Using RNA secondary structures to guide sequence motif finding towards single-stranded regions

RNA binding proteins recognize RNA targets in a sequence specific manner. Apart from the sequence, the secondary structure context of the binding site also affects the binding affinity. Binding sites are often located in single-stranded RNA regions and it was shown that the sequestration of a binding motif in a double-strand abolishes protein binding. Thus, it is desirable to include knowledge about RNA secondary structures when searching for the binding motif of a protein. We present the approach MEMERIS for searching sequence motifs in a set of RNA sequences and simultaneously integrating information about secondary structures. To abstract from specific structural elements, we precompute position-specific values measuring the single-strandedness of all substrings of an RNA sequence. These values are used as prior knowledge about the motif starts to guide the motif search. Extensive tests with artificial and biological data demonstrate that MEMERIS is able to identify motifs in single-stranded regions even if a stronger motif located in double-strand parts exists. The discovered motif occurrences in biological datasets mostly coincide with known protein-binding sites. This algorithm can be used for finding the binding motif of single-stranded RNA-binding proteins in SELEX or other biological sequence data.     

Building quantitative relationship between changed sequence and changed oxygen affinity in human hemoglobin beta-chain

244 point mutations have been recorded in human hemoglobin beta-chain, of which some change the oxygen affinity of human hemoglobin beta-chain. We use the amino-acid distribution probability to quantify these mutations, and use the cross-impact analysis with Bayes' law to determine the probability that changes the oxygen affinity of human hemoglobin beta-chain under mutations.     

Functional oligomerization of poliovirus RNA-dependent RNA polymerase.

Using a hairpin primer/template RNA derived from sequences present at the 3' end of the poliovirus genome, we investigated the RNA-binding and elongation activities of highly purified poliovirus 3D polymerase. We found that surprisingly high polymerase concentrations were required for efficient template utilization. Binding of template RNAs appeared to be the primary determinant of efficient utilization because binding and elongation activities correlated closely. Using a three-filter binding assay, polymerase binding to RNA was found to be highly cooperative with respect to polymerase concentration. At pH 5.5, where binding was most cooperative, a Hill coefficient of 5 was obtained, indicating that several polymerase molecules interact to retain the 110-nt RNA in a filter-bound complex. Chemical crosslinking with glutaraldehyde demonstrated physical polymerase-polymerase interactions, supporting the cooperative binding data. We propose a model in which poliovirus 3D polymerase functions both as a catalytic polymerase and as a cooperative single-stranded RNA-binding protein during RNA-dependent RNA synthesis.     

Quadruplex DNA: sequence, topology and structure

G-quadruplexes are higher-order DNA and RNA structures formed from G-rich sequences that are built around tetrads of hydrogen-bonded guanine bases. Potential quadruplex sequences have been identified in G-rich eukaryotic telomeres, and more recently in non-telomeric genomic DNA, e.g. in nuclease-hypersensitive promoter regions. The natural role and biological validation of these structures is starting to be explored, and there is particular interest in them as targets for therapeutic intervention. This survey focuses on the folding and structural features on quadruplexes formed from telomeric and non-telomeric DNA sequences, and examines fundamental aspects of topology and the emerging relationships with sequence. Emphasis is placed on information from the high-resolution methods of X-ray crystallography and NMR, and their scope and current limitations are discussed. Such information, together with biological insights, will be important for the discovery of drugs targeting quadruplexes from particular genes.     

Subunit oligomerization, and topology of the inositol 1,4, 5-trisphosphate receptor.

The inositol 1,4,5-trisphosphate receptor (InsP(3)R) is a tetrameric assembly of highly conserved subunits that contain multiple membrane-spanning sequences in the C-terminal region of the protein. In studies aimed at investigating the oligomerization and transmembrane topology of the type-1 InsP(3)R, a series of membrane-spanning region truncation and deletion plasmids were constructed. These plasmids were transiently transfected in COS-1 cells, and the resulting expression products were analyzed for the ability to assemble into tetrameric structures. The topology of the membrane-spanning region truncations and the full-length receptor was determined by immunocytochemical analysis of transfected COS-1 cells using complete or selective permeabilization strategies. Our results are the first to experimentally define the presence of six membrane-spanning regions. These results are consistent with the current model for the organization of the InsP(3)R in the endoplasmic reticulum and show that the truncation mutants are properly targeted and oriented in the endoplasmic reticulum membrane, thus making them amenable reagents to study receptor subunit oligomerization. Fractionation of soluble and membrane protein components revealed that the first two membrane-spanning regions were necessary for membrane targeting of the receptor. Sedimentation and immunoprecipitation experiments show that assembly of the receptor subunits was an additive process as the number of membrane-spanning regions increased. Immunoprecipitations from cells co-expressing the full-length receptor and carboxyl-terminal truncations reveal that constructs expressing the first two or more membrane-spanning domains were capable of co-assembling with the full-length receptor. Inclusion of the fifth membrane-spanning segment significantly enhanced the degree of oligomerization. Furthermore, a deletion construct containing only membrane-spanning regions 5 and 6 oligomerized to a similar extent as that of the wild type protein. Membrane-spanning region deletion constructions that terminate with the receptor's 145 carboxyl-terminal amino acids were found to have enhanced assembly characteristics and implicate the carboxyl terminus as a determinant in oligomerization. Our results reveal a process of receptor assembly involving several distinct yet additive components and define the fifth and sixth membrane spanning regions as the key determinants in receptor oligomerization.     

The sequence and topology of human complement component C9.

A partial nucleotide sequence of human complement component C9 cDNA representing 94% of the coding region of the mature protein is presented. The amino acid sequence predicted from the open reading frame of this cDNA concurs with the amino acid sequence at the amino-terminal end of three proteolytic fragments of purified C9 protein. No long stretches of hydrophobic residues are present, even in the carboxy-terminal half of the molecule which reacts with lipid-soluble photoaffinity probes. Monoclonal antibody epitopes have been mapped by comparing overlapping fragments of C9 molecule to which the antibodies bind on Western blots. Several of these epitopes map to small regions containing other surface features (e.g., proteolytic cleavage sites and N-linked oligosaccharide). The amino-terminal half of C9 is rich in cysteine residues and contains a region with a high level of homology to the LDL receptor cysteine-rich domains. A model for C9 topology based on these findings is proposed.     

Ribosomal RNA and rDNA sequence analyses.

The potential of ribosomal (r) RNA and the encoding genes (rDNA) to elucidate natural relationships has been dramatically extended by improved sequencing approaches and the application of polymerase chain reaction. Sequence information on 16S and 23S rRNA/DNA from 69 strains of 53 Streptomyces species allows determination of regions that can be used as target sites for diagnostic probes, and for amplification and sequencing primers. To generate phylogenetic trees, sequence similarities are converted into distance values. The topologies of the trees based on different parts of the molecule are compared among each other and to the numerical phenotypic clustering of the strains.     

Stem kernels for RNA sequence analyses

Several computational methods based on stochastic context-free grammars have been developed for modeling and analyzing functional RNA sequences. These grammatical methods have succeeded in modeling typical secondary structures of RNA, and are used for structural alignment of RNA sequences. However, such stochastic models cannot sufficiently discriminate member sequences of an RNA family from nonmembers and hence detect noncoding RNA regions from genome sequences. A novel kernel function, stem kernel, for the discrimination and detection of functional RNA sequences using support vector machines (SVMs) is proposed. The stem kernel is a natural extension of the string kernel, specifically the all-subsequences kernel, and is tailored to measure the similarity of two RNA sequences from the viewpoint of secondary structures. The stem kernel examines all possible common base pairs and stem structures of arbitrary lengths, including pseudoknots between two RNA sequences, and calculates the inner product of common stem structure counts. An efficient algorithm is developed to calculate the stem kernels based on dynamic programming. The stem kernels are then applied to discriminate members of an RNA family from nonmembers using SVMs. The study indicates that the discrimination ability of the stem kernel is strong compared with conventional methods. Furthermore, the potential application of the stem kernel is demonstrated by the detection of remotely homologous RNA families in terms of secondary structures. This is because the string kernel is proven to work for the remote homology detection of protein sequences. These experimental results have convinced us to apply the stem kernel in order to find novel RNA families from genome sequences.     

DEAD-box-protein-assisted RNA structure conversion towards and against thermodynamic equilibrium values

RNAs in biological processes often interconvert between defined structures. These RNA structure conversions are assisted by proteins and are frequently coupled to ATP hydrolysis. It is not well understood how proteins coordinate RNA structure conversions and which role ATP hydrolysis has in these processes. Here, we have investigated in vitro how the DEAD-box ATPase Ded1 facilitates RNA structure conversions in a simple model system. We find that Ded1 assists RNA structure conversions via two distinct pathways. One pathway requires ATP hydrolysis and involves the complete disassembly of the RNA strands. This pathway represents a kinetically controlled steady state between the RNA structures, which allows formation of less stable from more stable RNA conformations and thus RNA structure conversion against thermodynamic equilibrium values. The other pathway is ATP-independent and proceeds via multipartite intermediates that are stabilized by Ded1. Our results provide a basic mechanistic framework for protein-assisted RNA structure conversions that illuminates the role of ATP hydrolysis and reveal an unexpected diversity of pathways.     

Multicoil2: predicting coiled coils and their oligomerization states from sequence in the twilight zone

The alpha-helical coiled coil can adopt a variety of topologies, among the most common of which are parallel and antiparallel dimers and trimers. We present Multicoil2, an algorithm that predicts both the location and oligomerization state (two versus three helices) of coiled coils in protein sequences. Multicoil2 combines the pairwise correlations of the previous Multicoil method with the flexibility of Hidden Markov Models (HMMs) in a Markov Random Field (MRF). The resulting algorithm integrates sequence features, including pairwise interactions, through multinomial logistic regression to devise an optimized scoring function for distinguishing dimer, trimer and non-coiled-coil oligomerization states; this scoring function is used to produce Markov Random Field potentials that incorporate pairwise correlations localized in sequence. Multicoil2 significantly improves both coiled-coil detection and dimer versus trimer state prediction over the original Multicoil algorithm retrained on a newly-constructed database of coiled-coil sequences. The new database, comprised of 2,105 sequences containing 124,088 residues, includes reliable structural annotations based on experimental data in the literature. Notably, the enhanced performance of Multicoil2 is evident when tested in stringent leave-family-out cross-validation on the new database, reflecting expected performance on challenging new prediction targets that have minimal sequence similarity to known coiled-coil families. The Multicoil2 program and training database are available for download from http://multicoil2.csail.mit.edu.     

The topology of hepatitis B virus pregenomic RNA promotes its replication

Previous analysis of hepatitis B virus (HBV) indicated base pairing between two cis-acting sequences, the 5' half of the upper stem of epsilon and phi, contributes to the synthesis of minus-strand DNA. Our goal was to identify other cis-acting sequences on the pregenomic RNA (pgRNA) involved in the synthesis of minus-strand DNA. We found that large portions of the pgRNA could be deleted or substituted without an appreciable decrease in the level of minus-strand DNA synthesized, indicating that most of the pgRNA is dispensable and that a specific size of the pgRNA is not required for this process. Our results indicated that the cis-acting sequences for the synthesis of minus-strand DNA are present near the 5' and 3' ends of the pgRNA. In addition, we found that the first-strand template switch could be directed to a new location when a 72-nucleotide (nt) fragment, which contained the cis-acting sequences present near the 3' end of the pgRNA, was introduced at that location. Within this 72-nt region, we uncovered two new cis-acting sequences, which flank the acceptor site. We show that one of these sequences, named omega and located 3' of the acceptor site, base pairs with phi to contribute to the synthesis of minus-strand DNA. Thus, base pairing between three cis-acting elements (5' half of the upper stem of epsilon, phi, and omega) are necessary for the synthesis of HBV minus-strand DNA. We propose that this topology of pgRNA facilitates first-strand template switch and/or the initiation of synthesis of minus-strand DNA.     

Orientation and oligomerization specificity of the Bcr coiled-coil oligomerization domain

The Bcr oligomerization domain, from the Bcr-Abl oncoprotein, is an attractive therapeutic target for treating leukemias because it is required for cellular transformation. The domain homodimerizes via an antiparallel coiled coil with an adjacent short, helical swap domain. Inspection of the coiled-coil sequence does not reveal obvious determinants of helix-orientation specificity, raising the possibility that the antiparallel orientation preference and/or the dimeric oligomerization state are due to interactions of the swap domains. To better understand how structural specificity is encoded in Bcr, coiled-coil constructs containing either an N- or C-terminal cysteine were synthesized without the swap domain. When cross-linked to adopt exclusively parallel or antiparallel orientations, these showed similar circular dichroism spectra. Both constructs formed coiled-coil dimers, but the antiparallel construct was approximately 16 degrees C more stable than the parallel to thermal denaturation. Equilibrium disulfide-exchange studies confirmed that the isolated coiled-coil homodimer shows a very strong preference for the antiparallel orientation. We conclude that the orientation and oligomerization preferences of Bcr are not caused by the presence of the swap domains, but rather are directly encoded in the coiled-coil sequence. We further explored possible determinants of structural specificity by mutating residues in the d position of the coiled-coil core. Some of the mutations caused a change in orientation specificity, and all of the mutations led to the formation of higher-order oligomers. In the absence of the swap domain, these residues play an important role in disfavoring alternate states and are especially important for encoding dimeric oligomerization specificity.     

Achieving specific RNA cleavage activity by an inactive splicing endonuclease subunit through engineered oligomerization

Protein-protein interaction is a common strategy exploited by enzymes to control substrate specificity and catalytic activities. RNA endonucleases, which are involved in many RNA processing and regulation processes, are prime examples of this. How the activities of RNA endonucleases are tightly controlled such that they act on specific RNA is of general interest. We demonstrate here that an inactive RNA splicing endonuclease subunit can be switched "on" solely by oligomerization. Furthermore, we show that the mode of assembly correlates with different RNA specificities. The recently identified splicing endonuclease homolog from Sulfolobus solfataricus, despite possessing all of the putatively catalytic residues, has no detectable RNA cleavage activity on its own but is active upon mixing with its structural subunit. Guided by the previously determined three-dimensional structure of the catalytic subunit, we altered its sequence such that it could potentially self-assemble thereby enabling its catalytic activity. We present the evidence for the specific RNA cleavage activity of the engineered catalytic subunit and for its formation of a functional tetramer. We also identify a higher order oligomer species that possesses distinct RNA cleavage specificity from that of previously characterized RNA splicing endonucleases.     

Nucleotide sequence of small chromatin-associated RNA (fr3 RNA)

A small RNA found in the fraction on non-histone chromosomal proteins or rat liver and chicken reticulocytes [Holoubek, V., Deacon, N.J., Buckle, D.W. and Naora, H. (1983) Eur. J. Biochem. 137, 249-256] has been isolated from rat liver and then sequenced. The RNA is 30 nucleotides long and has the following composition: 5'AGUGGGGGACUGCGUUCGCGCUCUCCCCUG3'. This sequence is identical with the sequence of the last 30 nucleotides at the 3' end of small nuclear U1 RNA.