Intraspecific genotypic characterization of Lactobacillus rhamnosus strains intended for probiotic use and isolates of human origin

A set of 118 strains of the species Lactobacillus rhamnosus was collected, including probiotic strains, research strains with potential probiotic properties, food starter cultures, and human isolates. The majority of the strains were collected from companies, hospitals, or culture collections or were obtained after contacting authors who reported clinical case studies in the literature. The present work aimed to reveal the genotypic relationships between strains of these diverse sources. All strains were initially investigated using fluorescent amplified fragment length polymorphism (FAFLP) with three different primer combinations. Numerical analysis of FAFLP data allowed (i) confirmation of the identification of all strains as members of L. rhamnosus and (ii) delineation of seven stable intraspecific FAFLP clusters. Most of these clusters contained both (potentially) probiotic strains and isolates of human origin. For each of the clusters, strains of different sources were selected for pulsed-field gel electrophoresis (PFGE) of macrorestriction fragments obtained with the enzymes NotI and AscI. Analysis of PFGE data indicated that (i) some (potentially) probiotic strains were indistinguishable from other probiotic strains, suggesting that several companies may use duplicate cultures of the same probiotic strain, and (ii) in a number of cases human isolates from sterile body sites were indistinguishable from a particular probiotic strain, suggesting that some of these isolates may be reisolations of commercial strains.     

Protein adsorbents intended for use in aqueous two-phase systems

Preparation of adsorbents with high partition coefficients in polyethylene glycol-dextran and polyethylene glycol-phosphate systems is described. These adsorbents may be used to carry to carry proteins away from the insoluble cell fragments generated during cell disruption. By chromatographic elution, proteins may be selectively desorbed in a reduced volume.     

Porcine endothelial cells,unlike human endothelial cells,can be killed by human CTL via Fas ligand and cannot be protected by Bcl-2

In clinical transplantation host CTL are major effectors of acute rejection, and graft endothelial cells (EC) are major targets of the CTL response. It is unclear what roles CTL will play in pig-into-human xenotransplantation. We compared the mechanisms of killing used by human CTL (huCTL) vs allogeneic and pig xenogeneic EC targets. Both responses show MHC class I restriction of target cell recognition. A granzyme B inhibitor peptide completely blocks anti-human and partially blocks anti-pig responses, while inhibitory Fas ligand Ab only blocks killing of porcine cells despite similar levels of Fas expression in both target cell types. Transduction of Bcl-2 completely protects human EC from huCTL, but has no effect on huCTL-mediated killing of porcine EC despite its efficacy vs drug-induced apoptosis. Bcl-2 effectively protects human EC rendered sensitive to Fas ligand by overexpressing Fas from huCTL, yet fails to protect porcine aortic endothelial cells from huCTL in the presence of anti-Fas ligand Ab. These data reveal differences in the susceptibility of human and porcine targets to huCTL.     

Functional human insulin-degrading enzyme can be expressed in bacteria

Insulin-degrading enzyme (IDE) has been shown to degrade a number of biologically important peptides, including insulin and the amyloid-beta protein implicated in Alzheimer's disease. However, lack of a facile method to generate purified enzyme and related mutants has made it difficult to study the precise role of IDE in the clearance of these peptides. Therefore, we determined whether recombinant wild-type and mutant human IDEs can be overexpressed as functional enzymes in bacteria. Three vectors carrying cDNAs encoding N-terminally polyhistidine-tagged recombinant IDEs were constructed, and the proteins expressed in Escherichia coli were purified by metal affinity chromatography (final yield approximately 8 mg per liter of culture). The recombinant IDEs, like the endogenous mammalian enzyme, migrate with 110-kDa apparent molecular masses in SDS-polyacrylamide gels and as a approximately 200-kDa species in gel filtration. Further analysis by native PAGE indicates that IDE can form multimers of different complexities. The wild-type recombinant endopeptidase degrades insulin with an efficiency similar to that of the enzyme purified from mammalian tissues. Purified IDEs are stable at 4 degrees C for at least 1 month. Purified recombinant protein was used to raise specific polyclonal antibodies that can immunoprecipitate native mammalian IDE. Thus, the procedure described allows the rapid production of large amounts of purified IDE and demonstrates that IDE can be produced in an active form in the absence of other potential interacting mammalian proteins.     

Ribavirin can be mutagenic for arenaviruses

Arenaviruses include several important human pathogens, and there are very limited options of preventive or therapeutic interventions to combat these viruses. An off-label use of the purine nucleoside analogue ribavirin (1-β-d-ribofuranosyl-1-H-1,2,4-triazole-3-carboxamide) is the only antiviral treatment currently available for arenavirus infections. However, the ribavirin antiviral mechanism action against arenaviruses remains unknown. Here we document that ribavirin is mutagenic for the prototypic arenavirus lymphocytic choriomeningitis virus (LCMV) in cell culture. The mutagenic activity of ribavirin on LCMV was observed under single- and multiple-passage regimes and could not be accounted for by a decrease of the intracellular GTP pool promoted by ribavirin-mediated inhibition of inosine monophosphate dehydrogenase (IMPDH). Our findings suggest that the antiviral activity of ribavirin on arenaviruses might be exerted, at least partially, by lethal mutagenesis. Implications for antiarenavirus therapy are discussed.     

Aging by telomere loss can be reversed

Recently in Nature, Jaskelioff et al. (2010) demonstrated that multiple aging phenotypes in a mouse model of accelerated telomere loss can be reversed within 4 weeks of reactivating telomerase. This raises the major question of whether physiological aging, likely caused by a combination of molecular defects, may also be reversible.     

Haloperidol reduction can be assayed in human red blood cells

One metabolite of haloperidol present in plasma is "reduced haloperidol." This study demonstrates that human red blood cells are capable of converting haloperidol to reduced haloperidol in vitro. The reductase involved requires NADPH, as does haloperidol (ketone) reductase in human liver cytosol.     

Domestic dogs and puppies can use human voice direction referentially

Domestic dogs are particularly skilled at using human visual signals to locate hidden food. This is, to our knowledge, the first series of studies that investigates the ability of dogs to use only auditory communicative acts to locate hidden food. In a first study, from behind a barrier, a human expressed excitement towards a baited box on either the right or left side, while sitting closer to the unbaited box. Dogs were successful in following the human''s voice direction and locating the food. In the two following control studies, we excluded the possibility that dogs could locate the box containing food just by relying on smell, and we showed that they would interpret a human''s voice direction in a referential manner only when they could locate a possible referent (i.e. one of the boxes) in the environment. Finally, in a fourth study, we tested 8–14-week-old puppies in the main experimental test and found that those with a reasonable amount of human experience performed overall even better than the adult dogs. These results suggest that domestic dogs’ skills in comprehending human communication are not based on visual cues alone, but are instead multi-modal and highly flexible. Moreover, the similarity between young and adult dogs’ performances has important implications for the domestication hypothesis.     

Microheterogeneity of human kininogen by isoelectric focusing and crossed immunoelectrophoresis.

LMW kininogen was isolated from whole human plasma by gel filtration on Sephadex G-200 (Kav 0.34) followed by DEAE-chromatography according to earlier established methods. Further purification was performed with specific Sepharose-antibody columns to remove protein contaminants, avoiding procedures which may denature kininogen. The microheterogeneity was investigated by isoelectric focusing in column in the pH-gradients 3.5-10, 4-6 and 3.5-5. Kininogen components were determined by single radial immunodiffusion against monospecific anti-human kininogen serum, in comparison with focusing of whole plasma. 40% of isolated as well as whole plasma kininogen focused at pI 4.5; the respective focusing ranges were pI 4.4-4.7 (60--80%) and pI 4.3-4.6 (92%). The results were verified by crossed immunoelectrophoresis. The pI 4.5 component is apparently the main native form of human kininogen as shown by focusing of whole human blood bank plasma. Earlier described difficulty of separating kininogen and alpha2HS-glycoprotein was verified by crossed immunoelectrophoresis which showed approximately seven kininogen components after focusing in polyacrylamide gel electrophoresis at pI 4.5-5.0 and four alpha 2HS components at pI 4.2-4.6.     

Neutrophils activation can be diminished by apolipoprotein A-I

High density lipoprotein (HDL) has anti-inflammatory function. To investigate the effects of apolipoprotein A-I (ApoA-I), the major apolipoprotein of HDL, on activated neutrophils, we stimulated neutrophils in vitro with fMLP and PMA, as a receptor-binding and a nonreceptor-binding stimuli, respectively, and incubated ApoA-I with those neutrophils. Three conditions were utilized: 1) resting neutrophils + ApoA-I (0, 2.5,5, 10 microg/mL respectively), 2) fMLP(10(-7) mol/L)-activated neutrophils + ApoA-I (0, 2.5, 5, 10 microg/mL respectively), and 3) PMA(10(-7) mol/L)-activated neutrophils + ApoA-I (0, 2.5, 5, 10 microg/mL respectively). After incubation, we measured neutrophils adhesion to fibronectin, oxidative bust (O2- and H2O2 production), degranulation (release of MPO and elastase), and L929 cell mortality which were attacked by release-out of cytokines in activated neutrophils (using MTT). Our results showed that in vitro ApoA-I inhibits fMLP- and PMA- activated neutrophil adhesion, oxidative burst, degranulation and L929 cell mortality. These inhibition effects of ApoA-I on fMLP-activated neutrophils are more powerful than that on PMA-activated neutrophils. ApoA-I has no effect on resting neutrophils. We concluded that ApoA-I could diminish the function of activated neutrophils.     

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.     

AA-amyloidosis can be transferred by peripheral blood monocytes

Spongiform encephalopathies have been reported to be transmitted by blood transfusion even prior to the clinical onset. Experimental AA-amyloidosis shows similarities with prion disease and amyloid-containing organ-extracts can prime a recipient for the disease. In this systemic form of amyloidosis N-terminal fragments of the acute-phase reactant apolipoprotein serum amyloid A are the main amyloid protein. Initial amyloid deposits appear in the perifollicular region of the spleen, followed by deposits in the liver. We used the established murine model and induced AA-amyloidosis in NMRI mice by intravenous injections of purified amyloid fibrils ('amyloid enhancing factor') combined with inflammatory challenge (silver nitrate subcutaneously). Blood plasma and peripheral blood monocytes were isolated, sonicated and re-injected into new recipients followed by an inflammatory challenge during a three week period. When the animals were sacrificed presence of amyloid was analyzed in spleen sections after Congo red staining. Our result shows that some of the peripheral blood monocytes, isolated from animals with detectable amyloid, contained amyloid-seed that primed for AA-amyloid. The seeding material seems to have been phagocytosed by the cells since the AA-precursor (SAA1) was found not be expressed by the monocytes. Plasma recovered from mice with AA amyloidosis lacked seeding capacity. Amyloid enhancing activity can reside in monocytes recovered from mice with AA-amyloidosis and in a prion-like way trigger amyloid formation in conjunction with an inflammatory disorder. Human AA-amyloidosis resembles the murine form and every individual is expected to be exposed to conditions that initiate production of the acute-phase reactant. The monocyte-transfer mechanism should be eligible for the human disease and we point out blood transfusion as a putative route for transfer of amyloidosis.     

Sulfonate-sulfur can be assimilated for fermentative growth

Abstract Bacterial assimilation of sulfonate-sulfur under anaerobic conditions has been demonstrated. Two different bacteria able to grow fermentatively using sulfonate-sulfur as sole sulfur source were isolated by enrichment culture; neither were able to utilize sulfonates as sole source of carbon and energy for growth. The isolate of Clostridium pasteurianum assimilated the sulfur of isethionate (2-hydroxyethanesulfonate), taurine (2-aminoethanesulfonate), or p -toluenesulfonate. A facultatively fermentative Klebsiella strain did not utilize the sulfur of any of these sulfonates, but assimilated cysteate-sulfur; in contrast, when growing by aerobic respiration, the range of sulfonates able to serve as sulfur source was greater. Both bacteria displayed a preferential utilization of sulfate-sulfur to that of the sulfonates tested. Thus, bacterial assimilation of sulfonate-sulfur during anaerobic growth has direct parallels with features until now recognized only for aerobic assimilatory processes.     

Increased sensitivity to quinolone antibacterials can be engineered in human topoisomerase IIalpha by selective mutagenesis

A potential region of drug-DNA interaction in the A subunit of DNA gyrase has previously been identified from crystallographic studies. The local amino acid sequence has been compared with similar regions in yeast topoisomerase II and human topoisomerase IIalpha. Three non- conserved, potentially solvent-accessible residues at positions 762, 763 and 766 in human topoisomerase IIalpha lie between well-conserved regions. The corresponding residues in GyrA (83, 84 and 87) have a high frequency of mutation in quinolone-resistant bacteria. Mutations in human topoisomerase IIalpha have been generated in an attempt to engineer ciprofloxacin sensitivity into this enzyme: M762S, S763A and M766D (each mutated to the identical amino acid present in gyrase), along with an M762S/S763A double mutant and a triple mutant. These enzymes were introduced into a temperature-sensitive yeast strain, deficient in topoisomerase II, for in vivo studies, and were overproduced for in vitro studies. The M766D mutation renders the enzyme incapable of supporting the temperature-sensitive strain at a non-permissive temperature. However, both M766D and the triple mutant enzymes can be overproduced and are fully active in vitro. The double mutant was impaired in its ability to cleave DNA and had reduced catalytic activity. The triple mutation confers a three-fold increase in sensitivity to ciprofloxacin in vitro and similar sensitivities to a range of other quinolones. The activity of the quinolone CP-115,953, a bacterial and eukaryotic topoisomerase II poison, was unaffected by any of these mutations. Mutations in this region were found to increase the sensitivity of the enzyme to the DNA intercalating anti-tumour agents m-AMSA and ellipticine, but confer resistance to the non-intercalating agents etoposide, teniposide and merbarone, an effect that was maximal in the triple mutant. We have therefore shown the importance of this region in determining the sensitivity of topoisomerase II to drugs and have engineered increased sensitivity to quinolones.     

Triple-site antigen capture ELISA for human myoglobin can be more effective than double-site assay

Using a panel of monoclonal antibodies against human myoglobin (Mb), we have shown that the sensitivity of antigen-capture ELISA can be significantly increased by simultaneous immobilization of two cooperating capture monoclonal antibodies on a solid phase. This method ("triple-site ELISA") uses three monoclonal antibodies to different epitopes of the same antigen (two capture/one tracer) unlike the traditional double-site assay using one capture and one tracer monoclonal antibody. We developed double- and triple-site ELISA for Mb by varying the capture and tracer monoclonal antibodies. Triple-site assays showed 4-6-fold increase in sensitivity compared to the double-site assays. A model for this effect is suggested; according to the model, in triple-site ELISA, high-affinity cyclic configurations can be formed by an antigen, two capture monoclonal antibodies, and the surface of the solid phase.     

Latent human leukocyte collagenase can be activated by gold thioglucose and gold sodium thiomalate,but not by auranofin

Gold thioglucose and gold sodium thiomalate were shown to be potent activators of latent human leukocyte collagenase. No activation by auranofin was noted. The activation may proceed through the action of gold on the essential sulfhydrylgroups of latent enzyme and, thereby, mimick the action of the known organomercurial activators.