From gel filtration to biosensor technology: the development of chromatography for the characterization of protein interactions

The objective of this review is to summarize the development of chromatographic techniques for the determination of reaction stoichiometries and equilibrium constants for solute interactions of biological importance. Gel chromatography is shown to offer a convenient means of characterizing solute self-association as well as solute-ligand interactions. Affinity chromatography is an even more versatile method of characterizing interactions between dissimilar reactants because the biospecificity incorporated into the design of the affinity matrix ensures applicability of the method regardless of the relative sizes of the two reactants. Adoption of different experimental strategies such as column chromatography, simple partition equilibrium experiments and biosensor technology has created a situation wherein affinity chromatography affords a means of characterizing the whole range of reaction affinities-from relatively weak interactions (binding constants less that 10(3)M (-1)) to tight interactions with binding constants greater than 10(9)M (-1). In addition to its established prowess as a means of solute separation and purification, chromatography thus also possesses considerable potential for investigation of the functional roles of the purified reactants-an endeavour that requires characterization as well as identification of the interactions responsible for a physiological phenomenon.     

Studies of phenytoin binding to human serum albumin by high-performance affinity chromatography

High-performance affinity chromatography was used to study the binding of phenytoin to an immobilized human serum albumin (HSA) column. This was accomplished through frontal analysis and competitive binding zonal elution experiments, the latter of which used four probe compounds for the major and minor binding sites of HSA injected into the presence of mobile phases containing known concentrations of phenytoin. It was found that phenytoin can interact with HSA at the warfarin-azapropazone, indole-benzodiazepine, tamoxifen, and digitoxin sites of this protein. The association constants for phenytoin at the indole-benzodiazepine and digitoxin sites were determined to be 1.04 (+/-0.05) x 10(4)M(-1) and 6.5 (+/-0.6) x 10(3)M(-1), respectively, at pH 7.4 and 37 degrees C. Both allosteric interactions and direct binding for phenytoin appear to take place at the warfarin-azapropazone and tamoxifen sites. This rather complex binding system indicates the importance of identifying the binding regions on HSA for specific drugs as a means for understanding the transport of such substances in blood and in characterizing their potential for drug-drug interactions.     

Protein interaction with immobilized ligands: quantitative analyses of equilibrium partition data and comparison with analytical chromatographic approaches using immobilized metal affinity adsorbents

Quantitative or analytical affinity chromatography has been successful primarily for the analysis of biologically determined macromolecular affinity relationships. Quantitative approaches are also needed to better characterize simpler, chemically defined immobilized ligands with potential for selective interaction with specific, predetermined protein surface groups. Protein interaction with immobilized metal is a rather selective and versatile, high-affinity adsorption technique for which there is little quantitative information. Using model protein interactions with immobilized Cu2+ ions, we have compared analytical frontal affinity chromatographic methods to a simple, nonchromatographic protocol for the rapid determination of quantitative affinity relationships. Values obtained for the equilibrium dissociation constant (Kd) and binding capacity (Lt) characterizing the interaction of lysozyme with immobilized Cu2+ were quite similar by frontal analysis (Kd = 37-42 X 10(-6) M; Lt = 6.8-7.4 X 10(-6) mol protein/ml gel) and by equilibrium binding analyses (Kd = 33 +/- 4.7 X 10(-6) M; Lt = 5.8-6.1 X 10(-6) mol protein/ml gel; 14 determinations). The interaction of ovalbumin with immobilized Cu2+ was characterized by an affinity (Kd = 4.2-4.8 X 10(-6) M) and capacity (Lt = 1.5-2.1 X 10(-6) mol protein/ml gel) which were also the same regardless of the method for affinity analysis. These values indicate that the total protein bound at saturation corresponds to as much as 17% of the total immobilized Cu2+ ions (approximately 40 X 10(-6) mol/ml gel). Thus, depending on the fraction of total immobilized Cu2+ available for interaction with a given protein (e.g., lysozyme), the number of individual immobilized ligands actively participating as well as those rendered unavailable upon individual protein binding events may be greater than 1. Linear Scatchard plots obtained for both lysozyme and ovalbumin (purified) suggest the presence of only a single type of immobilized Cu2+-protein interaction operative under the experimental conditions employed. However, Scatchard analyses of data obtained by the nonchromatographic equilibrium binding method also demonstrated the ability to simultaneously resolve the contribution of two components whose presence was predicted by frontal chromatography. Our results support the validity and utility of equilibrium binding data analyzed according to the equations outlined by Scatchard and others as an alternative to analytical chromatographic methods.     

Evaluation of equilibrium constants by affinity chromatography

Theoretical expressions are derived for affinity chromatography of systems comprising an acceptor A with one binding site for attachment to a functional group X on the column matrix and one site for interaction with a small ligand B that specifically affects its elution. From a general relationship covering all possible interactions between A, B and X simpler expressions are derived for affinity systems in which only two equilibria operate. Methods are suggested whereby these simpler systems may be characterized in terms of the two pertinent equilibrium constants and the concentration of matrix-bound constituent. The means by which the theory may be adapted to affinity chromatography of acceptors with multiple binding sites for ligand is also illustrated. Results of partition experiments on the Sephadex G-100-lysozyme-d-glucose system in acetate-chloride buffer (I=0.17m), pH5.4, are used to demonstrate the feasibility of evaluating quantitatively affinity-chromatography interactions. Values of 30m(-1) and 1.2x10(6)m(-1) are obtained for the equilibrium constants for the reactions of lysozyme with glucose and Sephadex respectively, there being only an occasional binding site in the polysaccharide matrix (approximately 1 in 10(5) glucose residues). In a second experimental study the phytohaemagglutinin from Ricinus communis is subjected to frontal chromatography on Sepharose 4B in the presence of different concentrations of d-galactose, the results illustrating some of the difficulties and limitations that are likely to be encountered in quantitative studies of affinity-chromatographic systems.     

Studies of lectin-carbohydrate interactions by quantitative affinity chromatography: systems with galactose and ovalbumin as saccharidic ligand

The potential of affinity chromatography for characterizing lectin-carbohydrate interactions is investigated. First, the effect of galactose on the chromatographic behavior of Ricinus communis phytohemagglutinin on Sepharose 4B is used to establish that quantitative affinity chromatography on polysaccharide matrices affords an unequivocal means of characterizing the interactions of lectins with monosaccharides in solution. Second, a method of characterizing lectin-glycoprotein interactions by affinity chromatography is illustrated in an experimental study with Sephadex G-50 as affinity matrix for examination of the interaction between concanavalin A and ovalbumin. Third, although no general solution to the problem of ligand multivalency in quantitative affinity chromatography has been found, an experimental protocol has been devised for the situation in which the partitioning solute (lectin) is univalent.     

Analysis of protein self-association under conditions of the thermodynamic non-ideality

Analysis of protein-protein interactions in highly concentrated solutions requires a consideration of the non-ideality in such solutions which is expressed by the virial coefficients. Different equations are presented to estimate effects of the thermodynamic non-ideality on the macromolecular interaction of self-associating proteins in sedimentation equilibrium experiments. Usually the influence of thermodynamic non-ideal behavior are described by concentration power series. The convergence of such power series is limited at high solute concentration. When expressing the thermodynamic non-ideality by an activity power series this disadvantage can be minimized. The developed centrifuge equations are the basis for a global analysis to estimate equilibrium constants and the corresponding thermodynamic activities of the reactants. Based on fit analysis of synthetic concentration profiles it was established that marked deviations from the expected association constants are observed for proteins with strong association forces between solute molecules. Considerable differences were also observed in weakly interacting systems. This was due to the excluded volume of the protein which is similar in magnitude to the binding constant. For interactions with moderate affinities values extremely close to the true binding values were obtained, as confirmed by experimental results with concanavalin A.     

Use of quantitative affinity chromatography for characterizing high-affinity interactions: binding of heparin to antithrombin III

The versatility of quantitative affinity chromatography (QAC) for evaluating the binding of macromolecular ligands to macromolecular acceptors has been increased substantially as a result of the derivation of the equations which describe the partitioning of acceptor between matrix-bound and soluble forms in terms of total, rather than free, ligand concentrations. In addition to simplifying the performance of the binding experiments, this development makes possible the application of the technique to systems characterized by affinities higher than those previously amenable to investigation by QAC. Addition of an on-line data acquisition system to monitor the concentration of partitioning solute in the liquid phase as a function of time has permitted the adoption of an empirical approach for determining the liquid-phase concentration of acceptor in the system at partition equilibrium, a development which decreases significantly the time required to obtain a complete binding curve by QAC. The application of these new QAC developments is illustrated by the determination of binding constants for the interactions of high-affinity heparin (Mr 20,300) with antithrombin III at three temperatures. Association constants of 8.0 +/- 2.2 x 10(7), 3.4 +/- 0.3 x 10(7), and 1.0 +/- 0.2 x 10(7) M-1 were observed at 15, 25, and 35 degrees C, respectively. The standard enthalpy change of -4.2 +/- 0.6 kcal/mol that is calculated from these data is in good agreement with a reported value obtained from fluorescence quenching measurements.     

Interaction between pyridoxal kinase and pyridoxal-5-phosphate-dependent enzymes

The interactions of two pyridoxal-5-phosphate (PLP)-dependent enzymes, alanine aminotransferase (ALT) and glutamate decarboxylase (GAD), with pyridoxal kinase (PK) were studied by fluorescence polarization as well as surface plasmon resonance techniques. The results demonstrated that PK can specifically bind to ALT and GAD. Moreover, binding profiles of both enzymes to immobilized PK were altered by excess amount of PLP. The equilibrium affinity constants for ALT in the absence and presence of PLP are 20.4 x 10(4) M(-1)and 6.7 x 10(4) M(-1), and for GAD are 37 x 10(4) M(-1)and 20.8 x 10(4) M(-1), respectively. It appears that specific interactions occur between PK and PLP-dependent enzymes, and the binding affinities of PK for PLP-dependent enzymes decrease in the presence of PLP. The results support our hypothesis that PLP transfer from PK to PLP-dependent enzymes requires a specific interaction between PK and the enzyme.     

Direct measurement of equilibrium constants for high-affinity hemoglobins

The biological functions of heme proteins are linked to their rate and affinity constants for ligand binding. Kinetic experiments are commonly used to measure equilibrium constants for traditional hemoglobins comprised of pentacoordinate ligand binding sites and simple bimolecular reaction schemes. However, kinetic methods do not always yield reliable equilibrium constants with more complex hemoglobins for which reaction mechanisms are not clearly understood. Furthermore, even where reaction mechanisms are clearly understood, it is very difficult to directly measure equilibrium constants for oxygen and carbon monoxide binding to high-affinity (K(D) < 1 micro M) hemoglobins. This work presents a method for direct measurement of equilibrium constants for high-affinity hemoglobins that utilizes a competition for ligands between the "target" protein and an array of "scavenger" hemoglobins with known affinities. This method is described for oxygen and carbon monoxide binding to two hexacoordinate hemoglobins: rice nonsymbiotic hemoglobin and Synechocystis hemoglobin. Our results demonstrate that although these proteins have different mechanisms for ligand binding, their affinities for oxygen and carbon monoxide are similar. Their large affinity constants for oxygen, 285 and approximately 100 micro M(-1) respectively, indicate that they are not capable of facilitating oxygen transport.     

Binding of [3H]Serotonin to Skeletal Muscle Actin

We previously observed that the neurotransmitter 5-hydroxytryptamine (5-HT, serotonin) binds with high- and low-affinity interactions to an actin-like protein prepared from rat brain synaptosomes. In this study, we examined its binding to highly purified actin obtained from rabbit skeletal muscle. Monomeric G-actin bound serotonin with high and low affinities, exhibiting equilibrium dissociation constants (KD values) of 5 X 10(-5) M and 4 X 10(-3) M, respectively. The serotonin binding site on actin was distinct from those sites previously characterized for divalent cations, nucleotides, and cytochalasin alkaloids. The binding of serotonin (1 microM) to G-actin was increased as much as 26-fold by divalent cations. Potassium iodine (KI) increased the affinity of G-actin for serotonin, KD values for this binding being 3 X 10(-7) M and X 10(-5) M. Serotonin bound with even higher affinity to polymerized F-actin, with KD values of 2 X 10(-8) M and 2 X 10(-5) M. However, the total number of binding sites on F-actin was only about 4% of the number of G-actin. The binding of serotonin (0.1 microM) to G-actin could be inhibited by phenothiazines (1 microM) or reserpine (10 microM), but not by classical antagonists of serotonin receptors or by drugs that release serotonin or inhibit its uptake. The binding of serotonin to actin in vivo may participate in a contractile process related to neurotransmitter release.     

Study on the interactions between anti-HIV-1 active compounds with trans-activation response RNA by affinity capillary electrophoresis

The study on the interactions between two anti-human immunodeficiency virus type 1 (anti-HIV-1) active compounds with trans-activation response (TAR) RNA by affinity capillary electrophoresis (ACE) with UV absorbance detection is presented. The results showed that the novel active molecules could interact with TAR RNA and inhibit the reproduce process of HIV-1. The binding constants were estimated by the change of migration time of the analytes through the change of concentrations of TAR RNA in the buffer solution. The yielded binding constants of 8.87 x 10(3)M(-1) for active compound C(3) and 8.42 x 10(3)M(-1) for MC(3) at 20.0 degrees C, 0.626 x 10(3)M(-1) and 0.644 x 10(3)M(-1) at 37.0 degrees C, respectively. The thermodynamic parameters Delta H and DeltaS were obtained and shown that both hydrophobic and electrostatic interaction played roles in the binding processes. The results showed that the presented method was an easy and simple method to evaluate the interaction of small molecules with some bioactive materials.     

Analytical high-performance affinity chromatography: evaluation by studies of neurophysin self-association and neurophysin-peptide hormone interaction using glass matrices

Bovine neurophysin II (BNP II) was covalently immobilized on both nonporous and porous (200-nm pore diameter) glass beads and incorporated in a high-performance liquid chromatograph to evaluate analytical high-performance affinity chromatography as a microscale method for characterizing biomolecular interactions. By extension of the theoretical treatment of analytical affinity chromatography, both the self-association of neurophysin and its binding of the peptide hormone vasopressin were characterized by using a single chromatographic column containing immobilized neurophysin predominantly in the monomer form. Both [3H] [Arg8]vasopressin (AVP) and 125I-BNP II were rapidly eluted (less than 25 min). The relatively symmetrical elution peaks obtained allowed calculation of both equilibrium dissociation constants and kinetic dissociation rate constants. The dissociation constant measured chromatographically for the AVP-immobilized neurophysin complex, KM/L = 11 microM with porous glass beads and 75 microM with nonporous glass (NPG) beads, was in reasonable agreement with those previously obtained by curve fitting of Scatchard plots (16-20 microM) and from binding to [BNP II]Sepharose (50 microM). The values obtained are larger than that for dissociation of AVP from BNP II dimer, by a factor consistent with the intended nature of immobilized BNP II as monomers. Chromatography of BNP II on the [BNP II]NPG gave a dimer dissociation constant of 166 microM, a value in excellent agreement with that derived from equilibrium sedimentation studies (172 microM). In contrast to the agreement of chromatographic equilibrium binding constants with those measured in solution, the dissociation rate, k-3, determined from the variance of the affinity chromatographic elution profile with nonporous beads, was several orders of magnitude smaller than the solution counterpart.(ABSTRACT TRUNCATED AT 250 WORDS)     

Characterizing high-affinity antigen/antibody complexes by kinetic- and equilibrium-based methods

Two biophysical methods, Biacore and KinExA, were used to kinetically and thermodynamically characterize high-affinity antigen/antibody complexes. Three to five independent experiments were performed on each platform with three different antigen/antibody complexes possessing nanomolar to picomolar equilibrium dissociation constants. By monitoring the dissociation phase on Biacore for 4 h, we were able to measure dissociation rate constants (kd) on the order of 1 x 10(-5)s(-1). To characterize high-affinity interactions by KinExA, samples needed to be equilibrated for up to 35 h to reach equilibrium. In the end, we show that similar kinetic rate constants and affinities were determined with both solution-phase and solid-phase methodologies. These results help further validate both interaction technologies and illustrate their suitability for characterizing extremely high-affinity interactions.     

Self-association studies on the EphB2 receptor SAM domain using analytical ultracentrifugation

The self-association behavior of the Eph-kinases SAM domain has been studied in phosphate buffer, pH 7.4, containing 0.14 M NaCl using concentration-dependent sedimentation equilibrium experiments. Only weak interactions typical for a monomer-dimer equilibrium up to at least 12 mg/mL were observed. Such concentrated solutions require a consideration of the non-ideality expressed by virial coefficients. A special centrifuge equation was used for the global analysis to estimate equilibrium constants based on the thermodynamic activities of the reactants. When neglecting this, the parameters deviate by about 20%. Association constants for dimerization of the EphB2-SAM domain vary between 163 M(-1) at 10 degrees C and 395 M(-1) at 32 degrees C, indicating hydrophobic forces are involved in the dimerization process. In solutions of about 12 mg/mL, less than 50% dimers are in solution and higher oligomers can be excluded.     

High-resolution and high-throughput protocols for measuring drug/human serum albumin interactions using BIACORE

Characterizing how chemical compounds bind to human serum albumin (HSA) is essential in evaluating drug candidates. Using warfarin as a test system, we validate the application of BIACORE SPR biosensors to reliably determine binding constants for drug/HSA interactions. The binding responses for warfarin over HSA surfaces were extremely reproducible even though warfarin is small compared to the size of the immobilized protein. At high concentrations, warfarin bound at more than one site on HSA, which is consistent with its known binding properties. The affinity we determined for the high-affinity site (K(25 degrees C)(d) = 3.7 +/- 1.2 microM), as well as the dissociation rate constant (k(25 degrees C)(d) = 1.2 s(-1)), are also consistent with binding constants determined previously. These results validate the biosensor technology and illustrate how BIACORE can be used to study drug/HSA interactions in a high-resolution mode. Using a set of 10 test compounds, we present a protocol for determining equilibrium dissociation constants for HSA in a high-throughput mode. Our method involves working at low compound concentrations and fitting the equilibrium data for all compounds simultaneously. We show that the % bound values determined by SPR correlate with the values determined by solution-based methods. The ability to examine directly the binding of small molecules (130-800 Da), coupled with minimal sample requirements and automated instrumentation, makes BIACORE technology applicable for evaluating drug/HSA interactions.     

Combination of isothermal titration calorimetry and time-resolved luminescence for high affinity antibody-ligand interaction thermodynamics and kinetics

For experiments using synthetic ligands as probes for biological experiments, it is useful to determine the specificity and affinity of the ligands for their receptors. As ligands with higher affinities are developed (K(A)>10(8)M(-1); K(D)<10(-8)M), a new challenge arises: to measure these values accurately. Isothermal titration calorimetry measures heat produced or consumed during ligand binding, and also provides the equilibrium binding constant. However, as normally practiced, its range is limited. Displacement titration, where a competing weaker ligand is used to lower the apparent affinity of the stronger ligand, can be used to determine the binding affinity as well as the complete thermodynamic data for ligand-antibody complexes with very high affinity. These equilibrium data have been combined with kinetic measurements to yield the rate constants as well. We describe this methodology, using as an example antibody 2D12.5, which captures yttrium S-2-(4-aminobenzyl)-1, 4, 7, 10-tetraazacyclododecanetetraacetate.     

Binding of netropsin and 4,6-diamidino-2-phenylindole to an A2T2 DNA hairpin: a comparison of biophysical techniques

Isothermal titration calorimetry (ITC), differential scanning calorimetry (DSC), and biosensor-surface plasmon resonance (SPR) are evaluated for their accuracy in determining equilibrium constants, ease of use, and range of application. Systems chosen for comparison of the three techniques were the formation of complexes between two minor groove binding compounds, netropsin and 4,6-diamidino-2-phenylindole (DAPI), and a DNA hairpin having the sequence 5'-d(CGAATTCGTCTCCGAATTCG)-3'. These systems were chosen for their structural differences, simplicity (1:1 binding), and binding affinity in the range of interest (K approximately 10(8) M(-1)). The binding affinities determined from all three techniques were in excellent agreement; for example, netropsin/DNA formation constants were determined to be K = 1.7x10(8) M(-1) (ITC), K = 2.4x10(8) M(-1) (DSC), and K = 2.9x10(8) M(-1) (SPR). DSC and SPR techniques have an advantage over ITC in studies of ligands that bind with affinities greater than 10(8) M(-1). The ITC technique has the advantage of determining a full set of thermodynamic parameters, including deltaH, TdeltaS, and deltaC(p) in addition to deltaG (or K). The ITC data revealed complex binding behavior in these minor groove binding systems not detected in the other methods. All three techniques provide accurate estimates of binding affinity, and each has unique benefits for drug binding studies.     

Kinetics of heme binding to semi-alpha-hemoglobin

The binding of carbonmonoxyheme to semi-alpha-hemoglobin and to an apohemoglobin control was investigated using stopped-flow techniques in 0.025 M potassium phosphate buffer, pH 7 and 10 degrees C. The resultant second order kinetic data were analyzed by the classical model which assumes the existence of an intermediate complex which either redissociates to reactants or undergoes an irreversible conversion to form hemoglobin. The rate constants for the latter unimolecular process were apparently not experimentally different for semi-alpha-hemoglobin and apohemoglobin (360 ( +/- 100) s-1 and 480 ( +/- 60) s-1, respectively). However, the equilibrium dissociation constant for the intermediate of semi-alpha-hemoglobin (Kd = 9.3 ( +/- 2.6) micromolar) was approximately two fold greater than that of apohemoglobin (Kd = 4.1 ( +/- 0.5) micromolar). The reduced stability of the semi-alpha-hemoglobin complex was postulated to be due to the lower affinity of the beta pocket for heme. The studies reported here address the possible role of semi-alpha-hemoglobin as an intermediate in the assembly of hemoglobin in vivo.     

Characterization of the interaction between gastrin and its receptor in rat oxyntic gland mucosa

A gastrin receptor, identified in crude membrane preparations of rat oxyntic gland mucosa, has an equilibrium dissociation constant (Kd) of approx. 4 . 10(-10)M and a binding capacity of 4 fmol/mg protein. The binding capacity was significantly lower after 2 days of fasting, parallel with a significant drop in serum gastrin levels; there was no change in Kd. In order to verify Scatchard analysis and to determine if there was a coincident alteration in the association (k+1) and dissociation (k-1) rates in the fasted rat, a kinetics study was performed. Under our conditions, there appeared to be a single set of binding sites and the binding reaction obeyed first-order dissociation, and second-order association rate kinetics. Second-order association rate kinetics were validated by demonstrating the independence of the rate constants when there were alterations in the concentrations of reactants. The average k+1 was determined to be 2 . 10(6) M-1 . s-1. The average k-1 was determined to be 1 . 10(-3) s-1. There was no significant change in the k+1 and k-1 in fed and fasted rats. Fasting decreased the number of gastrin receptors without altering the affinity of the receptor for the hormone.