共查询到20条相似文献,搜索用时 31 毫秒
1.
Structural studies of the O6meG.T interaction in the d(C-G-T-G-A-A-T-T-C-O6meG-C-G) duplex 总被引:8,自引:0,他引:8
High-resolution proton and phosphorus NMR studies are reported on the self-complementary d(C1-G2-T3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplex (henceforth called O6meG.T 12-mer), which contains T3.O6meG10 interactions in the interior of the helix. The imino proton of T3 is observed at 9.0 ppm, exhibits a temperature-independent chemical shift in the premelting transition range, and broadens out at the same temperature as the imino proton of the adjacent G2.C11 toward the end of the helix at pH 6.8. We observed inter base pair nuclear Overhauser effects (NOEs) between the base protons at the T3.O6meG10 modification site and the protons of flanking G2.C11 and G4.C9 base pairs, indicative of the stacking of the T3 and O6meG10 bases into the helix. Two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) studies have permitted assignment of the base and sugar H1', H2', and H2' nonexchangeable protons in the O6meG.T 12-mer duplex. The observed NOEs demonstrate an anti conformation about all the glycosidic bonds, and their directionality supports formation of a right-handed helix in solution. The observed NOEs between the T3.O6meG10 interaction and the adjacent G2.C11 and G4.C9 base pairs at the modification site exhibit small departures from patterns for a regular helix in the O6.meG.T 12-mer duplex. The phosphorus resonances exhibit a 0.5 ppm spectral dispersion indicative of an unperturbed phosphodiester backbone for the O6meG.T 12-mer duplex. We propose a model for pairing of T3 and O6meG10 at the modification site in the O6meG.T 12-mer duplex.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
2.
Complete assignment of the imino protons of Escherichia coli valine transfer RNA: two-dimensional NMR studies in water 总被引:1,自引:0,他引:1
The imino proton spectrum of Escherichia coli valine tRNA has been studied by two-dimensional nuclear Overhauser effect spectroscopy (NOESY) in H2O solution. The small nuclear Overhauser effects from the imino proton of an internal base pair to the imino protons of each nearest neighbor can be observed as off-diagonal cross-peaks. In this way most of the sequential NOE connectivity trains for all the helices in this molecule can be determined in a single experiment. AU resonances can be distinguished from GC resonances by the AU imino NOE to the aromatic adenine C2-H, thus leading to specific base-pair assignments. In general, the NOESY spectrum alone is not capable of assigning every imino proton resonance even in well-resolved tRNA spectra. Multiple proton peaks exhibit more than two cross-peaks, resulting in ambiguous connectivities, and coupling between protons with similar chemical shifts produces cross-peaks that are incompletely resolved from the diagonal. The sequence of the particular tRNA determines the occurrence of the latter problem, which can often be solved by careful one-dimensional experiments. The complete imino proton assignments of E. coli valine tRNA are presented. 相似文献
3.
Base pair mismatches and carcinogen-modified bases in DNA: an NMR study of G.T and G.O4meT pairing in dodecanucleotide duplexes 总被引:4,自引:0,他引:4
High-resolution two-dimensional NMR studies have been completed on the self-complementary d(C-G-C-G-A-G-C-T-T-G-C-G) duplex (designated G.T 12-mer) and the self-complementary d(C-G-C-G-A-G-C-T-O4meT-G-C-G) duplex (designated G.O4meT 12-mer) containing G.T and G.O4meT pairs at identical positions four base pairs in from either end of the duplex. The exchangeable and nonexchangeable proton resonances have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOESY) spectra for the G.T 12-mer and G.O4meT 12-mer duplexes in H2O and D2O solution. The guanosine and thymidine imino protons in the G.T mismatch resonate at 10.57 and 11.98 ppm, respectively, and exhibit a strong NOE between themselves and to imino protons of flanking base pairs in the G.T 12-mer duplex. These results are consistent with wobble pairing at the G.T mismatch site involving two imino proton-carbonyl hydrogen bonds as reported previously [Hare, D. R., Shapiro, L., & Patel, D. J. (1986) Biochemistry 25, 7445-7456]. In contrast, the guanosine imino proton in the G.O4meT pair resonates at 8.67 ppm. The large upfield chemical shift of this proton relative to that of the imino proton resonance of G in the G.T mismatch or in G.C base pairs indicates that hydrogen bonding to O4meT is either very weak or absent. This guanosine imino proton has an NOE to the OCH3 group of O4meT across the pair and NOEs to the imino protons of flanking base pairs.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
4.
Behavior of the imino protons of the lambda OR3 17mer studied by high resolution NMR 总被引:2,自引:0,他引:2
S J Lee H Akutsu Y Kyogoku K Kitano Z Tozuka A Ohta E Ohtsuka M Ikehara 《Nucleic acids symposium series》1983,(12):197-200
Imino proton resonances of lambda OR3 17mer were observed with time-shared Redfield pulse method by using a JEOL 500 MHz NMR instrument. They show gradual broadening and disappearance with the elevation of temperature indicating the stepwise melting of the duplex. By the selective irradiation at each peak position nuclear Overhauser effects were observed between the imino and adenine C2H protons and between imino protons themselves. Combining these data, fifteen imino proton resonances could be assigned to each base pair except two terminal AT base pairs. Based on the assignment it can be said that AT rich regions near the terminal melt first, followed by the melting of the inside GC rich core. The two AT base pairs in the middle of the GC core are resistant to heat. Spin lattice relaxation times were also observed and the results are consistent with the melting profile. 相似文献
5.
High-resolution proton nuclear magnetic resonance spectroscopy and nuclear Overhauser effects for the low-field exchangeable proton resonances of human normal adult hemoglobin in aqueous solvents are being used to confirm and extend the assignments of these resonances to specific protons at the intersubunit interfaces of the molecule. Most of these exchangeable proton resonances of human normal adult hemoglobin have been found to be absent in the spectra of isolated alpha or beta subunits. This finding indicates that they are specific spectral markers for the quaternary structure of the hemoglobin tetramer. Based on the nuclear Overhauser effect results, we have assigned the exchangeable proton resonance at +7.4 ppm downfield from H2O to the hydrogen-bonded proton between alpha 103(G10)His and beta 108(G10)Asn at the alpha 1 beta 1 interface. The nuclear Overhauser effect results have also confirmed the assignments of the exchangeable proton resonances at +9.4 and +8.2 ppm downfield from H2O previously proposed by workers in this laboratory based on a comparison of human normal adult hemoglobin and appropriate mutant hemoglobins. This independent confirmation of previously proposed assignments is necessary in view of the possible long-range conformational effects of single amino-acid substitutions in mutant hemoglobin molecules. 相似文献
6.
Yeast tRNAPhe has been studied by using proton NMR and nuclear Overhauser effect (NOE) with deuterium substitution. Direct NOE evidence is presented for assignment of imino resonances of 23 of 27 base pairs in this tRNA. Other indirect evidence is presented for tentative assignment of four other base pairs. Almost total assignment also has been made of the important noninternally bonded imino protons and tertiary interactions (however, G18-psi 55 remains unassigned). The most surprising result has been identification of GC11 at -13.68 ppm; this is the first time a GC base pair has been identified so far downfield. This peak (GC11) is also identified as the resonance of the unique imino proton that exchanges in a time of more than 1 day, as previously described. These identifications of imino proton resonances made it possible to reinterpret the proton solvent exchange rate data previously published on this tRNA and understand them better. The assignments of resonances should pave the way for more detailed solution study of this tRNA and its interaction with biologically relevant molecules. 相似文献
7.
O6-ethylguanine carcinogenic lesions in DNA: an NMR study of O6etG.T pairing in dodecanucleotide duplexes 总被引:3,自引:0,他引:3
High-resolution two-dimensional NMR studies are reported on the self-complementary d-(C1-G2-C3-O6etG4-A5-G6-C7-T8-T9-G10-C11-G12) duplex (designated O6etG.T 12-mer) containing two symmetrically related O6etG.T lesion sites located four base pairs in from either end of the duplex. Parallel studies were undertaken on a related sequence containing O6meG.T lesion sites (designated O6meG.T 12-mer) in order to evaluate the influence of the size of the alkyl substituent on the structure of the duplex and were undertaken on a related sequence containing G.T mismatch sites (designated G.T 12-mer duplex), which served as the control duplex. The exchangeable and nonexchangeable proton and the phosphorus nuclei have been assigned from an analysis of two-dimensional nuclear Overhauser enhancement (NOE) and correlated spectra of the O6etG.T 12-mer, O6meG.T 12-mer, and G.T 12-mer duplexes in H2O and D2O solutions. The distance connectivities observed in the NOESY spectra of the O6alkG.T 12-mer duplexes establish that the helix is right-handed and all of the bases adopt an anti conformation of the glycosidic torsion angle including the O6alkG4 and T9 bases at the lesion site. The imino proton of T9 at the O6alkG.T lesion sites resonates at 8.85 ppm in the O6etG.T 12-mer duplex and at 9.47 ppm in the O6meG.T 12-mer duplex. The large upfield shift of the T9 imino proton resonance at the O6alkG4.T9 lesion site relative to that of the same proton in the G4.T9 wobble pair (11.99 ppm) and the A4.T9 Watson-Crick pair (13.95 ppm) in related sequences establishes that the hydrogen bonding of the imino proton of T9 to O6alkG4 is either very weak or absent. The imino proton of T9 develops NOEs to the CH3 protons of the O6etG and O6meG alkyl groups across the base pair, as well as to the imino and H5 protons of the flanking C3.G10 base pair and the imino and CH3 protons of the flanking A5.T8 base pair in the O6alkG.T 12-mer duplexes. These observations establish that the O6alkG4 and T9 residues are stacked into the duplex and that the O6CH3 and O6CH2CH3 groups of O6alkG4 adopt a syn orientation with respect to the N1 of the alkylated guanine.(ABSTRACT TRUNCATED AT 400 WORDS) 相似文献
8.
S J Lee H Akutsu Y Kyogoku M Shin E Ohtsuka M Ikehara 《Nucleic acids symposium series》1984,(15):117-120
High resolution proton NMR were measured for the deoxyoligonucleotide 22mer duplex corresponding to the CAP (catabolite gene activator protein) binding site of lac promotor. The spectra in the lower field region than the water resonance were taken with the time-shared Redfield pulse method by using a JEOL 500 MHz NMR spectrometer. In the imino proton region 18 peaks were separately observed, but the area intensity at 10 degrees C corresponds to 20 protons. By selective irradiation at each peak position NOEs (nuclear Overhauser effects) were observed between the imino and adenine C2H protons and between imino proton themselves. By tracing sequential NOE train carefully, 17 imino proton signals could be unambiguously assigned to each base pair except five AT base pairs at terminals. With the elevation of temperature the peaks showed gradual broadening and disappeared, which indicates the stepwise base pair opening of the duplex. Referring to the above peak assignments it can be concluded that GC20 and AT4 pairs close to terminals relax first and the base pair opening proceeds toward central GC13 and 14. 相似文献
9.
A series of double-helical oligodeoxyribonucleotides of sequence corresponding to a frame-shift mutational hot spot in the lambda CI gene, 5'-dGATGGGGCAG, are compared by proton magnetic resonance spectroscopy at 500 MHz of the exchangeable protons. Duplexes containing an extra guanine in a run of two, three, and four G.C base pairs are compared to regular helices of the same sequence and to another sequence containing an isolated bulged G, 5'-dGATGGGCAG.dCTGCGCCATC. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Resonances assigned to the G tract in bulge-containing duplexes are shifted anomalously upfield and are very broad. Imino proton lifetimes are determined by T1 inversion-recovery experiments. The exchange rates of G-tract imino protons in bulged duplexes are rapid compared to those in regular helices and are discussed in terms of the apparent rate of solvent exchange for the isolated G bulge. Delocalization of a bulged guanosine in homopolymeric sequences can explain the observed changes in chemical shift and relaxation times across the entire G.C run, and the chemical shifts can be fit by a simple model of fast exchange between base-paired and unpaired states for the imino protons. This allows us to calculate the relative occupancies of each bulge site. In these sequences, we find the extra base prefers positions internal to the G tract over those at the edge. 相似文献
10.
Peptide NH resonances in the 250 MHZ 1H nuclear magnetic resonance (NMR) spectrum of oxytocin in H2O were assigned to specific amino acid residues by the "underwater decoupling" technique (i.e., decoupling from corresponding CalphaH resonances, which are buried beneath the intense water peak). These experiments confirm previous assignments of A. I. Brewster an V. J. Hruby ((1973), Proc. Natl. Acad. Sci. U.S.A. 70, 3806) and A. F. Bradbury et al. ((1974), FEBS Lett. 42, 179). Three methods of assigning NH resonances of peptides--solvent titration, underwater decoupling, and isotopic labeling--are compared. As the solvet composition is gradually changed from dimethyl sulfoxide to H2O, oxytocin undergoes a conformational change at 70-90 mol % of H2O. Exposure to solvent of specific hydrogens of oxytocin in H2O was studied by monitoring intensity changes of solute resonances when the solvent peak was saturated. Positive nuclear Overhauser effects (NOE's) of 14 +/- 5 were observed for the Tyr ortho CH and meta CH resonances, respectively. Comparative studies with deamino-oxytocin indicate that these effects result predominantly from intermolecular dipoledipole interaction between aromatic side chain CH protons and protons of the solvent. The NOE's therefore indicate intimate contact between water and the aromatic CH hydrogens of the Tyr side chain. The extent of saturation transferred by proton exchange between water and NH group varies with Ph in a manner which appears to reflect the acid-base catalysis of the protolysis reaction. There is no indication that any NH protons are substantially shiedled from the solvent. 相似文献
11.
Structural studies of the O6meG.C interaction in the d(C-G-C-G-A-A-T-T-C-O6meG-C-G) duplex 总被引:10,自引:0,他引:10
One- and two-dimensional nuclear magnetic resonance (NMR) experiments have been undertaken to investigate the conformation of the d(C1-G2-C3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) self-complementary dodecanucleotide (henceforth called O6meG.C 12-mer), which contains C3.O6meG10 interactions in the interior of the helix. We observe intact base pairs at G2.C11 and G4.C9 on either side of the modification site at low temperature though these base pairs are kinetically destabilized in the O6meG.C 12-mer duplex compared to the G.C 12-mer duplex. One-dimensional nuclear Overhauser effects (NOEs) on the exchangeable imino protons demonstrate that the C3 and O6meG10 bases are stacked into the helix and act as spacers between the flanking G2.C11 and G4.C9 base pairs. The nonexchangeable base and H1', H2', H2', H3', and H4' protons have been completely assigned in the O6meG.C 12-mer duplex at 25 degrees C by two-dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) experiments. The observed NOEs and their directionality demonstrate that the O6meG.C 12-mer is a right-handed helix in which the O6meG10 and C3 bases maintain their anti conformation about the glycosidic bond at the modification site. The NOEs between the H8 of O6meG10 and the sugar protons of O6meG10 and adjacent C9 exhibit an altered pattern indicative of a small conformational change from a regular duplex in the C9-O6meG10 step of the O6meG.C 12-mer duplex. We propose a pairing scheme for the C3.O6meG10 interaction at the modification site. Three phosphorus resonances are shifted to low field of the normal spectral dispersion in the O6meG.C 12-mer phosphorus spectrum at low temperature, indicative of an altered phosphodiester backbone at the modification site. These NMR results are compared with the corresponding parameters in the G.C 12-mer, which contains Watson-Crick base pairs at the same position in the helix. 相似文献
12.
We report on proton and phosphorus high resolution NMR investigations of the self-complementary dodecanucleotide d(C1-G2-N3-G4-A5-A6-T7-T8-C9-O6meG10-C11-G12) duplexes (henceforth called O6 meG.N 12-mers), N = C, T, A and G, which contain N3.O6meG10 interactions in the interior of the helix. These sequences containing a single modified O6meG per strand were prepared by phosphoamidite synthesis and provide an excellent model for probing the structural basis for covalent carcinogenic lesions in DNA. Distance dependent nuclear Overhauser effect (NOE) measurements and line widths of imino protons demonstrate that the N3 and O6meG.10 bases stack into the duplex and are flanked by stable Watson-Crick base pairs at low temperature for all four O6meG.N 12-mer duplexes. The imino proton of T3 in the O6meG.T 12-mer and G3 in the O6meG.N 12-mer helix, which are associated with the modification site, resonate at unusually high field (8.5 to 9.0 ppm) compared to imino protons in Watson-Crick base pairs (12.5 to 14.5 ppm). The nonexchangeable base and sugar protons have been assigned from two dimensional correlated (COSY) and nuclear Overhauser effect (NOESY) measurements on the O6meG.N 12-mer helices. The directionality of the distance dependent NOEs establish all O6meG.N duplexes to be right-handed helices in solution. The glycosidic torsion angles are in the anti range at the N3.O6meG10 modification site except for O6meG10 in the O6meG.G 12-mer duplex which adopts a syn configuration. This results in altered NOEs between the G3 (anti).O6meG10 (syn) pair and flanking G2.C11 and G4.C9 base pairs in the O6meG.G 12-mer duplex. We observe pattern reversal for cross peaks in the COSY spectrum linking the sugar H1' protons with the H2',2" protons at the G2 and O6meG10 residues in the O6meG.N 12-mer duplexes with the effect least pronounced for the O6meG.T 12-mer helix. The proton chemical shift and NOE data have been analyzed to identify regions of conformational perturbations associated with N3.O6meG10 modification sites in the O6meG.N 12-mer duplexes. The proton decoupled phosphorus spectrum of O6meG.T 12-mer duplex exhibits an unperturbed phosphodiester backbone in contrast to the phosphorus spectra of the O6meG.C 12-mer, O6meG.G 12-mer and O6meG.A 12-mer duplexes which exhibit phosphorus resonances dispersed over 2 ppm characteristic of altered phosphodiester backbones at the modification site. Tentative proposals are put forward for N3.O6meG10 pairing models based on the available NMR data and serve as a guide for the design of future experiments. 相似文献
13.
Fluorine and deuterium NMR relaxation studies have been used to examine the motion of the 4-fluorophenyl ring attached to the active site of [(4-fluorophenyl)sulfonyl]-alpha-chymotrypsin at pH 4. Analysis of the results indicates that rotation about the 2-fold axis of this ring is reasonably rapid, though not as fast as in tosylchymotrypsin. Two-dimensional (2D) nuclear Overhauser effects (NOEs) were used to suggest the shifts of those protons of the enzyme close enough to the fluorine nucleus to lead to relaxation; important proton-fluorine dipolar relaxation contributions arise from protons with shifts of 7.4 +/- 0.3 ppm and between 4.0 and 5.4 ppm. Specific deuteration permits the assignment of the first of these to the protons ortho to the fluorine while serine-189, cysteines-191 and -220, and methionine-192 are suggested as possible bearers of the other protons. The fluorine chemical shift effect observed for the native conformation of this protein is 9 ppm downfield of the shift observed with the denatured protein; this large shift may be the result of van der Waals interactions between the fluorine and one or more of the protons whose signals appear in the 2D NOE experiments. 相似文献
14.
Conformation of an RNA pseudoknot. 总被引:15,自引:0,他引:15
The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al. 相似文献
15.
G Otting R Grütter W Leupin C Minganti K N Ganesh B S Sproat M J Gait K Wüthrich 《European journal of biochemistry》1987,166(1):215-220
Two-dimensional nuclear Overhauser enhancement (NOESY) spectra of labile protons were recorded in H2O solutions of a protein and of a DNA duplex, using a modification of the standard NOESY experiment with all three 90 degree pulses replaced by jump-and-return sequences. For the protein as well as the DNA fragment the strategically important spectral regions could be recorded with good sensitivity and free of artifacts. Using this procedure, sequence-specific assignments were obtained for the imino protons, C2H of adenine, and C4NH2 of cytosine in a 23-base-pair DNA duplex which includes the 17-base-pair OR3 repressor binding site of bacteriophage lambda. Based on comparison with previously published results on the isolated OR3 binding site, these data were used for a study of chain termination effects on the chemical shifts of imino proton resonances of DNA duplexes. 相似文献
16.
Pseudomonas putida and Azotobacter vinelandii ferredoxins each contain one [4Fe-4S] cluster and one [3Fe-4S] cluster. Their polypeptide chains are nearly identical, differing by only 15 residues out of a total of 106. T1 measurements and temperature dependence studies of the 1H NMR spectrum of each ferredoxin demonstrate that all six resolved downfield resonances are near an iron-sulfur center. The five most downfield resonances are shown to arise from protons on cysteinyl beta-carbons by incorporation of cysteine deuterated at the beta-carbon into cell protein. The sixth peak (10.5 ppm) is shown to be a non-cysteinyl proton. This peak resolves into two resonances of approximately equal intensity at temperatures below 15 degrees or above 25 degrees C. A nuclear Overhauser effect observed between the two downfield-most resonances of A. vinelandii ferredoxin indicates that they originate from a geminal pair of beta-cysteinyl protons. An Overhauser effect observed between the resonances at 22.3 and 15.7 ppm, in conjunction with other results, implies that the resonance at 22.3 ppm arises from a beta-proton on the 3Fe-center-bound Cys16, while the resonance at 15.7 ppm arises from Cys45 beta-proton, which is bound to the 4Fe center. The five most downfield resonances are pH-dependent. The sixth peak (10.5 ppm in P. putida ferredoxin) is pH-independent. Possible origins for the observed pH dependencies are discussed. 相似文献
17.
Shilpa Dogra Sweta Tripathi T.P. Pradeep Maya S. Nair Ritu Barthwal 《Journal of biomolecular structure & dynamics》2013,31(7):1164-1183
Mitoxantrone is a promising antitumor drug having considerably reduced cardiotoxicity as compared to anthracyclines. Its binding to deoxyhexanucleotides sequence d-(ATCGAT)2 has been studied by proton and phosphorous-31 nuclear magnetic resonance spectroscopy. The stoichiometry reveals that 1:1 and 2:1 mitoxantrone-d(ATCGAT)2 complexes are formed in solution. Significant upfield shifts in 6H/7H, 2H/3H, 11NH, and 12NH protons (~.5?ppm) of mitoxantrone and T6NH imino protons (~.3?ppm) are observed. The phosphorous resonances do not shift significantly indicating that the base pairs do not open at any nucleotide step along the sequence of hexamer. Several inter-molecular Nuclear Overhauser Enhancement connectivities between mitoxantrone and hexanucleotide protons indicate that mitoxantrone chromophore stacks with terminal A1-T6 base pair and side chains involving 12CH2, 12NH, and 14OH protons are in close proximity of A1, T2, A5, and T6 bases. Absorption and emission spectra show red shift in wavelength maxima, which is characteristic of stacking interaction. At higher mitoxantrone to nucleic acid ratios, electrostatic interactions are dominant. The 2:1 drug/DNA stoichiometric structure obtained by restrained Molecular Dynamics simulations shows considerable distortions in backbone torsional angles and helicoidal parameters although structural fluctuations in 25?ps analysis of trajectory are found to be negligible. Mitoxantrone binds as a monomer at either or both ends of hexamer externally with side chains interacting specifically with DNA. The findings are relevant to the understanding of pharmacological action of drug. 相似文献
18.
Summary Hydroxyl groups of serine and threonine, and to some extent also tyrosine are usually located on or near the surface of proteins. NMR observations of the hydroxyl protons is therefore of interest to support investigations of the protein surface in solution, and knowledge of the hydroxyl NMR lines is indispensable as a reference for studies of protein hydration in solution. In this paper, solvent suppression schemes recently developed for observation of hydration water resonances were used to observe hydroxyl protons of serine, threonine and tyrosine in aqueous solutions of small model peptides and the protein basic pancreatic trypsin inhibitor (BPTI). The chemical shifts of the hydroxyl protons of serine and threonine were found to be between 5.4 and 6.2 ppm, with random-coil shifts at 4°C of 5.92 ppm and 5.88 ppm, respectively, and those of tyrosine between 9.6 and 10.1 ppm, with a random-coil shift of 9.78 ppm. Since these spectral regions are virtually free of other polypeptide1H NMR signals, cross peaks with the hydroxyl protons are usually well separated even in homonuclear two-dimensional1H NMR spectra. To illustrate the practical use of hydroxyl proton NMR in polypeptides, the conformations of the side-chain hydroxyl groups in BPTI were characterized by measurements of nuclear Overhauser effects and scalar coupling constants involving the hydroxyl protons. In addition, hydroxyl proton exchange rates were measured as a function of pH, where simple first-order rate processes were observed for both acid- and base-catalysed exchange of all but one of the hydroxyl-bearing residues in BPTI. For the conformations of the individual Ser, Thr and Tyr side chains characterized in the solution structure with the use of hydroxyl proton NMR, both exact coincidence and significant differences relative to the corresponding BPTI crystal structure data were observed.[/p] 相似文献
19.
NMR studies of DNA (R+)n.(Y-)n.(Y+)n triple helices in solution: imino and amino proton markers of T.A.T and C.G.C+ base-triple formation 总被引:26,自引:0,他引:26
High-resolution exchangeable proton two-dimensional NMR spectra have been recorded on 11-mer DNA triple helices containing one oligopurine (R)n and two oligopyrimidine (Y)n strands at acidic pH and elevated temperatures. Our two-dimensional nuclear Overhauser effect studies have focused on an 11-mer triplex where the third oligopyrimidine strand is parallel to the oligopurine strand. The observed distance connectivities establish that the third oligopyrimidine strand resides in the major groove with the triplex stabilized through formation of T.A.T and C.G.C+ base triples. The T.A.T base triple can be monitored by imino protons of the thymidines involved in Watson-Crick (13.65-14.25 ppm) and Hoogsteen (12.9-13.55 ppm) pairing, as well as the amino protons of adenosine (7.4-7.7 ppm). The amino protons of the protonated (8.5-10.0 ppm) and unprotonated (6.5-8.3 ppm) cytidines in the C.G.C+ base triple provide distinct markers as do the imino protons of the guanosine (12.6-13.3 ppm) and the protonated cytidine (14.5-16.0 ppm). The upfield chemical shift of the adenosine H8 protons (7.1-7.3 ppm) establishes that the oligopurine strand adopts an A-helical base stacking conformation in the 11-mer triplex. These results demonstrate that oligonucleotide triple helices can be readily monitored by NMR at the individual base-triple level with distinct markers differentiating between Watson-Crick and Hoogsteen pairing. Excellent exchangeable proton spectra have also been recorded for (R+)n.(Y-)n.(Y+)n 7-mer triple helices with the shorter length permitting spectra to be recorded at ambient temperature.(ABSTRACT TRUNCATED AT 250 WORDS) 相似文献
20.
With proton nuclear magnetic resonance spectroscopy at 22 degrees C and pD 4.5, individual exchange rates in the range from 2 X 10(-5) to 1 X 10(-1) min-1 were observed for 23 amide protons in recombinant desulfatohirudin. The remaining 38 backbone amide protons exchange more rapidly than 1 X 10(-1) min-1. All 23 slowly exchanging protons are located in the polypeptide segment from residue 4 to residue 42, which forms a well-defined globular domain. Three different breathing modes of this molecular region are manifested in the exchange data, which appear to be correlated with the location of the three disulfide bonds. Chemical shift changes larger than 0.15 ppm between pH 2.5 and pH 5.0 arising from through-space interactions with carboxyl groups were observed for seven backbone amide protons. Two of these shifts can be explained by hydrogen bonds in the core of the protein, Gly 25 NH-Glu 43 O epsilon and Ser 32 NH-Asp 33 O delta, and two others by intraresidual NH-O epsilon interactions in Glu 61 and Glu 62. The remaining three pH shifts for Glu 35, Cys 39, and Ile 59 imply the existence of transient interactions between the molecular core and the flexible C-terminal segment 49-65, which have so far not been characterized by nuclear Overhauser effects or other conformational constraints. 相似文献