Versatile kanamycin-resistance cartridges for vector construction in Escherichia coli

To generate polylinker sequences which can be transferred together with an adjacent selectable marker, two plasmids (pWW-84 and pWW-97) were constructed which contain a kanamycin-resistance gene (KmR) flanked by various restriction sites. From these plasmids KmR-cartridges can be obtained as EcoRI, BamHI, SalI, AccI or HincII fragments for insertion into the appropriate restriction site of any plasmid. The following restriction sites can be introduced with these cartridges: BamHI, SalI (AccI, HincII), EcoRI, SacI, SphI and KpnI (Asp718) all adjacent to KmR, XhoI and HindIII, both within KmR. If desired, KmR can be removed by PstI digestion and religation, creating a single PstI site and leaving all adjacent sites intact.     

High-copy-number and low-copy-number plasmid vectors for lacZ alpha-complementation and chloramphenicol- or kanamycin-resistance selection

Three types of alpha-complementation plasmid vectors were constructed which contain a chloramphenicol- or kanamycin-resistance (CmR or KmR) gene and polylinker cloning sites within the coding region of lacZ'. These vectors are essentially based on high- or low-copy-number replicons. The low-copy-number vectors, 3.61 kb in size, confer CmR and contain the pSC101 replicon and pUC8-/pUC9-type polylinker. On the other hand, the high-copy-number vectors, 2.21 to 2.68 kb in size, confer either CmR or KmR, and contain the pBR322 replicon and pUC18-/pUC19-type or other modified polylinkers. All cloning sites except HindIII and SmaI sites in the KmR vectors are unique in each plasmid. Since almost all frequently used plasmid vectors confer ampicillin resistance, these vectors may be useful to simplify the subcloning/DNA joining experiments due to unnecessity of radioisotope labelling, size fractionation and purification of foreign DNA segments.     

Single-stranded hexameric linkers: a system for in-phase insertion mutagenesis and protein engineering

An efficient method for introducing two (or four) codons into a cloned gene has been developed. Single-stranded (ss) hexameric linkers are inserted into a plasmid linearized at cohesive-end restriction sites. The resultant 6 (or 12)-bp insertion creates a new 6-bp restriction site. Plasmids containing linker insertions are enriched by using biochemical selection, or selected by using a kanamycin-resistance (KmR) cassette (biological selection). A total of 57 new linkers have been designed, and compatible KmR cassettes flanked by eleven different restriction sites have been constructed. Two-codon insertions into the tetracycline-resistance (TcR) gene of pBR322 yielded a series of new plasmid vectors. Moreover, proteins with internally duplicated domains have been constructed from beta-lactamase (ApR) insertions into the ApR gene of pBR322. Some of the resulting "gemini" proteins retained the beta-lactamase activity.     

pUC12-STOP: An expression vector with portable translation stop signals

Summary A DNA linker with TAA translational stop codons in all three reading frames was inserted into the polylinker region of pUC12. The new plasmid pUC12-STOP is useful for the expression of DNA in cases where defined translational stops are desired. The STOP linker is flanked by unique restriction sites and thus can be excised as portable STOP linker fragments. The STOP linker was used to express in Escherichia coli a truncated form of the Herpes simplex virus type 1 glycoprotein D antigen.     

An inducible expression vector for both fission and budding yeast

We have developed a vector system for inducible gene expression in both fission yeast (Schizosaccharomyces pombe) and budding yeast (Saccharomyces cerevisiae). The autonomously replicating expression vector contains multiple glucocorticoid response elements, rendering a linked promoter inducible 20-70-fold by glucocorticoid hormones in the presence of the mammalian glucocorticoid receptor. A polylinker with several unique cloning sites allows insertion of cDNAs of interest. Glucocorticoids are gratuitous signalling molecules in yeast, exerting little or no effect on the expression of genes other than those fused to the regulated promoter.     

PCR method for generating multiple mutations at adjacent sites

Procedures to introduce point mutations, restriction sites and insert or delete DNA fragments are very important tools to study protein function. We describe here two-step PCR-based method for generating single or multiple mutations, insertions and delections in a small region of the sequence. In the first step, a unique restriction site is introduced near the part of DNA sequence to be changed, without changing the amino acid sequence. For this step, one of the methods already described can be used. In the second step, mutations are introduced using mutagenic primers containing the unique restriction site from the first step at the 5′ end, paired with a universal primer crossing another unique restriction site present originally in the sequence. The method is very simple, economic and rapid. In comparison with the traditionalin vitro mutagenesis methods, one can generate large numbers of mutated plasmids in hours.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Development of broad-host-range vectors for expression of cloned genes in Pseudomonas

The cloning and expression of genes in Pseudomonas have been difficult, until now, due to the absence of vector systems that contain multiple restriction sites downstream from promoter sequences that are functional in Pseudomonas. We report here the construction of several broad-host-range vectors that can be utilized in either Pseudomonas or Escherichia coli and that rely on easily selectable antibiotic resistance markers with multiple cloning sites. These vectors were constructed by inserting the entire pUC13 sequence into derivatives of the RSF1010 wide-host-range plasmid. From this construction, other derivatives were obtained, specifically a lacZ::KmR fusion gene which provides an easily selectable marker in both E. coli and Pseudomonas. These vectors have been used to express the Pseudomonas putida cytochrome P450 monoxygenase gene in a P450-deficient P. putida strain. Thus, these vectors allow for the cloning, expression and selection of Pseudomonas genes in Pseudomonas by complementation.     

Cloning of chicken lysozyme structural gene sequences synthesized in vitro.

Double-stranded chicken lysozyme cDNA was synthesized from an oviduct mRNA fraction enriched for lysozyme mRNA. The ds-cDNA was inserted into the BamHI site of plasmid pBR322 using chemically synthesized DNA linker molecules containing the BamHI restriction endonuclease cleavage site. After bacterial transformation, colonies carrying lysozyme DNA were identified by hybridization with highly purified lysozyme cDNA. The 555 base pairs long cloned DNA fragment of one recombinant plasmid was isolated and characterized by restriction endonuclease digestion. The DNA sequence of selected parts of the inserted DNA is as predicted from the amino acid sequence of prelysozyme. The sequence data allows the unambiguous location of the coding region within lysozyme mRNA.     

New cloning vectors and techniques for easy and rapid restriction mapping

We have modified plasmid, phage lambda and cosmid cloning vectors to be of general use for easily and unambiguously determining restriction maps of recombinant DNA molecules. Each vector is constructed so that it contains the rarely found NotI restriction site joined to a short synthetic linker sequence that is followed by a multiple cloning site. DNA cloned into these vectors may be restriction-mapped by either of two methods. In one technique, the cloned DNA is completely digested with NotI, followed by partial digestion with any other restriction enzyme. After electrophoresis and transfer to a nylon membrane, the fragments are hybridized to a labeled probe complementary to the NotI linker. In the second technique, referred to as recession hybridization detection, cloned DNA is digested with NotI and then briefly treated with exonuclease III to recess the 3' ends. After hybridizing a labeled complementary oligodeoxynucleotide to the single-stranded 5' end containing the linker sequence, the DNA is partially digested with another restriction enzyme, electrophoresed and the gel is exposed to x-ray film. With either method the size of each labeled fragment corresponds directly to the distance that a restriction site is located from the NotI linker terminus. Methods for obtaining partial restriction enzyme digests have been devised so that as many as 20 different enzymes may be conveniently mapped on a single gel in little more than a day. The vectors and techniques described may also be adapted to automated or semi-automated devices that read fragment lengths and calculate the resulting restriction map.(ABSTRACT TRUNCATED AT 250 WORDS)     

Insertional restoration of beta-galactosidase alpha-complementation (white-to-blue colony screening) facilitates assembly of synthetic genes

The assembly of synthetic genes from oligodeoxynucleotides can be an inefficient process. Upon ligation of a synthetic assembly into a plasmid vector and transformation of an Escherichia coli host, it is often found that only a minor fraction of the putative recombinant plasmids contains synthetic sequences. Moreover, the synthetic sequences cloned are often altered versions of those originally designed. We have designed a biological test to detect those plasmids that contain synthetic sequences of the proper length, termini and reading frame. The test is the reversal of the beta-galactosidase alpha-complementation (blue-to-white) test used to detect the insertion of DNA segments into the polylinker sequences of the phage M13 mp, plasmids pUC, and related vectors. We begin with a modified vector defective in alpha-complementation and use insertion of the synthetic DNA segment to restore alpha-complementation. The alpha-complementation activity of the original vector (e.g., pUC18) was first abolished by a frameshift or DNA insertion within the polylinker sequence of the lacZ' gene segment. The alpha-complementation was then restored by insertion of the synthetic DNA sequence between the cohesive ends generated by digestion of two polylinker restriction sites. Formation of blue colonies requires the insertion of a DNA segment of appropriate length and termini to reconstruct the lacZ' open reading frame and thus is much more selective than the usual insertional inactivation strategy. We show that this 'insertional restoration' screening method markedly enhances the proper assembly of synthetic genes and describe manipulations to readily and reliably frameshift various polylinker sequences.     

Jekyll, a family of phage-plasmid shuttle vectors

A series of shuttle vectors has been constructed, which consist of a plasmid carrying a polylinker sequence and an M13 origin integrated into a lambda vector. A short direct repeat flanking the plasmid allows plasmid excision by homologous recombination. Sequences are cloned into unique restriction sites within the plasmid, and can be recovered either in phage or plasmid form, or can be packaged further as single-stranded DNA phage. These vectors therefore combine the efficiency of phage lambda cloning and screening with the ease of handling or analysing plasmid or M13 clones.     

Creation of a convenient vector for transformation of Drosophila with functional FRT-pFRT sites

Modification of Drosophila transformation vector pCaSper3 with the P element was used to construct a new vector, pFRT. The vector contains two tandem FRT sites flanked with several unique restriction sites and separated by a polylinker of five restriction sites, and allows easy cloning of DNA fragments between or close to the FRT sites. FRT-mediated excision of DNA sequences cloned between the FRT sites was demonstrated in vivo. The vector was proposed for molecular genetic studies of the position effect variegation, structural and molecular organization of Drosophila polytene chromosomes, etc.     

Method for cloning single-stranded oligonucleotides in a plasmid vector

A method for cloning single-stranded oligonucleotides in a plasmid vector has been developed. The method relies on ligation of the oligonucleotide into suitable restriction enzyme sites of the cloning vector such that the site at the 5' end has a 5' overhang [for example, a Bgl II site (A decreases GATCT)], and the site at the 3' end has a 3' overhang [for example, a Sac I site (GAGCT decreases C)]. This arrangement allows the oligonucleotide to anneal to the single-stranded ends of the vector and to be covalently joined by T4 DNA ligase. The complementary strand can be synthesized in vitro to generate a double-stranded plasmid, or the partially single-stranded molecule can be used as a target for site-directed mutagenesis. The subsequent transfer of the oligonucleotide to test plasmids or excision for other manipulations, such as band shift experiments to identify protein binding sites, is facilitated by cloning of the oligonucleotide into a polylinker containing multiple restriction enzyme sites. For this purpose, the plasmid vector, pKP59, which is a 2.0 kB derivative of pBR322 lacking "poison sequences" and containing 16 cloning sites, has been the most satisfactory.     

Transduction, Restriction and Recombination Patterns in Escherichia Coli

Chromosomal DNA from several Escherichia coli reference (ECOR) strains was transduced by bacteriophage P1 into E. coli strain K12 W3110 trpA33. Recombination patterns of the transductants were determined by restriction fragment length polymorphism over a 40-kb region centering on a single marker (trpA(+)) in the tryptophan operon. These experiments demonstrate that transduction between different strains of E. coli can result in recombinational replacements that are small in comparison to the entrant molecule (replacements average 8-14 kb, whereas P1 packages ~ 100 kb) often in a series of discrete segments. The transduction patterns generated resemble the natureal mosaic sequence patterns of the ECOR strains described in previous work. Extensive polymorphisms in the restriction-modification systems of the ECOR strains are a possible explanation for the sequence patterns in nature. To test this possibility, two transductants were back-transduced into strain K12 W3110 trpA33. The resulting patterns were strikingly different from the original transductions. The size of the replacements was greater, and no multiple replacements were observed, suggesting a role for restriction-modification systems in the transduction patterns and perhaps for the mosaic sequence patterns in nature.