Composite structure of the chloroplast 23 S ribosomal RNA genes of Chlamydomonas reinhardii: Evolutionary and functional implications

The chloroplast ribosomal unit of Chlamydomonas reinhardii displays two features which are not shared by other chloroplast ribosomal units. These include the presence of an intron in the 23 S ribosomal RNA gene and of two small genes coding for 3 S and 7 S rRNA in the spacer between the 16 S and 23 S rRNA genes (Rochaix & Malnoë, 1978). Sequencing of the 7 S and 3 S rRNAs as well as their genes and neighbouring regions has shown that: (1) the 7 S and 3 S rRNA genes are 282 and 47 base-pairs long, respectively, and are separated by a 23 base-pair A + T-rich spacer. (2) A sequence microheterogeneity exists within the 3 S RNA genes. (3) The sequences of the 7 S and 3 S rRNAs are homologous to the 5′ termini of prokaryotic and other chloroplast 23 S rRNAs, indicating that the C. reinhardii counterparts of 23 S rRNA have a composite structure. (4) The sequences of the 7 S and 3 S rRNAs are related to that of cytoplasmic 5.8 S rRNA, suggesting that these RNAs may perform similar functions in the ribosome. (5) Partial nucleotide sequence complementarity is observed between the 5′ ends of the 7 S and 3 S RNAs on one hand and the 23 S rRNA sequences which flank the ribosomal intron on the other. These data are compatible with the idea that these small rRNAs may play a role in the processing of the 23 S rRNA precursor.     

A possible role of the 5'' terminal sequence of 16S ribosomal RNA in the recognition of initiation sequences for protein synthesis.

Extensive complementarity is found between the 5' end of 16S ribosomal RNA and protein synthesis initiation sites of bacteriophage RNA. Hybrids can be constructed from base sequences of 16S-RNA and two initiation regions on phage RNA. A model is proposed for the involvement of 16S-RNA in the unfolding of hairpin loops containing the initiation codon AUG.     

Complementarity between ferritin H mRNA and 28 S ribosomal RNA

We have found an interesting complementarity in sequences of human ferritin H mRNA and 28 S ribosomal RNA. Immediately upstream of the initiating AUG in the ferritin mRNA is a stretch of 67 nucleotides which contains sequences complementary to several regions in 28 S RNA. One such region can form 55 base pairings with the 5' noncoding region of the ferritin H mRNA. Most of the complementarity is due to repeats of CCG in the ferritin mRNA and GGC in the ribosomal RNA. The regions of complementarity in the 28 S RNA appear to be expansion sequences that have arisen in the evolution of eukaryotic ribosomal RNA. We suggest that interaction of ferritin mRNA and 28 S RNA may function to regulate the stability and/or translatability of ferritin mRNA.     

Complete DNA sequence coding for the large ribosomal RNA of yeast mitochondria.

The mitochondrial gene coding for the large ribosomal RNA (21S) has been isolated from a rho- clone of Saccharomyces cerevisiae. A DNA segment of about 5500 base pairs has been sequenced which included the totality of the sequence coding for the mature ribosomal RNA and the intron. The mature RNA sequence corresponds to a length of 3273 nucleotides. Despite the very low guanine-cytosine content (20.5%), many stretches of sequence are homologous to the corresponding Escherichia coli 23S ribosomal RNA. The sequence can be folded into a secondary structure according to the general models for prokaryotic and eukaryotic large ribosomal RNAs. Like the E.coli gene, the mitochondrial gene contains the sequences that look like the eukaryotic 5.8S and the chloroplastic 4.5S ribosomal RNAs. The 5' and 3' end regions show a complementarity over fourteen nucleotides.     

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.     

Secondary structure model for 23S ribosomal RNA.

A secondary structure model for 23S ribosomal RNA has been constructed on the basis of comparative sequence data, including the complete sequences from E. coli. Bacillus stearothermophilis, human and mouse mitochondria and several partial sequences. The model has been tested extensively with single strand-specific chemical and enzymatic probes. Long range base-paired interactions organize the molecule into six major structural domains containing over 100 individual helices in all. Regions containing the sites of interaction with several ribosomal proteins and 5S RNA have been located. Segments of the 23S RNA structure corresponding to eucaryotic 5.8S and 25 RNA have been identified, and base paired interactions in the model suggest how they are attached to 28S RNA. Functionally important regions, including possible sites of contact with 30S ribosomal subunits, the peptidyl transferase center and locations of intervening sequences in various organisms are discussed. Models for molecular 'switching' of RNA molecules based on coaxial stacking of helices are presented, including a scheme for tRNA-23S RNA interaction.     

The 3'' terminal oligonucleotide of E. coli 16S ribosomal RNA: the sequence in both wild-type and RNase iii- cells is complementary to the polypurine tracts common to mRNA initiator regions.

Application of Sanger techniques to the analysis of the 3' terminal oligonucleotide from E. coli 32-P-labelled 16 S rRNA yields the sequence AUCACCUCCUUAOH. This sequence is identical in RNA isolated from two wild-type strains (MRE600 and E. coli B, SY106) and from a mutant strain (AB301/105) defective in RNase III. Data presented here explains the previous derivation of an incorrect sequence (AUCCUCACUUCAOH) by others. The functional significance of complementarity between the 3' terminus of 16S rRNA and poly-purine tracts commonly found in mRNA initiator regions is discussed.     

The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

The complete nucleotide sequence of the major species of cytoplasmic 5S ribosomal RNA of Euglena gracilis has been determined. The sequence is: 5' GGCGUACGGCCAUACUACCGGGAAUACACCUGAACCCGUUCGAUUUCAGAAGUUAAGCCUGGUCAGGCCCAGUUAGUAC UGAGGUGGGCGACCACUUGGGAACACUGGGUGCUGUACGCUUOH3'. This sequence can be fitted to the secondary structural models recently proposed for eukaryotic 5S ribosomal RNAs (1,2). Several properties of the Euglena 5S RNA reveal a close phylogenetic relationship between this organism and the protozoa. Large stretches of nucleotide sequences in predominantly single-stranded regions of the RNA are homologous to that of the trypanosomatid protozoan Crithidia fasticulata. There is less homology when compared to the RNAs of the green alga Chlorella or to the RNAs of the higher plants. The sequence AGAAC near position 40 that is common to plant 5S RNAs is CGAUU in both Euglena and Crithidia. The Euglena 5S RNA has secondary structural features at positions 79-99 similar to that of the protozoa and different from that of the plants. The conclusions drawn from comparative studies of cytochrome c structures which indicate a close phylogenetic relatedness between Euglena and the trypanosomatid protozoa are supported by the comparative data with 5S ribosomal RNAs.     

Mini-III, an unusual member of the RNase III family of enzymes, catalyses 23S ribosomal RNA maturation in B. subtilis

The late steps of both 16S and 5S ribosomal RNA maturation in the Gram-positive bacterium Bacillus subtilis have been shown to be catalysed by ribonucleases that are not present in the Gram-negative paradigm, Escherichia coli. Here we present evidence that final maturation of the 5' and 3' extremities of B. subtilis 23S rRNA is also performed by an enzyme that is absent from the Proteobacteria. Mini-III contains an RNase III-like catalytic domain, but curiously lacks the double-stranded RNA binding domain typical of RNase III itself, Dicer, Drosha and other well-known members of this family of enzymes. Cells lacking Mini-III accumulate precursors and alternatively matured forms of 23S rRNA. We show that Mini-III functions much more efficiently on precursor 50S ribosomal subunits than naked pre-23S rRNA in vitro, suggesting that maturation occurs primarily on assembled subunits in vivo. Lastly, we provide a model for how Mini-III recognizes and cleaves double-stranded RNA, despite lacking three of the four RNA binding motifs of RNase III.     

Refined secondary structure models for the 16S and 23S ribosomal RNA of Escherichia coli

The complete range of published sequences for ribosomal RNA (or rDNA), totalling well over 50,000 bases, has been used to derive refined models for the secondary structures of both 16S and 23S RNA from E. coli. Particular attention has been paid to resolving the differences between the various published secondary structures for these molecules. The structures are described in terms of 133 helical regions (45 for 16S RNA and 88 for 23S RNA). Of these, approximately 20 are still tentative or unconfirmed. A further 20 represent helical regions which definitely exist, but where the detailed base-pairing is still open to discussion. Over 90 of the helical regions are however now precisely established, at least to within one or two base pairs.     

Nucleotide sequences of accessible regions of 23S RNA in 50S ribosomal subunits.

Nucleotide sequences around kethoxal-reactive guanine residues of 23S RNA in 50S ribosomal subunits have been determined. By use of the diagonal paper electrophoresis method )Noller, H.F. (1974), Biochemistry 13, 4694-4703), 41 ribonuclease T1 oligonucleotides, originating from about 25 sites, were identified and sequenced. These sites are single stranded and accessible in free 50S subunits, and are thus potential sites for interaction with functional ligands during protein synthesis. Examination of these sequences for potential intermolecular base-pairing reveals the following: (1) There are 19 possible complementary combinations between exposed sequences in 16S and 23S RNA containing more than 4 base pairs: 15 containing 5 base pairs and 4 containing 6 base pairs. Nine of these complementary combinations contain 16S RNA sequences which we have previously shown to be protected from kethoxall by 50S subunits (Chapman, N.M., and Noller, H.F. (1977), J. Mol. Biol. 109, 131-149). (2) One of the exposed sites in 23S RNA has a sequence which is complementary to the invariant GT psi CR sequence in tRNA.     

Basepairing of oligonucleotides to the 3'' end of 16S ribosomal RNA is not stabilized by ribosomal proteins

We have studied the binding of the octanucleotide (5'-3')d(AAGGAGGT) which is fully complementary to the 3' end of 16S ribosomal RNA, to ribosomes and to the isolated target sequence (5'-3') (ACCUCCUUA). The binding constant for 30S or 70S ribosomes is (5 +/- 2) X 10(7) mol-1, whereas the duplex containing the octa- and the nonanucleotide has an association constant of (6 +/- 3) X 10(7) mol-1. The two values are the same within the experimental error. This result suggests that basepairing at the 3' end of 16S rRNA is not stabilized by ribosomal proteins.     

The terminal sequences of Bombyx mori 18S ribosomal RNA.

The 5' and 3' terminal T1 oligonucleotides of 32p-labelled B. mori 18S ribosomal RNA were isolated by a two dimensional electrophoretic (diagonal) technique. Nucleotide sequence analysis showed that the 3' terminal fragment, (G)AUCAUUAOH, is identical to that previously obtained from the 18S rRNA of several other eukaryotic species. The sequence of the B. mori 5' terminal fragment is pUCCUCG.     

Isolation from rat liver and sequence of a RNA fragment containing 32 nucleotides from position 5 to 36 from the 3'' end of ribosomal 18S RNA.

Crude tRNA isolated from rat liver by the method of Rogg et al. (Biochem. Biophys. Acta 195, 13-15 1969) contains N6-dimethyladenosine (m6-2A) and was therefore fractionated in order to identify the m6-2A-containing RNAs. A unique species of RNA was purified which contained all the m62A present in the crude tRNA. Sequence analysis by postlabeling with gamma-32p-ATP and polynucleotide kinase revealed that this RNA represents the 32 nucleotides AAGGUUUC(C)U GUAGGUGm62Am62ACCUGCGGAAGGAUC from position 5 to 36 of the 3' terminus of ribosomal 18S RNA. The 36 nucleotide long sequence from the 3' end of rat liver 18S rRNA exhibits extensive homology with the corresponding sequence of E. coli 16S rRNA and with the 21 nucleotide long 3' terminal sequence so far known from Saccharomyces carlsbergensis 17S rRNA. A heterogeneity in this sequence provides the first evidence on the molecular level for the existence of (at least) two sets of redundant ribosomal 18S RNA genes in the rat.