Branch migration mediated DNA labeling and cloning

The sequence-dependent attachment (capture) of an oligodeoxynucleotide duplex containing a single-stranded tail can be mediated by branch migration into the end of a DNA molecule. Substitution of bromodeoxycytidine (BrdC) for deoxycytidine (dC) increased DNA-DNA hybrid stability. BrdC-containing oligodeoxynucleotides displaced dC-containing strands from duplexes with blunt ends or 3'-overhangs. In the later case the rate of displacement was of the same order of magnitude as DNA reassociation. A BrdC-containing displacer oligodeoxynucleotide was used for transient sequence-specific invasion at a particular PstI site. The product was captured by use of T4 DNA ligase and a linker oligodeoxynucleotide. The capture rate was more than 300 times the rate observed for an unrelated PstI site. This high degree of specificity required BrdC substitution. In addition, deliberate incorporation of an incorrect nucleotide into a displacer strand demonstrated that branch migration was terminated at a mismatch. A branched, BrdC-containing ligated product of a capture reaction was cloned and sequenced. The specific capture reaction may be used to label a particular DNA fragment prior to electrophoresis, to mark the specific fragment for affinity chromatography, or to facilitate cloning by introducing a new overhanging sequence compatible with a restriction endonuclease site in a cloning vector.     

Investigation of some properties of oligodeoxynucleotides containing 4'-thio-2'-deoxynucleotides: duplex hybridization and nuclease sensitivity.

The thermal stabilities of the duplexes formed between 4'-thio-modified oligodeoxynucleotides and their DNA and RNA complementary strands were determined and compared with those of the corresponding unmodified oligodeoxynucleotides. A 16mer oligodeoxynucleotide containing 10 contiguous 4'-thiothymidylate modifications formed a less stable duplex with the DNA target (deltaTm/modification -1.0 degrees C) than the corresponding unmodified oligodeoxynucleotide. However, when the same oligodeoxynucleotide was bound to the corresponding RNA target, a small increase in Tm was observed (deltaTm/modification +0.16 degrees C) when compared with the unmodified duplex. A study to identify the specificity of an oligodeoxynucleotide containing a 4'-thiothymidylate modification when forming a duplex with DNA or RNA containing a single mismatch opposite the modification found the resulting Tms to be almost identical to the wild-type duplexes, demonstrating that the 4'-thio-modification in oligodeoxynucleotides has no deleterious effect on specificity. The nuclease stability of 4'-thio-modified oligodeoxynucleotides was examined using snake venom phosphodiesterase (SVPD) and nuclease S1. No significant resistance to degradation by the exonuclease SVPD was observed when compared with the corresponding unmodified oligodeoxynucleotide. However, 4'-thio-modified oligodeoxynucleotides were found to be highly resistant to degradation by the endonuclease S1. It was also demonstrated that 4'-thio-modified oligodeoxynucleotides elicit Escherichia coli RNase H hydrolysis of the RNA target only at high enzyme concentration.     

Cleavage of dT8 and dT8 phosphorothioyl analogues by Escherichia coli DNA topoisomerase I: product and rate analysis

Escherichia coli DNA topoisomerase I catalyzes the cleavage of short, single-stranded oligodeoxynucleotides with dT8 as the shortest cleavable oligo(thymidylic acid). The 5'-32P-labeled products formed from the cleavage of [5'-32P]dT8 are dT5, dT4, and dT3 with over 70% of the substrate cleaved to dT4. Mg(II) ions affect this product distribution by increasing the percentage of dT4 formed. The substitution of a sulfur atom for a nonbridging oxygen atom in a phosphodiester linkage yields oligodeoxynucleotide phosphorothioyl (PS) analogues. The epimers of the analogues were separated, and the position and stereochemistry of the phosphorothiodiester bond were determined. Topoisomerase I is stereospecific in its reactivity toward these analogues. With the oligodeoxynucleotide PS analogue substrates, the rate of cleavage, the stereospecificity, and the product distribution depend upon the position and the stereochemistry of the phosphorothiodiester linkage.     

Zebularine: a novel DNA methylation inhibitor that forms a covalent complex with DNA methyltransferases

Mechanism-based inhibitors of enzymes, which mimic reactive intermediates in the reaction pathway, have been deployed extensively in the analysis of metabolic pathways and as candidate drugs. The inhibition of cytosine-[C5]-specific DNA methyltransferases (C5 MTases) by oligodeoxynucleotides containing 5-azadeoxycytidine (AzadC) and 5-fluorodeoxycytidine (FdC) provides a well-documented example of mechanism-based inhibition of enzymes central to nucleic acid metabolism. Here, we describe the interaction between the C5 MTase from Haemophilus haemolyticus (M.HhaI) and an oligodeoxynucleotide duplex containing 2-H pyrimidinone, an analogue often referred to as zebularine and known to give rise to high-affinity complexes with MTases. X-ray crystallography has demonstrated the formation of a covalent bond between M.HhaI and the 2-H pyrimidinone-containing oligodeoxynucleotide. This observation enables a comparison between the mechanisms of action of 2-H pyrimidinone with other mechanism-based inhibitors such as FdC. This novel complex provides a molecular explanation for the mechanism of action of the anti-cancer drug zebularine.     

Bile acid-oligodeoxynucleotide conjugates: synthesis and liver excretion in rats

The synthesis of bile acid oligodeoxynucleotide conjugates via the 3-OH group of the bile acids is described. When used in vivo in rats, covalent conjugation of an oligodeoxynucleotide via a linker to cholic acid resulted in an increased biliary excretion of bile acid-oligodeoxynucleotide conjugates compared to unconjugated oligodeoxynucleotides.     

Synthesis and characterization of phenothiazine labeled oligodeoxynucleotides: novel 2'-deoxyadenosine and thymidine probes for labeling DNA.

A facile procedure for the incorporation of phenothiazine at the terminus of oligodeoxynucleotides is reported. Phenothiazine is covalently linked to the 5'-position of 2'-deoxyadenosine and thymidine. Next, the corresponding phosphoramidites are prepared, and then the labeled nucleosides are incorporated in DNA using an automated DNA solid-phase synthesizer. Phenothiazine labeled oligodeoxynucleotides form stable B-form duplexes with similar melting temperatures, CD spectra, and DSC traces compared to unlabeled DNA duplexes. The favorable photophysical properties of phenothiazine are also retained after covalent attachment to the oligodeoxynucleotide.     

Identification of a base-specific contact between the restriction endonuclease SsoII and its recognition sequence by photocross-linking

A target sequence-specific DNA binding region of the restriction endonuclease SsoII was identified by photocross-linking with an oligodeoxynucleotide duplex which was substituted with 5-iododeoxyuridine (5-IdU) at the central position of the SsoII recognition site (CCNGG). For this purpose the SsoII–DNA complex was irradiated with a helium/cadmium laser (325 nm). The cross-linking yield obtained was ~50%. In the presence of excess unmodified oligodeoxynucleotide or with oligodeoxynucleotides substituted with 5-IdU elsewhere, no cross-linking was observed, indicating the specificity of the cross-linking reaction. The cross-linked SsoII-oligodeoxynucleotide complex was digested with chymotrypsin, a cross-linked peptide–oligodeoxynucleotide complex isolated and the site of cross-linking identified by Edman sequencing to be Trp61. In line with this identification is the finding that the W61A variant cannot be cross-linked with the IdU-substituted oligodeoxynucleotide, shows a decrease in affinity towards DNA and is inactive in cleavage. It is concluded that the region around Trp61 is involved in specific binding of SsoII to its DNA substrate.     

Sequence confirmation of synthetic phosphorothioate oligodeoxynucleotides using Sanger sequencing reactions in combination with mass spectrometry

A protocol relying on Sanger sequencing reactions in combination with mass spectrometry (MS) for sequence confirmation of antisense phosphorothioate oligodeoxynucleotides is described. In this procedure, synthetic phosphorothioate oligodeoxynucleotides are used as reverse primers for extension of matched templates with enough length (approximately 150-300 bp) for well-established Sanger sequencing. Because the complementary strand of modified primer is used directly for sequencing primer extension, the base order shown in the sequencing result is reversely complementary to phosphorothioate oligodeoxynucleotide. This sequencing method can be applied not only to phosphorothioate oligodeoxynucleotides with different lengths (13-21 mer) and base composition but also to sequences with bases' switch, deletion, or insertion. In addition, modified primers incorporate the 5' end of polymerase chain reaction (PCR) products conveying the characters of phosphorothioate modification. The method requires only common reagents and instruments and so is better suited to routine sequence analysis in quality control of phosphorothioate antisense drugs.     

Effect of ionic strength on the hybridization of oligodeoxynucleotides with reduced charge due to methylphosphonate linkages to unmodified oligodeoxynucleotides containing the complementary sequence

A 12-mer oligodeoxynucleotide containing 10 methylphosphonate bonds and 1 phosphodiester bond was shown to bind specifically to the restriction endonuclease fragment containing complementary DNA in a Southern blot. This 12-mer as well as 14-mer oligodeoxynucleotides containing 3 methylphosphonate and 10 phosphodiester bonds was used to examine the effect of reduced charge on the thermodynamics of binding to complementary DNA or complementary oligodeoxynucleotides with additional nucleotides overlapping both the 3' and 5' ends. The 14-mer oligodeoxynucleotides were synthesized with one methylphosphonamidite (A, C, G, or T). Melting profiles were examined by spectrophotometry for the 14-mers and by a gel-shift assay for the 12-mer. Nearest-neighbor free energy values were compiled for predicting concentration-dependent melting temperatures for all oligodeoxynucleotide hybridizations, including those involving adjacent dG residues. The free energy contribution to duplex formation from the dangling ends was about 1 kcal/mol. The free energy decrement due to introduction of each methylphosphonate linkage was -0.75 kcal/mol in high salt independent of the methylphosphonamidite used for synthesis of the oligodeoxynucleotide. However, the change in charge per nearest-neighbor base pair decreased from 0.26 to 0.0 when the nearest-neighbor base pair contained one methylphosphonate. Thus at very low salt, methylphosphonate-substituted oligodeoxynucleotides form more stable hybrids than analogous phosphodiester sequences. The 12-mer with 10 methylphosphonate bonds outcompetes the analogous phosphodiester 12-mer below 0.01 M NaCl. The temperature of 50% dissociation of bound oligodeoxynucleotide after being washed for 30 min was measured with a dot-blot assay. These results, together with the thermodynamic results, indicate that the substitution of methylphosphonate linkages at high salt only affects the reverse rate constant.     

Photooxidation of oligodeoxynucleotides by UO2(2+).

Photooxidation and consequent cleavage of oligodeoxynucleotides by the uranyl ion is greatly enhanced in the presence of a terminal 5'- or 3'-phosphate group. This enhanced cleavage is confined to nearby phosphodiester bonds in the case of a 5'-phosphate, but is less localized in the case of a 3'-phosphate. Several attempts to use a complementary oligodeoxynucleotide to direct a uranyl "warhead" against an oligodeoxynucleotide target were unsuccessful. Our results are most easily explained if we suppose that uranyl ions form coordination complexes with terminal phosphates and that, on photoexcitation, coordinated uranyl ions extract a hydrogen atom from the CH bond of a nearby deoxyribose residue.     

In vivo inhibition of duck hepatitis B virus replication and gene expression by phosphorothioate modified antisense oligodeoxynucleotides.

Antisense oligodeoxynucleotide strategies have been employed in a variety of eukaryotic systems both to understand normal gene function and to block gene expression. Pharmacologically, 'code blockers' are ideal agents for antitumour and antimicrobial treatments because of their specific mode of action. Here we report the inhibition of duck hepatitis B virus (DHBV) by antisense oligodeoxynucleotides in primary duck hepatocyte cultures in vitro as well as in DHBV-infected Pekin ducks in vivo. The most effective antisense oligodeoxynucleotide was directed against the 5' region of the pre-S gene and resulted in a complete inhibition of viral replication and gene expression in vitro and in vivo. These results demonstrate the application of antisense oligodeoxynucleotides in vivo and exemplify their potential as human antiviral therapeutics.     

Oligodeoxynucleotide analogs with 5'-linked anthraquinone

We report here the synthesis of novel 5'-linked oligodeoxynucleotides, both normal phosphodiester and phosphorothioate analogs, in which a covalently attached group at the 5'-terminus is an anthraquinone. These compounds represent a new class of antisense compounds in which the base sequence of the oligodeoxynucleotide serves to deliver a nuclease-resistant reactive drug-like molecule to a cellular target nucleic acid (mRNA or DNA).     

Binding of phosphorothioate oligodeoxynucleotides to basic fibroblast growth factor, recombinant soluble CD4, laminin and fibronectin is P-chirality independent.

Antisense oligodeoxynucleotides can selectively inhibit the expression of individual genes and thus have potential applications in anticancer and antiviral therapy. A critical prerequisite to their use as therapeutic agents is the understanding of their non-specific interactions with biological structures, e.g. proteins. In this study we examined the interactions of P-chiral phosphorothioate oligodeoxynucleotides with several proteins. The Rp- and Sp- diastereomers, and racemic machine-made mixtures, or M-oligodeoxynucleotides were used independently as competitors of the binding of a probe, phosphodiester oligodeoxynucleotide bearing a 5' alkylating moiety, to rsCD4, bFGF and laminin. These oligodeoxynucleotides were also used as competitors of the binding of a non-alkylating probe M-phosphorothioate oligodeoxynucleotide, 5'-32P-SdT18 to fibronectin. The average values of and quantitative estimates for the IC50 of competition and the constant of competition (Kc) of Rp-, Sp- and M-stereoisomers of several homo- and heteropolymer oligodeoxynucleotides were determined and compared. Surprisingly, in the proteins we studied, the values of IC50 and Kc for the Rp-, Sp- and M-oligodeoxynucleotides were essentially identical. Thus, the ability of the phosphorothioate oligodeoxynucleotides we employed, to bind to the proteins studied in this work, is virtually independent of P-chirality. Our results also imply that the role of the purine and pyrimidine bases in oligodeoxynucleotide-protein interactions, as well as the nature of the contact points (sulfur versus oxygen) between the oligomer and the protein, may be relatively unimportant.     

Esterase 2-oligodeoxynucleotide conjugates as sensitive reporter for electrochemical detection of nucleic acid hybridization

A thermostable, single polypeptide chain enzyme, esterase 2 from Alicyclobacillus acidocaldarius, was covalently conjugated in a site specific manner with an oligodeoxynucleotide. The conjugate served as a reporter enzyme for electrochemical detection of DNA hybridization. Capture oligodeoxynucleotides were assembled on gold electrode via thiol-gold interaction. The esterase 2-oligodeoxynucleotide conjugates were brought to electrode surface by DNA hybridization. The p-aminophenol formed by esterase 2 catalyzed hydrolysis of p-aminophenylbutyrate was amperometrically determined. Esterase 2 reporters allows to detect approximately 1.5 x 10(-18)mol oligodeoxynucleotides/0.6 mm2 electrode, or 3 pM oligodeoxynucleotide in a volume of 0.5 microL. Chemically targeted, single site covalent attachment of esterase 2 to an oligodeoxynucleotide significantly increases the selectivity of the mismatch detection as compared to widely used, rather unspecific, streptavidin/biotin conjugated proteins. Artificial single nucleotide mismatches in a 510-nucleotide ssDNA could be reliably determined using esterase 2-oligodeoxynucleotide conjugates as a reporter.     

Intercalation of aflatoxin B1 in two oligodeoxynucleotide adducts: comparative 1H NMR analysis of d(ATCAFBGAT).d(ATCGAT) and d(ATAFBGCAT)2

8,9-Dihydro-8-(N7-guanyl-[d(ATCGAT)])-9-hydroxyaflatoxin B1.d(ATCGAT) and 8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1.8,9-dihydro-8-(N7-guanyl-[d(ATGCAT)])-9-hydroxyaflatoxin B1 were prepared by direct addition of afltoxin B1 8,9-epoxide to d(ATCGAT)2 and d(ATGCAT)2, respectively. In contrast to reaction of aflatoxin B1 8,9-epoxide with d(ATCGAT)2 which exhibits a limiting stoichiometry of 1:1 aflatoxin B1:d(ATCGAT)2 [Gopalakrishnan, S., Stone, M. P., & Harris, T. M. (1989) J. Am. Chem. Soc. 111, 7232-7239], reaction of aflatoxin B1 8,9-epoxide with d(ATGCAT)2 exhibits a limiting stoichiometry of 2:1 aflatoxin B1:d(ATGCAT)2. 1H NOE experiments, nonselective 1H T1 relaxation measurements, and 1H chemical shift perturbations demonstrate that in both modified oligodeoxynucleotides the aflatoxin moiety is intercalated above the 5'-face of the modified guanine. The oligodeoxynucleotides remain right-handed, and perturbation of the B-DNA structure is localized adjacent to the adducted guanine. Aflatoxin-oligodeoxynucleotide 1H NOEs are observed between aflatoxin and the 5'-neighbor base pair and include both the major groove and the minor groove. The aflatoxin methoxy and cyclopentenone ring protons face into the minor groove; the furofuran ring protons face into the major groove. No NOE is observed between the imino proton of the modified base pair and the imino proton of the 5'-neighbor base pair; sequential NOEs between nucleotide base and deoxyribose protons are interrupted in both oligodeoxynucleotide strands on the 5'-side of the modified guanine. The protons at C8 and C9 of the aflatoxin terminal furan ring exhibit slower spin-lattice relaxation as compared to other oligodeoxynucleotide protons, which supports the conclusion that they face into the major groove. Increased shielding is observed for aflatoxin protons; chemical shift perturbations of the oligodeoxynucleotide protons are confined to the immediate vicinity of the adducted base pair. The imidazole proton of the modified guanine exchanges with water and is observed at 9.75 ppm. The difference in reaction stoichiometry is consistent with an intercalated transition-state complex between aflatoxin B1 8,9-epoxide and B-DNA. Insertion of aflatoxin B1-8,9 epoxide above the 5'-face of guanine in d(ATCGAT)2 would prevent the binding of a second molecule of aflatoxin B1 8,9-epoxide. In contrast, two intercalation sites would be available with d(ATGCAT)2.(ABSTRACT TRUNCATED AT 400 WORDS)     

Polymer support oligonucleotide synthesis XVIII: use of beta-cyanoethyl-N,N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplifying deprotection and isolation of the final product.

Various 5'O-N-protected deoxynucleoside-3'-O-beta-cyanoethyl-N,N-dialkylamino-/N- morpholinophosphoramidites were prepared from beta-cyanoethyl monochlorophosphoramidites of N,N-dimethylamine, N,N-diisopropylamine and N-morpholine. These active deoxynucleoside phosphates have successfully been used for oligodeoxynucleotide synthesis on controlled pore glass as polymer support and are very suitable for automated DNA-synthesis due to their stability in solution. The intermediate dichloro-beta- cyanoethoxyphosphine can easily be prepared free from any PC1(3) contamination. The active monomers obtained from beta-cyanoethyl monochloro N,N- diisopropylaminophosphoramidites are favoured. Cleavage of the oligonucleotide chain from the polymer support, N-deacylation and deprotection of beta-cyanoethyl group from the phosphate triester moiety can be performed in one step with concentrated aqueous ammonia. Mixed oligodeoxynucleotides are characterized by the sequencing method of Maxam and Gilbert.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.