Three-State Diagram for DNA

Abstract

Experimental phase diagrams (A form, B form, Coil) were built in the coordinates (a, alcohol fraction: T, temperature) for the natural DNAs and poly d(A-T). The main parameter of the B-A transition,—cooperativity length, v _o, was estimated by the slopes of the branches A-B, A-Coil, B-Coil in the vicinity of the triple point: v _o +AD0- 10-20 base pairs, which corresponds to the energy for the B/A junction of 1.2–1.8 kcal/mol.

We discovered two new effects which are due to the coexistence of the three different conformations in one polymeric molecule: an increase in the melting temperature above that for the ‘ideal’ triple point (i.e. for the case of the ideal phase transitions); a widening of the melting curve within the B-A transition range.

The physics of these phenomena is discussed.     

Mechanochemical study of NaDNA and NaDNA-netropsin fibers in ethanol-water and trifluoroethanol-water solutions.

Highly oriented calf-thymus NaDNA fibers, prepared by a wet-spinning method, were complexed with netropsin in ethanol-water and trifluoroethanol (TFE)-water solutions. The relative fiber length, L/L0, was measured at room temperature as a function of ethanol or TFE concentration to obtain information on the B-A conformational transition. The B-A transition point and transition cooperativity of the fibers were calculated. The binding of netropsin to NaDNA fibers was found to stabilize B form and to displace the B-A transition to higher ethanol concentration, as indicated by its elongational effect on the fiber bundles. An increased salt concentration was found to reduce netropsin binding. In netropsin-free ethanol solution, the dissociation of bound netropsin from the DNA fibers was observable. Pure B-NaDNA fibers were found to be more stable in TFE solution than in ethanol solution. This was interpreted as being due to a different steric factor and a larger polarity of TFE compared with ethanol, resulting in its smaller capacity to reduce the water activity and dielectric constant of the medium in the immediate vicinity of DNA fibers. Therefore, the effect of netropsin binding on the B-A transition of NaDNA fibers became less obvious in TFE solution. In another series of experiments, L/L0 was measured as a function of temperature to obtain information on the helix-coil transition, or melting, as well as the B-A transition of NaDNA and NaDNA-netropsin fibers. The melting temperature and helix-coil transition width were calculated from the melting curves. A phenomenological approach was used to describe the melting behavior of the fibers in and around the B-A transition region. The effect of netropsin on the melting of DNA fibers was attributed mainly to the stabilization of B-DNA and to a higher melting cooperativity in the B-DNA region.     

A study of DNA melting in concentrated water-alcohol solutions

The DNA melting profiles with high resolution have been studied for conditions corresponding to the B and A conformations of DNA in water-alcohol solutions. The melting profiles of the A-form and B-form DNA, their mean melting temperatures and melting range width were found to differ. DNA was shown to be heterogeneous in respect of the B-A transition, the GC-rich regions more readily converting into the A form than AT-rich ones. The presence of boundaries between the A and B sections within the transition zone did not smooth off the fine structure of melting profiles.     

B-A and B-Z transitions in deoxyoligoduplexes containing 4- and 5- methylcytosine

Self-complementary oligodeoxynucleotides: GGACCCGGGTCC, GGA4mCCCGGGTCC, GGA5mCCCGGGTCC, CGCGCGCG, CG4mCGCGCG, CG5mCGCGCG were synthetized to study the contribution of methyl groups into the energetics of the three known cooperative transitions in DNA: helix-coil, B-A and B-Z With the use of circular dichroism and absorbtion methods the profiles of the above transitions were obtained by variation of temperature (helix-coil), trifluoroethanol fraction (B-A), NaCl and trifluorethanol contents (B-Z). On the basis of the transition widths and shifts of the transition points due to the methylations the energetics of the methyl groups was estimated. 5mC stabilizes the B form relatively the A form by 0.33 kcal/mol; while 4mC by 0.5 kcal/mol. In the B-Z transition 5 mC stabilizes the Z form by 0.28 kcal/mol relatively the B form; 4mC stabilizes also the Z form although by 0.14 kcal/mol only. Thus, these naturally occurring modifications could modulate substantially the ability of a DNA piece to shift into the A or Z form.     

A Linear Biopolymer in the Vicinity of the Triple Point The Homopolymer Case

Abstract

This is a theoretical study of a situation where each residue of a linear biopolymer may adopt one of three conformational states. Such a situation exists in the case of DNA, since it may be in helical A, B,…, Z forms as well as the melted state. In the vicinity of the triple point in the phase diagram three states, e.g. the A form, the B form and the denatured state, co-exist within a given molecule. We present an exact analytical solution of the simplest homopolymer model. Theory predicts that the presence of two helical states in one molecule should affect the helix-coil transition in two ways. The melting temperature experiences an upward shift and the melting range width is increased, by a factor of √2 as a maximum.     

A Study of DNA Melting in Concentrated Water-Alcohol Solutions

Abstract

The DNA melting profiles with high resolution have been studied for conditions corresponding to the B and A conformations of DNA in water-alcohol solutions. The melting profiles of the A-form and B-form DNA, their mean melting temperatures and melting range width were found to differ. DNA was shown to be heterogeneous in respect of the B-A transition, the GC-rich regions more readily converting into the A form than AT-rich ones. The presence of boundaries between the A and B sections within the transition zone did not smooth off the fine structure of melting profiles.     

A study of the B-A transition in DNA by gel electrophoresis

A procedure is developed for studying the B-A transition in DNA using gel electrophoresis. The starting point has been the idea that the junction between the A and B sections, which appear within the transition interval would increase the mobility of the DNA molecules. Indeed, the mobility of DNA in a gel is shown to increase in the middle of the B-A transition due to the formation of the largest possible number of boundaries between the B and A forms. The middle of the B-A transition in supercoiled DNA appears to be shifted against the middle of the transition in open circular (as well as linear) DNA by about 1.3% towards lower ethanol concentrations under the influence of the superhelical stress.     

A Study of the B-A Transition in DNA by Gel Electrophoresis

Abstract

A procedure is developed for studying the B-A transition in DNA using gel electrophoresis. The starting point has been the idea that the junction between the A and B sections, which appear within the transition interval would increase the mobility of the DNA molecules. Indeed, the mobility of DNA in a gel is shown to increase in the middle of the B-A transition due to the formation of the largest possible number of boundaries between the B and A forms. The middle of the B-A transition in supercoiled DNA appears to be shifted against the middle of the transition in open circular (as well as linear) DNA by about 1.3% towards lower ethanol concentrations under the influence of the superhelical stress.     

CC/GG contacts facilitate the B to A transition of DNA in solution

Self-complementary decadeoxynucleotides, CCGATATCGG, CCAGATCTGG, CCCTGCAGGG, GGGGGCCCCC, were designed and synthesized to estimate the A-philic free energy of CC/GG contacts. First, regions of temperature-stability of the double-stranded conformation were determined for each 10-mer. Then, circular dichroism spectra were recorded for the B-family forms at different temperatures, counter-ion concentrations and trifluoroethanol contents. A cooperative change typical of the B-A transition is observed in the CD spectra at a trifluoroethanol content specific for each duplex. The positions of half-transition points were functions not only of the nucleotide sequence but of the duplex length as well: the B to A transitions were hindered in these 10-mers in comparison with a lengthy DNA. The B-phility value was estimated to be 3 kcal/mol of 10-mer. The B-A transition point was shown to drop with an increase in the number of CC/GG contacts in a duplex. The designed 10-mers made it possible to estimate quantitatively the A-phility of CC/GG contact as compared with an average DNA: (FA-FB)CC = 0.2 Kcal/mol, (FA-FB)DNA = 0.7 Kcal/mol.     

Theory of DNA melting in the interval of B-A transition

Theory of DNA melting within the B--A transition range is presented. The phase diagram in coordinates alcohol--temperature is plotted. The temperature shift of DNA helix--coil transition in the B--A transition point is predicted to be delta T = 3 degrees. The temperature rise of DNA melting in the range of B--A transition is caused by the presence of junctions between regions in B and A forms in helical sections.     

Modulation of the B-A transition of DNA by potential antitumor antibiotics. Influence of the base composition of DNA

The B-A transition of DNA in oriented films of DNA-drug complexes is more or less restricted as a consequence of drug binding as revealed by infrared linear dichroism. A fraction of DNA is irreversibly locked into the B form. This behavior is described by the number of DNA base pairs "frozen" in the B form by one drug molecule. This quantity is dependent on the DNA sequence the drug is attached to. In this paper, drug complexes of oriented films of NaDNA with a GC content of 42% from calf thymus and a GC-rich DNA from Micrococcus lysodeikticus were compared. The restriction of the B-A transition of DNA complexes with two intercalating antibiotics, aclacinomycin A and violamycin BI, is not severely influenced by the base composition of DNA. By contrast, the strong groove binding oligopeptide antibiotics netropsin and distamycin A are much less effective to restrict the B-A transition of GC-rich DNA than of AT-rich DNA. This finding is in agreement with previous results by other methods which support a model based upon a strong preference of AT clusters by these two non-intercalating drugs.     

Cholesterol favors phase separation of sphingomyelin

The phase behavior of mixed lipid dispersions representing the inner leaflet of the cell membrane has been characterized by X-ray diffraction. Aqueous dispersions of phosphatidylethanolamine:phosphatidylserine (4:1 mole/mole) have a heterogeneous structure comprising an inverted hexagonal phase H(II) and a lamellar phase. Both phases coexist in the temperature range 20-45 degrees C. The fluid-to-gel mid-transition temperature of the lamellar phase assigned to phosphatidylserine is decreased from 27 to 24 degrees C in the presence of calcium. Addition of sphingomyelin to phosphatidylethanolamine/phosphatidylserine prevents phase separation of the hexagonal H(II) phase of phosphatidylethanolamine but the ternary mixture phase separates into two lamellar phases of periodcity 6.2 and 5.6 nm, respectively. The 6.2-nm periodicity is assigned to the gel phase enriched in sphingomyelin of molecular species comprising predominantly long saturated hydrocarbon chains because it undergoes a gel-to-fluid phase transition above 40 degrees C. The coexisting fluid phase we assign to phosphatidylethanolamine and phosphatidylserine and low melting point molecular species of sphingomyelin which suppresses the tendency of phosphatidylethanolamine to phase-separate into hexagonal H(II) structure. There is evidence for considerable hysteresis in the separation of lamellar fluid and gel phases during cooling. The addition of cholesterol prevents phase separation of the gel phase of high melting point sphingomyelin in mixtures with phosphatidylserine and phosphatidylethanolamine. In the quaternary mixture the lamellar fluid phase, however, is phase separated into two lamellar phases of periodicities of 6.3 and 5.6 nm (20 degrees C), respectively. The lamellar phase of periodicity 5.6 nm is assigned to a phase enriched in aminoglycerophospholipids and the periodicity 6.3 nm to a liquid-ordered phase formed from cholesterol and high melting point molecular species of sphingomyelin characterized previously by ESR. Substituting 7-dehydrocholesterol for cholesterol did not result in evidence for lamellar phase separation in the mixture within the temperature range 20-40 degrees C. The specificity of cholesterol in creation of liquid-ordered lamellar phase is inferred.     

Pressure studies on two hydrated phospholipids--1,2-dimyristoyl-phosphatidylcholine and 1,2-dipalmitoyl-phosphatidylcholine

We present results of studies on the effect of pressure on phase transitions in 1,2-dimyristoyl-phosphatidylcholine (DMPC) and 1,2-dipalmitoyl-phosphatidylcholine (DPPC) dispersed in excess water. The P-T diagram of hydrated DMPC shows a Gel III-Gel II-Gel I triple point at 3.5 kbar, 41 degrees C, the Gel III phase being obtained by annealing the sample at high pressure for several hours. In the case of DPPC, a pressure induced phase (X) appears between the Gel II and Gel I phases at approximately 0.93 kbar. With increasing pressure the temperature range of the X phase increases at the expense of that of the Gel I phase until finally at 2.87 kbar, the latter is completely suppressed. The P-T diagram of water-rich DPPC thus has 2 triple points, the Gel II-X-Gel I triple point at 0.93 kbar, 42.5 degrees C and the X-Gel I-liquid crystal triple point at 2.87 kbar, 98.5 degrees C. A pressure induced Gel III-Gel II transition is also observed in DPPC in the pressure range of 1.7-3 kbar.     

An effective way to determine the melting curve

A new ‘two-phase’ simulation method with which to accurately predict the melting curve is proposed. The method requires, as a starting configuration, generating a two-phase coexistence state by employing a suitable ensemble. Examining a change in volume ratio of the two phases upon varying temperature (pressure) under a fixed pressure (temperature) allows us to determine the phase transition point. The Clausius–Clapeyron relationship can then be implemented as a guide to predict the nearby phase transition point. The method was applied to determine the solid–liquid phase boundary of the modified Lennard–Jones system. A better accuracy, as that achieved by the non-equilibrium relaxation method (Asano Y, Fuchizaki K. J Phys Soc Jpn. 2017;86:025001), was obtained but with much less computational cost.     

Alcohol induced B-A transition of DNAs with different base compositions studied by circular dichroism

The circular dichroic (CD) spectra of natural DNAs (from Cl. perfringens, T2 phage, calf thymus, E. coli, and M. lysodeikticus) as well as duplexes of synthetic DNAs (poly(dA) X poly(dT), poly(dA-dT), and poly(dG-dC] were measured in water-ethanol mixtures with 0.3 mM NaCl. A conformational change from the B to the A form was observed for the natural DNAs on adding ethanol. The ethanol concentration that induces the transition and the extent of the change in the CD spectrum are different for the five natural DNAs depending on their GC contents. The higher the GC content is, the more easily the transition to the A form takes place. The results indicate that the GC content of a DNA is an important factor for induction of the B-A transition. The results for the synthetic DNAs show that their properties cannot be inferred by simple extrapolation of those of natural DNAs. Coexisting ions and the molecular weight of a DNA were also found to affect the induction of the B-A transition.     

Peculiarities of the B to A transition of the lambda phage regulatory site OR3 and of its fragment

Conformations of the synthetic deoxyoligonucleotide 17 base pairs long, which is an OR3 operator of lambda phage, and of its 9-b.p. fragment were studied by the circular dichroism method (CD). The regions of stability of the double-stranded state were determined for these duplexes. A comparison of the CD spectra for these oligonucleotides with the CD for a lengthy DNA showed the conformation of these short DNA pieces to belong to the B-family. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at a TFE concentration specific for each oligonucleotide, which is supposed to stem from a B to A transition. The length of the fragment was found to affect the ability for the B-A transition. The transition into the A form is hindered by 13% TFE for the short 9-nucleotide in comparison with the 17-nucleotide. We suggest that this is due to the B form stabilization by terminal base pairs (B-phility of the ends).     

CC/GG Contacts Facilitate the B to A Transition of DMA in Solution

Abstract

Self-complementary decadeoxynucleotides, CCGATATCGG, CCAGATCTGG, CCCTG- CAGGG, GGGGGCCCCC, were designed and synthesized to estimate the A-philic free energy of CC/GG contacts.

First, regions of temperature-stability of the double-stranded conformation were determined for each 10-mer. Then, circular dichroism spectra were recorded for the B-family forms at different temperatures, counter-ion concentrations and trifluoroethanol contents.

A cooperative change typical of the B-A transition is observed in the CD spectra at a trifluoroethanol content specific for each duplex. The positions of half-transition points were functions not only of the nucleotide sequence but of the duplex length as well: the B to A transitions were hindered in these 10-mers in comparison with a lengthy DNA. The B-phility value was estimated to be 3 kcal/mol of 10-mer.

The B-A transition point was shown to drop with an increase in the number of CC/GG contacts in a duplex. The designed 10-mers made it possible to estimate quantitatively the A- phility of CC/GG contact as compared with an average DNA: (F_A-F_B)CC=0.2 Kcal/mol, (F_A-F_B)DNA=0.7 Kcal/mol.     

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.     

Phase equilibrium in poly(rA).poly(rU) complexes with Cd2+ and Mg2+ ions, studied by ultraviolet, infrared, and vibrational circular dichroism spectroscopy

Ultraviolet (UV) and infrared (IR) absorption and vibrational circular dichroism (VCD) spectroscopy were used to study conformational transitions in the double-stranded poly(rA). poly(rU) and its components-single-stranded poly(rA) and poly(rU) in buffer solution (pH 6.5) with 0.1M Na+ and different Mg2+ and Cd2+ (10(-6) to 10(-2) M) concentrations. Transitions were induced by elevated temperature that changed from 10 up to 96 degrees C. IR absorption and VCD spectra in the base-stretching region were obtained for duplex, triplex, and single-stranded forms of poly(rA) . poly(rU) at [Mg2+],[Cd2+]/[P] = 0.3. For single-stranded polynucleotides, the kind of conformational transition (ordering --> disordering --> compaction, aggregation) is conditioned by the dominating type of Me2+-polymer complex that in turn depends on the ion concentration range. The phase diagram obtained for poly(rA) . poly(rU) has a triple point ([Cd2+] approximately 10(-4)M) at which the helix-coil (2 --> 1) transition is replaced with a disproportion transition 2AU --> A2U + poly(rA) (2 --> 3) and the subsequent destruction of the triple helix (3 --> 1). The 2 --> 1 transitions occur in the narrow temperature interval of 2 degrees -5 degrees . Unlike 2 --> 1 and 3 --> 1 melting, the disproportion 2 --> 3 transition is a slightly cooperative one and observed over a wide temperature range. At [Me2+] approximately 10(-3) M, the temperature interval of A2U stability is not less than 20 degrees C. In the case of Cd2+, it increases with the rise of ion concentration due to the decrease of T(m) (2-->3). The T(m) (3-->1) value is practically unchanged up to [Cd2+] approximately 10(-3)M. Differences between diagrams for Mg(2+) and Cd2+ result from the various kinds of ion binding to poly(rA).poly-(rU) and poly(rA).