Karyotypic evolution of a novel cervid satellite DNA family isolated by microdissection from the Indian muntjac Y-chromosome

A minilibrary was constructed from DOP-PCR products using microdissected Y-chromosomes of Indian muntjac as DNA templates. Two microclones designated as IM-Y4-52 and IM-Y5-7 were obtained from negative screening of all three cervid satellite DNAs (satellites I, II, and IV). These two microclones were 295 and 382 bp in size, respectively, and shared 70% sequence homology. Southern blot analysis showed that the IM-Y4-52 clone was repetitive in nature with an 0.32-kb register in HaeIII digest. Sequence comparison revealed no similarities to DNA sequences deposited in the GenBank database, suggesting that the microclone sequences were from a novel satellite DNA family designated as cervid satellite V. A subclone of an Indian muntjac BAC clone which screened positive for IM-Y4-52 had a 3,325-bp insert containing six intact monomers, four deleted monomers, and two partial monomers. The consensus sequence of the monomer was 328 bp in length and shared more than 80% sequence homology with every intact monomer. A zoo blot study using IM-Y4-52 as a probe showed that the strong hybridization with EcoRI digested male genomic DNA of Indian muntjac, Formosan muntjac, Chinese muntjac, sambar deer, and Chinese water deer. Female genomic DNA of Indian muntjac, Chinese water deer, and Formosan muntjac also showed positive hybridization patterns. Satellite V was found to specifically localize to the Y heterochromatin region of the muntjacs, sambar deer, and Chinese water deer and to chromosome 3 of Indian muntjac and the X-chromosome of Chinese water deer.Y.-C. Li and Y.-M. Cheng contributed equally to this work.     

CENP-A associated complex satellite DNA in the kinetochore of the Indian muntjac

The centromere/kinetochore complex is a chromosomal assembly that mediates chromosome motility and mitotic regulation by interacting with microtubules of the mitotic spindle apparatus. Centromere protein A (CENP-A) is a histone H3 homolog that is concentrated in the chromatin of the inner kinetochore plate of human chromosomes. To identify DNA sequences associated with the inner kinetochore plate, we used anticentromere autoantibodies to immunoprecipitate CENP-A associated chromatin selectively from Indian muntjac fibroblasts. DNA was cloned from immunoprecipitated CENP-A- associated chromatin and characterized by DNA sequence and hybridization analyses. A novel centromeric satellite DNA sequence was identified and shown by fluorescence in situ hybridization analysis to be present at all centromeres of the Indian muntjac. This satellite DNA constitutes a 972 bp monomer repeat and shows partial homology with satellite II DNA of the white-tailed deer. Southern blot analysis of muntjac genomic DNA suggests that this satellite DNA is present in repetitive tandem arrays and contains complex internal arrangements. In conjunction with previous work showing the association of CENP-A with human α-satellite DNA, we conclude that the mammalian inner kinetochore plate contains a unique form of chromatin that contains CENP-A in association with complex satellite DNA. Received: 18 May 1999; in revised form: 5 July 1999 / Accepted: 20 July 1999     

Effect of laminin on karyotypic variability in cell line of Indian muntjac skin fibroblasts

The numerical and structural karyotypic variability has been investigated in the Indian muntjac skin fibroblasts cell line M and karyotypic variant of this line M' on cultivation on a laminin 2/4 coated surface. In cell line M, cultivated on the laminin-coated surface for 4 and 14 days, and in karyotypic variant M', cultivated for 2, 4 and 14 days, the character of cell distribution for the chromosome number has changed. These changes involve a significant decrease in frequency of cells with model numbers of chromosomes, and an increase in frequency of cells with lower chromosome numbers. As a result, new modal chromosome numbers form. The frequency of cells with 4 chromosomes increases significantly; as a rule, such cells are absent in the control cell variants. Many new additional structural variants of the karyotype (SVK) appear. Detachment of cells M' from the laminin-coated surface followed by a 2 day cultivation on a hydrophilic surface, commonly used for routine cell cultivation, does not restore the control cell distribution for chromosomal number. The frequency of chromosomal aberrations on cultivation of the laminin-coated surface does not change relatively to controls. The observed alterations seem to be due to both disturbances of mitotic apparatus and selection of SVK, which are more advantageous to changed culture conditions of the cell population.     

Identification of an Indian muntjac DNA fragment preferentially hybridizing to the X-chromosome

Upon digestion of DNA from male and female Indian muntjac (Muntiacus muntjak) fibroblasts with the restriction enzyme Hae III or Alu I, a prominent fragment of DNA (greater than 20 kb in length) was observed. This excluded DNA (ex-DNA) appeared not to contain sequences recognized by a variety of restriction enzymes and constituted about 0.6% of the total DNA in the female genome. For equal amounts of DNA digested, female DNA contained more of this material. In situ hybridization indeed revealed strong hybridization of the ex-DNA to the entire X chromosome with a few less intense sites of hybridization on other chromosomes. Hybridization studies against total muntjac DNA indicated the presence of repetitive sequences in the ex-DNA. These repetitive sequences did not cross-hybridize with human or mouse DNA.     

The study of quantitative karyotypic variability by induction of chromosomal instability in cultured cells of the Indian muntjac skin fibroblasts

The influence of mycoplasmal contamination and somatic cell hybridization on the character of karyotypic variability in cell cultures of Indian muntjac skin fibroblasts has been investigated. Mycoplasma arginini and Acholeplasma laidlawii, used as factors inducing chromosomal instability, do not break the main regulations peculiar to intact control. They regulations are: 1) nonrandom character of cell distribution according to the number of chromosomal deviations from MSVK; 2) specific character of deviations of each chromosome from MSVK; 3) presence of significant connections between separate chromosomes by simultaneous mainly single directed numeral deviations. However, mycoplasmal contamination promotes the increase in the number of deviations in the direction of a decreasing chromosomes number. There is a breach of some connections between chromosomes by simultaneous deviations. They are chromosomes with broken connections according to the number of deviations which form telomeric associations (dicentrics). The number of these associations excel essentially intact control. The formation of new MSVK in subline M2 cells of the Indian muntjac in the process of chromosomal segregation in cell hybrid (M2 x clone of JF1 rat Jensen sarcoma) depends on the presence of significant connections between chromosomes by simultaneous numerical deviations in direction of MSVK formation. They are chromosomes that take part in the formation of new MSVK which form telomeric associations. These associations can be observed till stabilization of new MSVK. Probably, the support of the balance of karyotypic structure by factors inducing chromosomal instability is connected with change of some connections between chromosomes according to the number by simultaneous deviations as well as with the formation of dicentrics.     

Compound kinetochores of the Indian muntjac

The chromosomes of the Indian muntjac (Muntiacus muntjak vaginalis) are unique among mammals due to their low diploid number (2N=6, 7) and large size. It has been proposed that the karyotype of this small Asiatic deer evolved from a related deer the Chinese muntjac (Muntiacus reevesi) with a diploid chromosome number of 2n= 46 consisting of small telocentric chromosomes. In this study we utilized a kinetochore-specific antiserum derived from human patients with the autoimmune disease scleroderma CREST as an immunofluorescent probe to examine kinetochores of the two muntjac species. Since CREST antiserum binds to kinetochores of mitotic chromosomes as well as prekinetochores in interphase nuclei, it was possible to identify and compare kinetochore morphology throughout the cell cycle. Our observations indicated that the kinetochores of the Indian muntjac are composed of a linear beadlike array of smaller subunits that become revealed during interphase. The kinetochores of the Chinese muntjac consisted of minute fluorescent dots located at the tips of the 46 telocentric chromosomes. During interphase, however, the kinetochores of the Chinese muntjac clustered into small aggregates reminiscent of the beadlike arrays seen in the Indian muntjac. Morphometric measurements of fluorescence indicated an equivalent amount of stained material in the two species. Our observations indicate that the kinetochores of the Indian muntjac are compound structures composed of linear arrays of smaller units the size of the individual kinetochores seen on metaphase chromosomes of the Chinese muntjac. Our study supports the notion that the kinetochores of the Indian muntjac evolved by linear fusion of unit kinetochores of the Chinese muntjac. Moreover, it is concluded that the evolution of compound kinetochores may have been facilitated by the nonrandom aggregation of interphase kinetochores in the nuclei of the ancestral species.     

Localization of the repetitive telomeric sequence (TTAGGG)n in two muntjac species and implications for their karyotypic evolution

It has been suggested that the chromosome set of the Indian muntjac, Muntiacus muntjak vaginalis (female, 2n = 6; male, 2n = 7), evolved from small acrocentric chromosomes, such as those found in the complement of the Chinese muntjac, M. reevesi (2n = 46), by a series of tandem fusions and other rearrangements. The location of the highly conserved human telomeric sequence (TTAGGG)n in the metaphase chromosomes of M.m. vaginalis and its close relative, M. reevesi, was investigated by non-radioactive in situ hybridization. The (TTAGGG)n repeat was found adjacent to the centromeres in the short arm and at the telomeres in the long arm of M. reevesi acrocentric metaphase chromosomes. Tandem fusions present in the karyotype of M.m. vaginalis chromosomes were not reflected by interstitial signals of the telomere repeat, as these chromosomes displayed hybridization signals only at the ends of the chromatids. Mechanisms that might have played a role in the evolution of the reduced karyotype of the Indian muntjac are discussed.     

Evolution of muntjac DNA

The extent of nuclear single-copy DNA divergence between Muntiacus reevesi and Muntiacus muntjak vaginalis (Cervidae), a species pair showing extreme karyotype differences but striking morphological similarity, is 2%, as judged from the thermal stability of interspecific DNA-DNA hybrids. A comparison of the total nuclear DNA reassociation kinetics of the two species indicates a reduction of lowly repetitive sequences in M. m. vaginalis.     

The influence of a substrate including extracellular matrix proteins on karyotypic variability in two cell lines of Indian muntjac skin fibroblasts

The influence of cell-culture conditions on numerical and structural karyotypic variability has been investigated in two Indian muntjac skin fibroblast “markerless” cell lines, M and MT. The cells were cultivated on a substrate consisting of extracellular matrix proteins (ECMs) synthesized by human mesenchymal stem cells (SC5-MSC). The character of cell distribution for the chromosome number of the cell line M changed after cultivation for 1 and 4 days as compared to control cells, which were cultured on a hydrophilic surface without ECM coating. These changes involve a significant decrease in frequency of cells with the modal numbers of chromosomes and an increase in frequency of cells with lower chromosome numbers. Many new types of additional structural variants of the karyotype (SVK) appear. The MT cell line, differing from M line in the number of homologous chromosomes, exhibited a character of cell distribution similar to that of the M line for the chromosome number for only 1 day after cultivation on the ECM substrate, but not after 4 days under the same culture conditions, when no difference from the control cells was observed. Further cultivation of MT cells for 8 days did not change the character of cell distribution for the chromosome number relative to the control variant. The observed alterations seem to be due to disturbances in the correct chromosome-segregation process, which were caused by an abrupt shift in the cell-culture conditions. Analysis of the structural karyotypic variability revealed a significant increase in frequency of chromosomal aberrations in the M cell line for 1 and 4 days in culture on the ECM substrate as compared to the control cells. The frequency of dicentric chromosomes (telomeric associations) was increased and constituted more than 50% of all chromosome aberrations. No increase in frequency of chromosome aberrations was observed for MT cells cultured under the same conditions. It can be suggested that the differing by the karyotypic structure, but the genetically identical cell lines have different response to the substrate. In contrast to the M line, in the MT line, a fast normalization of numerical karyotypic characteristics and no enhancement of structural karyotypic variability takes place. This provides a possibility to cultivate an MT cell on the given protein substrate while maintaining a balanced karyotypic structure characteristic of MT cell line.     

Localization and characterization of recombinant DNA clones derived from the highly repetitive DNA sequences in the Indian muntjac cells: their presence in the Chinese muntjac

A total of seven, highly repeated, DNA recombinant M13 mp8 clones derived from a Hpa II digest of cultured cells of the Indian muntjac (Muntiacus muntjac vaginalis) were analyzed by restriction enzymes, in situ hybridization, and DNA sequencing. Two of the clones, B1 and B8, contain satellite DNA inserts which are 80% homologous in their DNA sequences. B1 contains 781 nucleotides and consist of tandem repetition of a 31 bp consensus sequence. This consensus sequence, TCCCTGACGCAACTCGAGAGGAATCCTGAGT, has only 3 bp changes, at positions 7, 24, and 27, from the consensus sequence of the 31 bp subrepeats of the bovine 1.715 satellite DNA. The satellite DNA inserts in B1 and B8 hybridize primarily but not specifically to chromosome X, and secondarily to other sites such as the centromeric regions of chromosomes 1 and 2. Under less stringent hybridization conditions, both of them hybridize to the interior of the neck region and all other chromosomes (including chromosomes 3 and Y). The other five DNA clones contain highly repetitive, interdispersed DNA inserts and are distributed throughout the genome except for the neck region of the compound chromosome X+3. Blot hybridization results demonstrate that the satellite DNA component is also present in Chinese muntjac DNA (Muntiacus reevesi) in spite of the very different karyotypes of the Chinese and Indian muntjacs.     

Kinetics of DNA replication in the Indian muntjac chromosomes as studied by quantitative autoradiography

DNA replication patterns of individual chromosomes and their various euchromatic and heterochromatic regions were analyzed by means of quantitative autoradiography. The cultured cells of the skin fibroblast of a male Indian muntjac were pulse labeled with ³H-thymidine and chromosome samples were prepared for the next 32 h at 1–2 h intervals. A typical late replication pattern widely observed in heterochromatin was not found in the muntjac chromosomes. The following points make the DNA replication of the muntjac chromosomes characteristics: (1) Heterochromatin replicated its DNA in a shorter period with a higher rate than euchromatin. (2) Two small euchromatic regions adjacent to centromeric heterochromatin behaved differently from other portions of euchromatin, possessing shorter Ts, higher DNA synthetic rates and starting much later and ending earlier their DNA replication. (3) Segmental replication patterns were observed in the chromosomes 2 and 3 during the entire S phase. (4) Both homologues of the chromosome 3 showed a synchronous DNA replication pattern throughout the S phase except in the distal portion of the long arms during the mid-S phase.     

5-Azacytidine- and Hoechst-induced aneuploidy in Indian muntjac

Hoechst 33258 (bis-benzimidazole) and 5-azacytidine (5-AC) cause decondensation of the pericentric heterochromatin in mouse and aberrations in the sequence of centromere separation apparently by different mechanisms. We treated the male Indian muntjac cells (2n=7), which do not undergo decondensation of the pericentric heterochromatin, to study if these chemicals would result in induction of aneuploidy limited to the Y(2) chromosome. This paper reports that both agents result in aneuploidy primarily limited to one chromosome, the Y(2). It is likely that other chromosomes are not tolerated in aneuploid condition because every chromosome carries some household genes including those essential for mitotic progression. The loss/gain of the Y(2) chromosome is tolerated because it is the smallest chromosome and is almost entirely composed of constitutive heterochromatin. Since Indian muntjac has only three pairs of large chromosomes comprising its basic genome, which can be clearly viewed under high dry objective, these cells are very suitable for the preliminary analysis of aneuploidy-inducing ability of various chemicals.     

Molecular and structural evolution of Citrus satellite DNA

Highly repeated satellite DNA (stDNA) of citric plants was characterized by cloning and sequencing 10–14 repeats of each plant (Citrus limon, C. sinensis, C. ichangensis, Poncirus trifoliata). The monomers are mostly 181 bp in length with a GC-content between 60% and 68% (significantly higher than the average GC-content of the citrus group genomes). Similarity among the repeats indicates that they belong to a satellite family that underwent species-specific modifications, which are reflected in the phylogenetic relationships. Curvature provoked by dA-stretches of the repeats analyzed by gel shifts revealed structural conservation, even though the nucleotide sequences vary among species, thereby probably supporting the heterochromatic structure of stDNA. We show that the species-specific modification of the satellite consensus involves changes in the position and number of dA tracts. The molecule shapes of satellite oligomeres predicted by computer modelling indicate a superhelical structure of the tandem repeats which is in a good agreement with the satellite sequence dendrogram. The contribution of DNA bending elements to the evolution of plant satellite repeats is discussed. Received: 27 November 2000 / Accepted: 12 January 2001     

Human telomerase can immortalize Indian muntjac cells

The mechanisms of replicative senescence by telomere shortening are not fully understood. The Indian muntjac has the fewest chromosomes of all mammals, greatly simplifying the analysis of each telomere over time. In this study, telomere shortening was observed throughout the life span of cultured normal muntjac cells by quantitative fluorescence in situ hybridization and terminal restriction fragment analysis. Ectopic expression of the human telomerase catalytic subunit in these cells reconstituted telomerase activity, extended telomere lengths, and immortalized the cells, demonstrating that the Indian muntjac cells can serve as a telomere-based replicative senescence model for human cells. In one strain, two chromosome ends had significantly shorter telomeres than the other ends, which led to a variety of chromosome abnormalities. Near senescence, additional ends became telomere signal free, and chromosome aberrancies increased dramatically. Interstitial telomere sequences coincided with fragile sites, suggesting that these remnants of chromosome fusion events might contribute to genome instability. One SV40-immortalized cell line lacked telomerase, and its genetic instability was corrected by the ectopic expression of telomerase, confirming that too-short telomeres were the source of abnormalities. Indian muntjac cells provide an excellent system for understanding the mechanism of replicative senescence and the role of telomerase in the elongation of individual telomeres.     

Comparative genomic analysis links karyotypic evolution with genomic evolution in the Indian Muntjac (Muntiacus muntjak vaginalis)

The karyotype of Indian muntjacs (Muntiacus muntjak vaginalis) has been greatly shaped by chromosomal fusion, which leads to its lowest diploid number among the extant known mammals. We present, here, comparative results based on draft sequences of 37 bacterial artificial clones (BAC) clones selected by chromosome painting for this special muntjac species. Sequence comparison on these BAC clones uncovered sequence syntenic relationships between the muntjac genome and those of other mammals. We found that the muntjac genome has peculiar features with respect to intron size and evolutionary rates of genes. Inspection of more than 80 pairs of orthologous introns from 15 genes reveals a significant reduction in intron size in the Indian muntjac compared to that of human, mouse, and dog. Evolutionary analysis using 19 genes indicates that the muntjac genes have evolved rapidly compared to other mammals. In addition, we identified and characterized sequence composition of the first BAC clone containing a chromosomal fusion site. Our results shed new light on the genome architecture of the Indian muntjac and suggest that chromosomal rearrangements have been accompanied by other salient genomic changes. Electronic Supplementary Material Supplementary material is available in the online version of this article at and is accessible for authorized users.Qi Zhou, Ling Huang, Jianguo Zhang: these authors contributed equally to the paper.Sequence data from this article have been deposited in the GenBank Libraries under Accession No. DQ280153-DQ280188, DQ377335, DQ458964.     

Origin and evolution of a major feline satellite DNA

A major satellite DNA has been cloned from the domestic cat (Felis catus) and characterized. The satellite monomer, termed FA-SAT, is 483 base-pairs in size, 64% G + C, and represents about 1 to 2% of the cat genome. A consensus sequence based upon partial sequence data from 21 independently isolated clones demonstrates: (1) FA-SAT is not composed of a series of shorter repeats, although about 25 copies, primarily imperfect, of the hexanucleotide TAACCC appear in the sequence; (2) there are many more CpG dinucleotides present in FA-SAT than expected for a random sequence of its size; and (3) 61% of all base substitutions in FA-SAT involve the replacement of G and C residues by A and T residues, indicating that FA-SAT is rapidly becoming A + T-rich. FA-SAT-related sequences are found in many mammals, where they appear to be scattered throughout the genome and not tandemly arranged as in the cat. An FA-SAT-related sequence was cloned from the domestic dog genome and sequenced, and shown to contain multiple copies of the same TAACCC hexanucleotide found in the cat satellite.     

Visible light observations on the kinetochore of the Indian muntjac, Muntiacus muntjac, Z

We report here a silver stain technique (Kt stain) for locating the kinetochore (centromere body) without concomitant staining of C-band material. We compare our observations with those obtained from C-banding, Cd (centromeric dot) banding, and electron micrographs, and we report preliminary observations on Indian muntjac centromeres.     

Chromosome numbers and karyotypic evolution of Caraboidea

The chromosome numbers of 136 species of the Spanish caraboid fauna were studied. The most frequent karyotypes are 2n=37 (54 species) and 2n=24 (23 species), and the chromosome number ranges from 2n=21 to 2n=69, of which 2n=69 is the highest diploid number hitherto found among the Coleoptera. It is proposed that 2n=37 is the ancestral karyotype of the division Caraboidea and the suborder Adephaga as opposed to that of the suborder Polyphaga, 2n=20. Karyotypic evolution has led to increases and decreases of this number, both tendencies having taken place in four genera. Species of ten genera show a neo-XY bivalent due to an X-autosome fusion. The thirty-three chromosome numbers of Caraboidea reveal that these Coleoptera have a remarkable karyotypical heterogeneity.