A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Prenatal diagnosis of 45,X/46,XX mosaicism and 45,X: implications for postnatal outcome.

The prognosis for 45,X/46,XX mosaicism diagnosed prenatally has yet to be established. We report our experience with 12 patients in whom prenatal diagnosis of 45,X/46,XX mosaicism was detected by amniocentesis for advanced maternal age or decreased maternal serum alpha-feto protein and compared them with 41 45,X/46,XX patients diagnosed postnatally. The girls in the prenatal group range in age from 3 mo to 10 years. All have had normal linear growth. Four had structural anomalies including: ASD (n = 1); ptosis and esotropia (n = 1); labial fusion (n = 1); and urogenital sinus, dysplastic kidneys, and hydrometrocolpos (n = 1). Gonadotropins were measured in seven; one had elevated luteinizing hormone/FSH at 3 mo of age. One has developmental delay and seizures as well as ophthalmologic abnormalities. None would have warranted karyotyping for clinical suspicion of Turner syndrome. The prevalence of 45,X/46,XX mosaicism is 10-fold higher among amniocenteses than in series of postnatally diagnosed individuals with Turner syndrome, which suggests that most individuals with this karyotype escape detection and that an ascertainment bias exists toward those with clinically evident abnormalities. The phenomenon of a milder phenotype for the prenatal group is similar to that observed for 45,X/46,XY diagnosed prenatally. Prenatal counseling for 45,X/46,XX in the absence of such ultrasound abnormalities as hydrops fetalis should take into account the expectation of a milder phenotype (except, possibly, with respect to developmental delay) than that of patients ascertained postnatally. The same does not hold true for 45,x diagnosed prenatally.     

Turner's syndrome--correlation between karyotype and phenotype

Turner's syndrome is defined as a congenital disease determining by quantitative and/or structural aberrations of one from two X chromosomes with frequent presence of mosaicism. Clinically it is characterized by growth and body proportion abnormalities, gonadal dysgenesis resulting in sexual infantilism, primary amenorrhoea, infertility, characteristic stigmata, anomalies of heart, renal and bones and the presence of some diseases like Hashimoto thyroiditis with hypothyroidism, diabetes mellitus type 2, osteoporosis, hypertension. Turner's syndrome occurs in 1:2000 to 1:2500 female livebirth. The most frequent X chromosome aberrations in patients with phenotype of Turner syndrome are as follows: X monosomy - 45,X; mosaicism (50-75%), including 45,X/46,XX (10-15%), 45,X/46,XY (2-6%), 45,X/46,X,i(Xq), 45,X/46,X,del(Xp), 45,X/46,XX/47,XXX; aberration of X structure: total or partial deletion of short arm of X chromosome (46,X,del(Xp)) isochromosom of long arm of X chromosome (46,X,(i(Xq)), ring chromosome (46, X,r(X)), marker chromosome (46,X+m). Searching of X chromosome and mapping and sequencing of genes located at this chromosome (such as SHOX, ODG2, VSPA, SOX 3) have made possible to look for linkage between phenotypes and adequate genes or regions of X chromosome. In this paper current data concerning correlation between phenotype and karyotype in patients with TS have been presented.     

Growth failure in early life: an important manifestation of Turner syndrome

The goals of this study were to test the hypothesis that girls with Turner syndrome (TS) experience growth failure early in life and to establish model-based normative growth charts for 0- to 8-year-old American girls with TS. Full-term girls with TS who had 5 or more measurements of height obtained during their first 10 years of life prior to initiation of growth hormone, estrogen and/or androgen therapy were eligible for this study. A nonlinear mixed-effects model comprising the first two components of the infancy-childhood-puberty (ICP) model of growth was fitted to the longitudinal height measurements and compared with those of healthy American girls. Height measurements (n = 1,146) from 112 girls with TS (45,X: 57.1%; 45,X/46,XX: 12.5%; 46,X, iso(X): 4.5%, and other: 25.9%) were analyzed. Mean height SDS fell from -0.68 at birth to -1.60 at 1 year, -1.80 at 2 years and -1.95 at 3 years. When compared to controls (676 girls, 4,537 measurements), girls with TS grew more slowly due to three principal factors: a slow growth rate of the infancy component, a slow growth rate at the onset of the childhood component, and delayed onset of the childhood component. Traditional concepts of growth failure in TS should be revised. Physicians should consider the diagnosis of TS in any girl with unexplained failure to thrive or short stature, even in the first 3 years of life.     

Cytogenetic studies in a selected group of mentally retarded children

Summary Chromosomal abnormalities are an important cause of mental retardation. We studied the frequency of karyotype abnormalities in 74 mentally retarded patients selected from 306 patients referred to our clinic. Giemsa-banding was done on all cases. Additional studies in abnormal cases included autoradiography and X and Y chromatin. Karyotype analyses and blood group (Xg and Duffy) studies were carried out in family members in some cases.Fourteen of these children had chromosomal abnormalities, seven sex chromosomal, and seven had autosomal abnormalities. Three patients had 45,X and one had a 45,X/46,Xr(X) karyotype. Other sex chromosomal abnormalities were 46,XX/ 48,XXXX;48,XXXY/49,XXXXY; and 48,XXYY. Autosomal abnormalities were 46,XX,1q-;46,XY,2q-;46,XY,5p-;46,XY, dup(5p); 45,XX,t(13,14); and 46,XY,17p-. This is the first report from India of cytogenetic abnormalities in idiopathic mental retardation. The chromosomal studies in these patients help not only in accurate diagnosis, proper prognosis, and genetic counseling but also in gene localization and in the study of the origin of X-chromosome abnormalities.     

A Turner patient with a 45,X,t(1;2) (q41;p11.2) karyotype

The most common chromosomal anomaly is 45,X in the Turner syndrome. In addition to this, anomaly, mosaicism such as structural 46,X,i(Xq), 46,X,del(Xp), 46,X,r(X), 46,X,t(X;Y) and numerical 46XO/46,XX/47XXX are seen rather frequently. An infant with the Turner syndrome was found to have a karyotype 45X,t(1;2) (q41;p16) using high resolution banding. Based on our knowledge, we present the first case of 45X,t(1;2) (q41;p11.2), a karyotype in Turner's syndrome in the literature.     

Upper limb hemimelia in a twin pregnancy which was obtained by an ICSI and PGD in a woman with mosaic Turner's syndrome and the prognosis

Turner's syndrome (TS) is depicted as a total or partial absence of X chromosome, and occurs in approximately 1/2200 of live born females. Generally, mosaic patients are diagnosed following karyotype analysis due to recurrent pregnancy loss, repeated in vitro fertilization (IVF) failure, and a history of malformed babies. The purpose of this case report is to show that even a selection of normal karyotype embryos can result in abnormalities for those with mosaic TS. A 32-year old patient who underwent IVF after ICSI-PGD, and was diagnosed with 45X/46XX karyotype. At the 12-week scan, one of the fetuses had an upper limb hemimelia in one arm, and feticide was applied to that fetus. The patient delivered a healthy, 2980 g female baby at the thirty-eighth week. In mosaic TS pregnancies (even those obtained by ICSI-PGD), fetal anomaly risk is high. Therefore, careful prenatal scanning is needed for these pregnancies.     

The origin of 45,X males.

Maleness in association with the karyotype 45,X is a very rare and hitherto unexplained condition previously described in only four or five patients. This study was carried out to determine whether such males might actually possess Y-chromosomal material. Of the two 45,X males studied, one was found to be a low-grade mosaic with a 46,XY karyotype in less than 3% of fibroblasts; all lymphocytes karyotyped were 45,X. Fibroblast DNA from this individual was found to contain Y-specific repeated sequences in 1%-3% the amount observed in the father, consistent with mosaicism for a 46,XY cell line. No Y-specific repeated sequences were detected in the other patient, in whom all mitoses were 45,X. In neither patient were there detectable amounts of any of the single-copy Y-specific DNA sequences for which we tested. Studies of Xg blood groups and of X-linked restriction fragment length polymorphisms indicated that the single X chromosome was of maternal origin in both 45,X male probands. In contrast to the situation in XX males, we can exclude paternal X-Y interchange as the etiology in the cases described here. Our findings are compatible with mosaicism being the explanation of at least some "45,X" males.     

Prenatal diagnosis of mosaicism identified in amniotic fluid cell cultures

Chromosomal mosaicism in prenatal diagnosis is an important problem to be solved immediately and the probable phenotypic reflections should be explained to the family. We report two numerical and two structural mosaicisms detected in amniocyte cultures. The first fetus had a 47,XY,+mar[10]/46,XY[10] karyotype. The marker chromosome was shown to be derived from chromosome 15 by FISH method. The newborn had intrauterine growth retardation and cerebral thrombosis and died at the 29th day of age. The second fetus had a 45,X[4]/46,XX[26] karyotype. The parents refused cordocentesis and decided to terminate pregnancy in the 21st week. The third case, presented with bilateral large choroid plexus cysts, had a 46,XX, dup(1)(q22-q32)[9]/46,XX[21] karyotype. The parents' karyotypes were normal and the pregnancy was aborted in the 23rd week of gestation. The second structural abnormality was reported as 46,XX,t(6;11)(q23; p13)[3]/46,XX[20]. The mosaicism was detected in only one flask. The parents decided to continue pregnancy and cordocentesis could not be performed due to the fetal and placental position. The baby was born at term. Peripheral blood lymphocyte culture resulted in a 46,XX normal karyotype. Information and risks were explained to all families during genetic counseling. Mosaicism in prenatal diagnosis needs both detailed examination and follow up, since clinical findings depend on the type of abnormality.     

Exclusively paternal X chromosomes in a girl with short stature

A 13 1/2 year-old girl with short stature and very few Turner stigmata revealed 45,X/46,XX mosaicism with 90%–100% 46,XX cells in three sequential blood lymphocyte cultures. Molecular investigation of the parental origin of her X chromosomes revealed homozygosity for paternal X markers and an absence of maternal markers. Luteinizing hormone response to growth hormone releasing hormone was increased. Impaired gonadal function and shortness of stature in this case could be a result of the mild mosaicism with a 45,X cell line and/or is a consequence of the paternal-only origin of her X chromosomes.     

Birth weight and motor development of infants with Turner's syndrome

There were analysed 61 cases of Turner's syndrome, in this group--48 cases with 45,X karyotype. Author confirmed, that mean birth weight of these children was lower (2920 g), than in healthy girls (3400 g), especially in cases with 45,X karyotype (2894 g). The 1st birth order in 45,X cases decreased birth weight of these children (mean 2693 g). The most retardation of motor development--3 months--in locomotion was observed. Between two genotype groups 45,X (mean 2894 g) and 45,X/46,XX (mean 3015 g) the difference was statistically significant.     

A three-step molecular protocol employing DNA obtained from dried blood spots for neonatal screening for 45,X Turner syndrome

Turner syndrome (TS) is one of the most common human chromosomal abnormalities; it is characterized by the presence of one normal X chromosome and the complete or partial loss of the second X chromosome. The early recognition of TS patients allows for adequate therapy for short stature and pubertal sex steroid substitution. We developed a cost-effective molecular diagnostic tool that can be used to identify 45,X TS patients from dried blood spots, for possible use in neonatal screening for TS. We used a three-step method for 45,X TS detection: i) DNA extraction from dried blood spot samples, ii) pre-PCR HpaII digestion (methylation-sensitive enzyme) and iii) GeneScan analysis of selected cases. DAX-1 gene amplification was used to recognize DNA integrity, and the androgen receptor gene (Xq11-12), which is both a highly polymorphic and methylated gene, was used to determine the number of X chromosome alleles. Using this three-step diagnostic procedure, we detected apparent TS in 1/304 (0.33%) samples; such individuals should be submitted to clinical examination and karyotype confirmation. The three-step 45,X TS neonatal screening protocol is a simple, reliable, fast (under 30 h) and cost-effective diagnostic tool, useful for the neonatal detection of TS.     

Turner syndrome female with a small ring X chromosome lacking the XIST, an unexpectedly mild phenotype and an atypical association with alopecia universalis

Rearranged X chromosome in Turner syndrome (TS) are generally well tolerated but in cases of ring X chromosomes and of X/autosome translocations the incidence of mental retardation and other congenital abnormalities can be significantly higher. These abnormal phenotypes can be ascribed to failed or partial X inactivation. Here, we report a 10-year-old female who was referred for a cytogenetic analysis because she developed an alopecia universalis. The patient, of normal intelligence, had been found to have traits of TS, especially short stature. A first cytogenetic analysis showed a no mosaic 45,X karyotype. Since, the risk of developing gonadoblastoma in TS patients with mosaicism for a Y derivative chromosome and because association of alopecia universalis and TS is uncommon, fluorescence in situ hybridization (FISH) was performed to search for a second cell population. Our patient was found to have a mosaic 45,X/46,X,+r. FISH analysis using sex chromosome probes permitted us to identify the very small marker as a ring X chromosome, detected in 90% of cells. The ring appeared to be formed almost totally of alphoid sequences with breakpoints in the juxtacentromeric region. The r(X) does not include the XIST locus and may, therefore, not be subject to X-inactivation. Unexpectedly mild phenotype in our patient and its association with alopecia universalis will be discussed.     

Cross-sectional growth study in patients with Turner's syndrome

The body height, weight and growth velocity were investigated in 416 patients with Turner's syndrome whose age ranged from 3 to 17 years. They were all prepubertal at the time of the present study. The chromosomal analysis revealed 45, X monosomy in 148 cases, mosaicism in 208 cases, and nonmosaic structural abnormalities of X chromosome in 60 cases. There were no significant differences in height, growth velocity and weight between the patients with the 45, X karyotype and those with other chromosomal variants at any age. Combined mean heights at 3, 10 and 17 years of age were 86.0 +/- 3.5 (m +/- SD), 116.7 +/- 5.8 and 136.8 +/- 4.8 cm, respectively. These values were below -2.0 SD of normal Japanese girls. The growth velocity was 6.0 +/- 0.5 cm/year at 4 years of age, but decreased gradually and was 1.6 +/- 0.7 cm/year at 17 years of age. The degree of overweight was within +/- 10% of ideal body weight for height between the ages of 3 and 8, 10-20% between the ages of 9 and 10, and 20-30% above the age of 11 years.     

Tall stature, insulin resistance, and disturbed behavior in a girl with the triple X syndrome harboring three SHOX genes: offspring of a father with mosaic Klinefelter syndrome but with two maternal X chromosomes

AIMS: To describe the tall stature and its possible underlying mechanism in a Caucasian girl (age 12 years and 10 months) with 46,XX (28%)/47,XXX (72%) mosaicism and to identify the parental origin of her extra X chromosome. METHODS: The fasting glucose-to-insulin ratio was studied. The karyotypes of the girl and her parents as well as the presence of SHOX copies and the parental origin of her extra X chromosome were assessed. RESULTS: Clinical examination revealed a tall stature and severe acne, and endocrinological/metabolic assessment revealed insulin resistance. Fluorescence in situ hybridization cytogenetic analysis depicted the presence of three SHOX genes in the 47,XXX cell line of the patient. Karyotyping of her parents showed a normal 46,XX karyotype in the mother and 46,XY(93%)/47,XXY(7%) Klinefelter mosaicism in the father. However, DNA analysis unequivocally showed maternal origin of the extra X chromosome of the patient. CONCLUSIONS: This report suggests that SHOX gene triplication may produce a tall stature, even in the presence of preserved ovarian function. X triplication might predispose to insulin resistance and behavioral disorders.     

Interphase cytogenetics on paraffin-embedded sections of ovary for detection of genomic constitution in a patient with Turner's syndrome and chromosomal mosaicism

The difficulty of detecting sex chromosome mosaicism cytogenetically hinders the finding of an acceptable explanation for phenotypic-genotypic discrepancy amongst those patients. Fluorescence in situ hybridization (FISH) permits the genomic identification of patients with mosaic karyotypes in interphase nuclei by utilising an X chromosome-specific DNA probe (interphase cytogenetics). We evaluated the efficiency of interphase cytogenetics in the detection of the genomic constitution of the ovary from a patient with Turner's syndrome having mosaicism (46,XX/45,X0) previously established by blood lymphocyte karyotyping. We used a biotin-labelled alphoid repetitive sequence, pBAMX5, specific for the centromeric region of the human X chromosome. Although examination of ovarian sections and blood lymphocytes by FISH showed the presence of both 46,XX and 45,X0 cell lines, the genomic constitution of the germ cells/oocytes in ovarian primordial follicles was shown to be normal (46,XX). Our results (1) show the high applicability of interphase cytogenetics on paraffin sections, (2) indicate the possibility of genomic screening of different tissues that are otherwise not amenable to routine cytogenetic investigation and (3) offer a reliable methodological approach to defining accurate by the percentage of abnormal karyotypes in mosaicism of different organs and non-dividing tissues.     

Deoxyribonucleic acid damage study in primary amenorrhea by comet assay and karyotyping

AIM:

This study aims at evaluating the chromosomal abnormalities and deoxyribonucleic acid (DNA) damage in cases with primary amenorrhea by karyotyping and comet assay.

STUDY DESIGN:

A total of 30 cases of primary amenorrhea were recruited. Secondary sexual characters were assessed by Tanner staging. Chromosomal analysis was performed by conventional phytohemagglutinin stimulated lymphocyte cell culture technique. Alkaline version of comet assay was used to evaluate DNA damage.

RESULTS:

The chromosomal pattern of 20 subjects (66.7%) was found to be normal (46,XX). Two subjects had 46,XY pattern and eight subjects had Turner syndrome (45,X or 45,X/46,XX). The comet parameters were found to be increased among subjects with 45,X monosomy, when compared to the rest of the study group and also in subjects with Tanner stage 1 when compared to stage 2.

CONCLUSION:

Comet assay revealed increased DNA damage in cases with 45,X monosomy, compared with subjects with 46,XX and 46,XY karyotype, which correlated with clinical features.     

A case of 46,XY/45,X/46,XX intersex

Summary A case of 46,XY/45,X/46,XX mosaicism in a phenotypic intersex is decribed in detail. A few relevant aspects, which emerge especially from the phenotypic and karyotypic analysis, are briefly commented upon.

---

Zusammenfassung Es wird ein Fall von Mosaicismus 46,XY/45,X/46,XX beschrieben. Einige Aspekte, die aus der phänotypischen und karyotypischen Analyse des Patienten hervorgehen, sind kurz kommentiert.

     

Mixed gonadal dysgenesis: a syndrome of broad clinical, cytogenetic and histopathologic spectrum.

Mixed gonadal dysgenesis (MGD) is an abnormality of sexual differentiation (ASD), which encompasses an heterogeneous group of different gonadal and phenotypic abnormalities. This study describes the main clinical features found in 16 patients with MGD, relating the clinical presentation with cytogenetic evaluation and histopathological findings. For purpose of this study, MGD was considered in those patients who fulfilled the following diagnostic criteria: 1) müllerian and/or wolfflan derivatives; 2) any of the following gonadal characteristics: a) bilateral intrabdominal or scrotal immature testicular tissue; b) intrabdominal or scrotal immature testicular tissue with contralateral streak gonad. Patients were selected from an ASD study which was carried out in Medical Genetic Unit of University of Zulia (UGM-LUZ), Maracaibo, Venezuela, from 1980 to 1997. The following information was extracted from the medical history at UGM-LUZ: age, gender which patient was reared, clinical presentation, cytogenetic evaluation, laparoscopic findings and gonadal biopsy. Sixteen patients fulfilled the diagnostic criteria and ranged in age from 1.2 to 39.4 years with an average of 12.65 years. Only 5 patients were reared as males. Twelve patients consulted for genital ambiguity. Chromosomal evaluation was as following: 8 patients with 45,X/46,XY mosaicism: 5 had a 46,XY normal male karyotype and the remaining patients: 46,XX; 46,XX/46,XY and 45,X/46,Xi(Xq) karyotypes, respectively. All patients showed müllerian derivatives and occasionally wolffian derivatives. Gonadal tumors were present in 2 patients. Molecular studies of genes that govern gonadal development are necessary for a better understanding of the wide heterogeneity present in MGD.