mol Biol 207:217-235). Further, ES-MS analysis of the protein after it had been reduced and carboxymethylated indicated the presence of five cysteine residues, whereas the published sequence contains six (Kilby GW et al., 1995, Eur Mass Spectrom 1:203-208). The entire protein sequence of gamma E crystallin has therefore been studied via a combination of ES-MS, ES-MS/MS, and Edman amino acid sequencing. The corrected sequence gives an M(r) of 20.955.3, which matches that obtained by ES-MS analysis of the purified native protein. The corrected sequence is also in agreement with a recent cDNA sequence obtained for a bovine gamma-crystallin by R. Hay (pers. comm.).     

Selective association of G protein beta(4) with gamma(5) and gamma(12) subunits in bovine tissues.

The beta and gamma subunits of G proteins are tightly bound under physiological conditions, and so far, seven beta and 11 gamma subunit isoforms have been found. The relative abilities of the beta and gamma subunits to associate with each other have been studied using transfected cell assays, in vitro translation and the yeast two-hybrid system, but have not been fully characterized in various tissues. In the present study, we demonstrated the selectivity of association of the beta with gamma isoforms in bovine tissues. Immunoprecipitation of betagamma complexes from tissue extracts with antibodies against various gamma subunits and subsequent analyses revealed that beta(4) associated with the gamma subunits with the following rank order of selectivity: gamma(5) > gamma(12) > gamma(2) > gamma(3), while beta(2) bound to gamma(2), gamma(3), and gamma(12) more selectively than to gamma(5). By contrast, beta(1) associated with all gamma subunits without significant selectivity. Analyses of purified betagamma complexes containing various gamma isoforms revealed beta subunit compositions similar to those found in the immunoprecipitates. Particular combinations of beta and gamma subunit isoforms may contribute to maintaining efficient and specific signal transduction mediated by G proteins.     

Novel cAMP regulatory elements in the promoter region of bovine P-450(11 beta) gene

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)     

Effect of FS (alpha 2 gamma beta s) hybrid hemoglobin on Hb S nucleation and aggregation

Asymmetrical cross-linked FS (alpha 2 gamma beta s) hybrid hemoglobin (Hb FS-fumarate) was prepared by reacting mixtures of hemoglobins F and S with double-headed aspirin, bis(3,5-dibromosalicyl) fumarate. When the molar ratio of hemoglobin to the cross-linking agent was 1 to 2 in a 1:1 FS mixture, the relative ratio of the products, cross-linked hemoglobins F (Hb F-fumarate), FS (HB FS-fumarate), and S (Hb S-fumarate), was 1.0:2.6:2.0, in contrast to a 1:2:1 ratio of cross-linked hemoglobins A, AS, and S in a 1:1 AS mixture. These results suggest that the fumaryl group reacts differently with Hb F, Hb FS and Hb S, and that the difference could be attributed to the difference in the structure in the vicinity of the EF6 Lys of non alpha-chains. The oxygen-binding properties of Hb F-fumarate, Hb FS-fumarate, and Hb S-fumarate were similar, except that the n-value of Hb F-fumarate was slightly lower than n-values of Hb S-fumarate and Hb FS-fumarate. Kinetic studies on aggregation showed that the addition of Hb FS-fumarate to unmodified Hb S did not affect the delay time prior to aggregation, but did increase the total turbidity. Electrophoretic and densitometric scanning analysis of the aggregate phase of this mixture showed the fraction of Hb FS-fumarate to be 19%. Hb F-fumarate's effect on the delay time is concentration-dependent; the greater the concentration of Hb F-fumarate, the longer the delay time. The turbidity after aggregation of the mixture of Hb S and Hb F-fumarate was much less than that of Hb S and Hb FS-fumarate. However, the fraction of Hb F-fumarate in the aggregate phase was 19%, which is similar to that of Hb FS-fumarate. These data suggest that Hb F and FS hybrid hemoglobin cannot participate in nuclei formation, but can participate in aggregation after sufficient amounts of nuclei are formed from Hb S, and that increased levels of Hb F do not have an inhibitory effect on the formation of nuclei but on the growth of aggregates.     

Crystallization of a new form of the eye lens protein beta B2-crystallin

A new crystal form of the bovine oligomeric lens protein beta B2 has been grown in the presence of calcium acetate. The crystals are orthorhombic, I222 or I2(1)2(1)2(1), with cell dimensions a = 77.8 A, b = 83.6 A, c = 109.2 A. This new crystal form, which diffracts to at least 2.5 A, has a and b cell dimensions that are half those of the original crystal form, although there is no simple relationship between the c cell dimensions. The new crystal form reported here contains only one subunit per asymmetric unit, indicating that the dimer lies on a crystallographic 2-fold axis, and is a suitable candidate for molecular replacement studies.     

New medium for solubilizing proteins of the eye lens core (nucleus)

The eye lens core (nucleus) is a practical source of proteins for use as genetic markers. A new, simple extraction solution for these proteins is described. The solution was tested on fish (mullet, rockfish, and barracuda) lens nuclei, which produced weak extracts with other extraction media. A new solution, in addition to producing the strongest extracts, demonstrated desirable qualities relating to electrophoresis and storage. This solution may serve as a general extraction solution for nuclear lens proteins.     

Developmental constraints in regressive evolution: studies of the expression of the γs-crystallin gene in the developing lens of cave-dwelling Astyanax fasciatus (Cuvier, 1819) (Teleostei, Characidae) by in situ hybridization

The early morphogenesis of the lens and the expression of the γs-crystallin gene was studied in epigean Astyanax fasciatus and its cave-dwelling derivative. At early stages, the lens of the cave fish develops in a way that is similar to the epigean form. Later, the developmental timing is delayed and growth ceases in the cave-fish lens. With the beginning of cytodifferentiation, the development of the lens breaks down. Crystallin lens fibres are not produced at any time and the γs-crystallin gene, which is transcribed during a limited period in the lens of epigean fishes, is not active in cave specimens. This study confirms earlier immunofluorescence observations that demonstrated the lack of crystallin proteins in the cave-fish lens, but is in contrast to results on the blind mole rat, which showed a persistence of functioning crystallins in the degenerated lens of this species. The significance of developmental constraints in regressive evolution is discussed.