1H NMR study of the base-pairing reactions of d(GGAATTCC): salt effects on the equilibria and kinetics of strand association

Previously, we examined the imino proton relaxation of d(GGAATTCC) in order to characterize salt and polyamine effects on the base-pair opening kinetics of this oligonucleotide [Braunlin, W. H., & Bloomfield, V. A. (1988) Biochemistry 27, 1184-1191]. Here, we report salt-dependent measurements of the NMR behavior of the nonexchangeable base proton resonances of d(GGAATTCC). From chemical shift measurements, we find an unexpectedly large salt dependence of Ka, the equilibrium constant for helix association. A total of 1.8 +/- 0.3 sodium ions are thermodynamically released upon dissociation of the octamer duplex. Most of the salt dependence of the equilibrium constant can be traced to a large salt dependence of the association rate. Thus, 1.4 +/- 0.2 sodium ions associate during the rate-limiting step of helix association. In agreement with our previous imino proton results, we also find a significant salt dependence of the duplex dissociation rate. Activation energies for helix association are very small, and possibly negative; most of the temperature dependence of the association equilibrium can be traced to a large activation energy (approximately 50 kcal/mol) for duplex dissociation.     

Determinants of conductance of a bacterial voltage-gated sodium channel

Through molecular dynamics (MD) and free energy simulations in electric fields, we examine the factors influencing conductance of bacterial voltage-gated sodium channel Na_vMs. The channel utilizes four glutamic acid residues in the selectivity filter (SF). Previously, we have shown, through constant pH and free energy calculations of pKa values, that fully deprotonated, singly protonated, and doubly protonated states are all feasible at physiological pH, depending on how many ions are bound in the SF. With 173 MD simulations of 450 or 500 ns and additional free energy simulations, we determine that the conductance is highest for the deprotonated state and decreases with each additional proton bound. We also determine that the pKa value of the four glutamic residues for the transition between deprotonated and singly protonated states is close to the physiological pH and that there is a small voltage dependence. The pKa value and conductance trends are in agreement with experimental work on bacterial Na_v channels, which show a decrease in maximal conductance with lowering of pH, with pKa in the physiological range. We examine binding sites for Na⁺ in the SF, compare with previous work, and note a dependence on starting structures. We find that narrowing of the gate backbone to values lower than the crystal structure's backbone radius reduces the conductance, whereas increasing the gate radius further does not affect the conductance. Simulations with some amount of negatively charged lipids as opposed to purely neutral lipids increases the conductance, as do simulations at higher voltages.     

Thermal Stability of Apolipoprotein A-I in High-Density Lipoproteins by Molecular Dynamics

Apolipoprotein (apo) A-I is an unusually flexible protein whose lipid-associated structure is poorly understood. Thermal denaturation, which is used to measure the global helix stability of high-density lipoprotein (HDL)-associated apoA-I, provides no information about local helix stability. Here we report the use of temperature jump molecular dynamics (MD) simulations to scan the per-residue helix stability of apoA-I in phospholipid-rich HDL. When three 20 ns MD simulations were performed at 500 K on each of two particles created by MD simulations at 310 K, bilayers remained intact but expanded by 40%, and total apoA-I helicity decreased from 95% to 72%. Of significance, the conformations of the overlapping N- and C-terminal domains of apoA-I in the particles were unusually mobile, exposing hydrocarbon regions of the phospholipid to solvent; a lack of buried interhelical salt bridges in the terminal domains correlated with increased mobility. Nondenaturing gradient gels show that 40% expansion of the phospholipid surface of 100:2 particles by addition of palmitoyloleoylphosphatidylcholine exceeds the threshold of particle stability. As a unifying hypothesis, we propose that the terminal domains of apoA-I are phospholipid concentration-sensitive molecular triggers for fusion/remodeling of HDL particles. Since HDL remodeling is necessary for cholesterol transport, our model for remodeling has substantial biomedical implications.     

Effect of Zn ion on the structure and electronic states of Aβ nonamer: molecular dynamics and ab initio molecular orbital calculations

Aggregates of amyloid-beta proteins (Aβ) have been recognised to be intimately related to pathogenesis of Alzheimer’s disease (AD). Indeed, Aβ aggregates of various sizes from dimers to fibrils were found in the brains of AD patients, and these aggregates can be self-organised. Since abnormal accumulation of metal ions such as Zn, Cu and Fe was also observed in the brains, the association between Aβ aggregations and these metal ions has been studied widely. In the present study, to elucidate the influence of Zn ions on the stability of Aβ aggregates, we performed molecular dynamics (MD) simulations and ab initio fragment molecular orbital (FMO) calculations on the Aβ nonamers with and without Zn ions and investigated the change in its structure and electronic states induced by Zn ions at atomic and electronic levels. The MD simulations revealed that Aβ nonamer cannot keep its symmetry structure, whereas Aβ nonamer with Zn ions keeps the structure. The FMO results indicated that electrostatic interactions among the charged amino-acid residues of Aβ nonamer are significantly changed by the influence of Zn ions to stabilise Aβ nonamer. These results provide useful information for proposing novel compounds, which binds specifically to Aβ and inhibits the Aβ aggregation.     

Folding simulations of alanine-based peptides with lysine residues.

The folding of short alanine-based peptides with different numbers of lysine residues is simulated at constant temperature (274 K) using the rigid-element Monte Carlo method. The solvent-referenced potential has prevented the multiple-minima problem in helix folding. From various initial structures, the peptides with three lysine residues fold into helix-dominated conformations with the calculated average helicity in the range of 60-80%. The peptide with six lysine residues shows only 8-14% helicity. These results agree well with experimental observations. The intramolecular electrostatic interaction of the charged lysine side chains and their electrostatic hydration destabilize the helical conformations of the peptide with six lysine residues, whereas these effects on the peptides with three lysine residues are small. The simulations provide insight into the helix-folding mechanism, including the beta-bend intermediate in helix initiation, the (i, i + 3) hydrogen bonds, the asymmetrical helix propagation, and the asymmetrical helicities in the N- and C-terminal regions. These findings are consistent with previous studies.     

88 Comparison of monovalent and divalent ion distributions around a DNA duplex with molecular dynamic simulation and Poisson–Boltzmann approach

Ion interactions with nucleic acids (both DNA and RNA) are an important and evolving field of investigation. Positively charged cations may interact with highly negatively charged nucleic acids via simple electrostatic interactions to help screen the electrostatic repulsion along the nucleic acids and assist their folding and/or compaction. Cations may also bind at specific sites and become integral parts of the structures, possibly playing important enzymatic roles. Two popular methods for computationally exploring a nucleic acid’s ion atmosphere are atomistic molecular dynamics (MD) simulations and the Poisson–Boltzmann (PB) equation. In general, monovalent ion results obtained from MD simulations and the PB equation agree well with experiment. However, Bai et al. (2007) observed discrepancies between experiment and the PB equation while examining the competitive binding of monovalent and divalent ions, with more significant discrepancies for divalent ions. The goal of this project was to thoroughly investigate monovalent (Na⁺) and divalent (Mg²⁺) ion distributions formed around a DNA duplex with MD simulations and the PB equation. We simulated three different cation concentrations, and matched the equilibrated bulk ion concentration for our theoretical calculations with the PB equation. Based on previous work, our Mg²⁺ ions were fully solvated, the expected state of Mg²⁺ ions when interacting with a duplex, when the production simulations began and remained throughout the simulations (Kirmizialtin, 2010; Robbins, 2012). Na⁺ ion distributions and number of Na⁺ ions within 10?Å of the DNA obtained from our two methods agreed well. However, results differed for Mg²⁺ ions, with a lower number of ions within the cut-off distance obtained from the PB equation when compared to MD simulations. The Mg²⁺ ion distributions around the DNA obtained via the two methods also differed. Based on our results, we conclude that the PB equation will systematically underestimate Mg²⁺ ions bound to DNA, and much of this deviation is attributed to dielectric saturation associated with high valency ions.     

Spermine: an "invisible" component in the crystals of B-DNA. A grand canonical Monte Carlo and molecular dynamics simulation study

The association of spermine(4+) (Spm(4+)), Mg(2+) and monovalent (M(+)) ions with DNA in crystal form, have been studied using grand canonical Monte Carlo (GCMC) and molecular dynamics (MD) computer simulations. GCMC calculations were used to calculate the distribution of Spm(4+), Mg(2+), and M(+) between the equilibrating solvent and the DNA crystal under conditions mimicking the crystal-growing protocols reported in a number of recent X-ray diffraction studies of DNA oligomers. The GCMC simulations show that the composition of ions neutralizing the negative charge of DNA can vary in a broad range. The GCMC simulations were used to provide appropriate conditions for subsequent 6 ns constant pressure and temperature MD simulations of DNA in a typical crystalline environment consisting of three DNA double helix decamers in a periodic hexagonal cell, containing 1200 water molecules, eight Spm(4+), 32 Na(+) and four Cl(-) ions. Based on the simulation results, it seems possible to give an explanation why spermine molecules are usually not detected in X-ray studies in spite of their high concentration in the preparatory samples used as the crystallizing agent. It appears that this flexible polyamine molecule has several binding modes, interacting in fairly irregular manner with different sites on DNA and showing no regular ordering in the DNA crystals. Ions of Na(+) and Spm(4+) compete with each other and with water molecules in binding to bases in the minor groove and they influence the structure of the DNA hydration shell in different ways.     

Simulation and experiment conspire to reveal cryptic intermediates and a slide from the nucleation-condensation to framework mechanism of folding

There is a change from three-state to two-state kinetics of folding across the homeodomain superfamily of proteins as the mechanism slides from framework to nucleation-condensation. The tendency for framework folding in this family correlates with inherent helical propensity. The cellular myeloblastis protein (c-Myb) falls in the mechanistic transition region. An earlier, preliminary report of protein engineering experiments and molecular dynamics simulations (MD) showed that the folding mechanism for this protein has aspects of both the nucleation-condensation and framework models. In the more in-depth analysis of the MD trajectories presented here, we find that folding may be attributed to both of these mechanisms in different regions of the protein. The folding of the loop, middle helix, and turn is best described by nucleation-condensation, whereas folding of the N and C-terminal helices may be described by the framework model. Experimentally, c-Myb folds by apparent two-state kinetics, but the MD simulations predict that the kinetics hide a high-energy intermediate. We stabilized this hypothetical folding intermediate by deleting a residue (P174) in the loop between its second and third helices, and the mutant intermediate is long-lived in the simulations. Equilibrium and kinetic experiments demonstrate that folding of the DeltaP174 mutant is indeed three-state. The presence and shape of the intermediate observed in the simulations were confirmed by small angle X-ray scattering experiments.     

Domain motions in bacteriophage T4 lysozyme: A comparison between molecular dynamics and crystallographic data

A comparison of a series of extended molecular dynamics (MD) simulations of bacteriophage T4 lysozyme in solvent with X-ray data is presented. Essential dynamics analyses were used to derive collective fluctuations from both the simulated trajectories and a distribution of crystallographic conformations. In both cases the main collective fluctuations describe domain motions. The protein consists of an N- and C-terminal domain connected by a long helix. The analysis of the distribution of crystallographic conformations reveals that the N-terminal helix rotates together with either of these two domains. The main domain fluctuation describes a closure mode of the two domains in which the N-terminal helix rotates concertedly with the C-terminal domain, while the domain fluctuation with second largest amplitude corresponds to a twisting mode of the two domains, with the N-terminal helix rotating concertedly with the N-terminal domain. For the closure mode, the difference in hinge-bending angle between the most open and most closed X-ray structure along this mode is 49 degrees. In the MD simulation that shows the largest fluctuation along this mode, a rotation of 45 degrees was observed. Although the twisting mode has much less freedom than the closure mode in the distribution of crystallographic conformations, experimental results suggest that it might be functionally important. Interestingly, the twisting mode is sampled more extensively in all MD simulations than it is in the distribution of X-ray conformations. Proteins 31:116–127, 1998. © 1998 Wiley-Liss, Inc.     

Molecular modeling of temperature dependence of solubility parameters for amorphous polymers

A molecular modeling strategy is proposed to describe the temperature (T) dependence of solubility parameter (δ) for the amorphous polymers which exhibit glass-rubber transition behavior. The commercial forcefield "COMPASS" is used to support the atomistic simulations of the polymer. The temperature dependence behavior of δ for the polymer is modeled by running molecular dynamics (MD) simulation at temperatures ranging from 250 up to 650 K. Comparing the MD predicted δ value at 298 K and the glass transition temperature (T(g)) of the polymer determined from δ-T curve with the experimental value confirm the accuracy of our method. The MD modeled relationship between δ and T agrees well with the previous theoretical works. We also observe the specific volume (v), cohesive energy (U(coh)), cohesive energy density (E(CED)) and δ shows a similar temperature dependence characteristics and a drastic change around the T(g). Meanwhile, the applications of δ and its temperature dependence property are addressed and discussed.     

Simulations of the bis-penicillamine enkephalin in sodium chloride solution: a parameter study.

A simulation study of DPDPE in sodium chloride solution has been performed and compared with previous simulations using a different interaction potential for the ions. Both global thermodynamics as well as a characterization of association to DPDPE have been calculated. We show that the parameters used for the ions have a profound effect on the association to the peptide in 1M NaCl. The observed differences suggest that individual associations in these and previous simulations are sensitive to parameters.     

Role of salt bridges in homeodomains investigated by structural analyses and molecular dynamics simulations

Homeodomains are a class of helix-turn-helix DNA-binding protein motifs that play an important role in the control of cellular development in eukaryotes. They fold in a three alpha-helix structural module, where the third helix is the recognition helix that fits into the major groove of DNA. Structural analysis of the members of the homeodomain family led to the identification of interactions likely to stabilize the protein domains. Linking the helices pairwise, three salt bridges were found to be well preserved within the family. Also well conserved were two cation-pi interactions between aromatic and positively charged side chains. To analyze the structural role of the salt bridges, molecular dynamics simulations (MD) were carried out on the wild-type homeodomain from the Drosophila paired protein (1fjl) and on three mutants, which lack one or two salt bridges and mimic natural mutations in other homeodomains. Analysis of the trajectories revealed only small structural rearrangements of the three helices in all MD simulations, thereby suggesting that the salt bridges have no essential stabilizing role at room temperature, but rather might be important for improving thermostability. The latter hypothesis is supported by a good correlation between the melting midpoint temperatures of several homeodomains and the number of salt bridges and cation-pi interactions that connect secondary structures.     

Intermolecular interactions between cholecystokinin-8 and the third extracellular loop of the cholecystokinin-2 receptor

The structure of the third extracellular loop of the human cholecystokinin-2 receptor, CCK2-R(352-379), and its interactions with the C-terminal octapeptide of cholecystokinin (CCK-8) have been determined by high-resolution NMR and computer simulations. In the presence of dodecylphosphocholine micelles, the structure of the receptor fragment consisted of three helices, with the first and third corresponding to residues of the extracellular ends of transmembrane helices (TM) 6 and 7, respectively. The central, extracellular helix, consisting of residues 363-368, was found to be closely associated with the membrane mimetic used during the spectroscopic studies and molecular dynamics (MD) simulations. Upon titration of CCK-8 to the receptor domain, chemical shift perturbation and intermolecular NOEs (Trp30, Met31 of CCK-8 and P371, F374 of CCK2-R) indicated the formation of a stable complex and specific ligand/receptor interactions. Using the NOE-generated intermolecular contact points, extensive MD simulations of CCK-8 bound to the CCK2 receptor were carried out. The results, with CCK-8 in close proximity to TM7, differ from previous structural studies of CCK-8 association with CCK1-R, in which the ligand formed a number of interactions with TM6. These differences may play a role in the ligand specificity displayed by the CCK1 and CCK2 receptor subtypes.     

DNA structure: what's in charge?

DNA structure is well known to be sensitive to hydration and ionic strength. Recent theoretical predictions and experimental observations have raised the idea of the intrusion of monovalent cations into the minor groove spine of hydration in B-form DNA. To investigate this further, extensions and further analysis of molecular dynamics (MD) simulations on d(CGCCGAATTCGCG), d(ATAGGCAAAAAATAGGCAAAAATGG) and d(G(5)-(GA(4)T(4)C)(2)-C(5)), including counterions and water, have been performed. To examine the effective of minor groove ions on structure, we analyzed the MD snapshots from a 15 ns trajectory on d(CGCGAATTCGCG) as two subsets: those exhibiting a minor groove water spine and those with groove-bound ions. The results indicate that Na(+) at the ApT step of the minor groove of d(CGCCGAATTCGCG) makes only small local changes in the DNA structure, and these changes are well within the thermal fluctuations calculated from the MD. To examine the effect of ions on the differential stability of a B-form helix, further analysis was performed on two longer oligonucleotides, which exhibit A-tract-induced axis bending localized around the CpG step in the major groove. Plots of axis bending and proximity of ions to the bending locus were generated as a function of time and revealed a strong linear correlation, supporting the idea that mobile cations play a key role in local helix deformations of DNA and indicating ion proximity just precedes the bending event. To address the issue of "what's in charge?" of DNA structure more generally, the relative free energy of A and B-form d(CGCGAATTCGCG) structures from MD simulations under various environmental circumstances were estimated using the free energy component method. The results indicate that the dominant effects on conformational stability come from the electrostatic free energy, but not exclusively from groove bound ions per se, but from a balance of competing factors in the electrostatic free energy, including phosphate repulsions internal to the DNA, the electrostatic component of hydration (i.e. solvent polarization), and electrostatic effects of the counterion atmosphere. In summary, free energy calculations indicate that the electrostatic component is dominant, MD shows temporal proximity of mobile counterions to be correlated with A-track-induced bending, and thus the mobile ion component of electrostatics is a significant contributor. However, the MD structure of the dodecamer d(CGCGAATTCGCG) is not highly sensitive to whether there is a sodium ion in the minor groove.     

Structural dynamics of neuropeptide hPYY

We have employed a combination of experiment and simulation to characterize the ensemble of structures sampled by human Peptide YY (hPYY), an important member of the neuropeptide Y family. Experimental structural characterization carried out with far UV circular dichroism spectroscopy and Fourier Transform-Infrared measurements confirmed that the major feature of the secondary structure of hPYY is the α-helix, encompassing about half the peptide residues, with smaller contributions from turn and β-sheet like structures. The peptide undergoes thermal denaturation characterized by a melting temperature of 48°C with an enthalpy change of -24.5 kcal/mol and entropy change of -76.2 cal/(mol K). In our computational studies, based on a 4-μsec MD trajectory generated with the AMBER03 potential, we found excellent agreement of the predicted features with experimental data, including a stable C-terminal helix, a central turn and conservation of about 80% of measured long-range NOE contacts. The main structural fluctuations involved partial helix unwinding and large-scale motions of the N-terminal. Our joint experimental/computational approach leads to several insights into the biological function of PYY. We conclude that the C-terminal helix is crucial for the structural integrity of PYY. The structures and motions found in the simulations suggest microscopic explanations for observed changes in biological activity of the peptide upon mutation and truncation. We also performed microsecond-length MD and replica-exchange simulations of hPYY with the OPLS-AA force field, for which computed structures did not agree well with experimental data, predicting significant loss of helicity and NOE contacts.     

Molecular dynamics simulation of the stability of a 22-residue α-helix in water and 30% trifluoroethanol

A molecular dynamics (MD) simulation was performed on the α-helix H8-HC5, the C-terminal part of myoglobin (residue 132–153), under periodic boundary conditions in two different solutions, water and water with 30% (v/v) 2,2,2-trifluoroethanol (TFE), at 300 K to investigate the stability of the helix. In both simulations, the initial configuration was a canonical right-handed α-helix. In the course of the MD trajectory in water (200 ps), the helix clearly destabilized and began to unfold after 100 ps. In the TFE solution, two stable parts of helical regions were observed after 70 ps of a 200-ps MD simulation, supporting the notion that TFE acts as a structure-forming solvent. © 1993 John Wiley & Sons, Inc.     

Molecular dynamics simulations of human prion protein: importance of correct treatment of electrostatic interactions.

Molecular dynamics simulations have been used to investigate the dynamical and structural behavior of a homology model of human prion protein HuPrP(90-230) generated from the NMR structure of the Syrian hamster prion protein ShPrP(90-231) and of ShPrP(<90-231) itself. These PrPs have a large number of charged residues on the protein surface. At the simulation pH 7, HuPrP(90-230) has a net charge of -1 eu from 15 positively and 14 negatively charged residues. Simulations for both PrPs, using the AMBER94 force field in a periodic box model with explicit water molecules, showed high sensitivity to the correct treatment of the electrostatic interactions. Highly unstable behavior of the structured region of the PrPs (127-230) was found using the truncation method, and stable trajectories could be achieved only by including all the long-range electrostatic interactions using the particle mesh Ewald (PME) method. The instability using the truncation method could not be reduced by adding sodium and chloride ions nor by replacing some of the sodium ions with calcium ions. The PME simulations showed, in accordance with NMR experiments with ShPrP and mouse PrP, a flexibly disordered N-terminal part, PrP(90-126), and a structured C-terminal part, PrP(127-230), which includes three alpha-helices and a short antiparallel beta-strand. The simulations showed some tendency for the highly conserved hydrophobic segment PrP(112-131) to adopt an alpha-helical conformation and for helix C to split at residues 212-213, a known disease-associated mutation site (Q212P). Three highly occupied salt bridges could be identified (E146/D144<-->R208, R164<-->D178, and R156<-->E196) which appear to be important for the stability of PrP by linking the stable main structured core (helices B and C) with the more flexible structured part (helix A and strands A and B). Two of these salt bridges involve disease-associated mutations (R208H and D178N). Decreased PrP stability shown by protein unfolding experiments on mutants of these residues and guanidinium chloride or temperature-induced unfolding studies indicating reduced stability at low pH are consistent with stabilization by salt bridges. The fact that electrostatic interactions, in general, and salt bridges, in particular, appear to play an important role in PrP stability has implications for PrP structure and stability at different pHs it may encounter physiologically during normal or abnormal recycling from the pH neutral membrane surface into endosomes or lysomes (acidic pHs) or in NMR experiments (5.2 for ShPrP and 4.5 for mouse PrP).     

Glycosaminoglycan conformation: do aqueous molecular dynamics simulations agree with x-ray fiber diffraction?

Glycosaminoglycan-protein interactions are biologically important and require an appreciation of glycan molecular shape in solution, which is presently unavailable. In previous studies we found strong similarity between aqueous molecular dynamics (MD) simulations and published x-ray diffraction refinements of hyaluronan. We have applied a similar approach here to chondroitin and dermatan, attempting to clarify some of the issues raised by the x-ray diffraction literature relating to chondroitin and dermatan sulfate. We predict that chondroitin has the same beta(1-->4) linkage conformation as hyaluronan, and that their average beta(1-->3) conformations differ. This is explained by changes in hydrogen-bonding across this linkage, resulting from its axial hydroxyl, causing a different sampling of left-handed helices in chondroitin (2.5- to 3.5-fold) as compared with hyaluronan (3.0- to 4.0-fold). Few right-handed helices, which lack intramolecular hydrogen-bonds, were sampled during our MD simulations. Thus, we propose that the 8-fold helix observed in chondroitin-6-sulfate, represented in the literature as an 8(3) helix (right-handed), though it has never been refined, is more likely to be 8(5) (left-handed) helix. Molecular dynamics simulations implied that (4)C(1) and (2)S(O), but not (1)C(4), forms of iduronate could be used in refinements of dermatan x-ray fiber diffraction patterns. Current models of 8-fold dermatan sulfate chains containing (4)C(1) iduronate refine to right-handed helices, which possess no intramolecular hydrogen-bonds. However, MD simulations predict that models containing (2)S(O) iduronate could provide better (8(5) helix) starting structures for refinement. Thus, the 8-fold dermatan sulfate refinement (8(3) helix) could be in error.     

Structural basis for the interaction of the beta-secretase with copper

The β-secretase (BACE1) features a unique sulfur rich motif (M₄₆₂xxxC₄₆₆xxxM₄₇₀xxxC₄₇₄xxxC₄₇₈) in its transmembrane helix (BACE1-TM) which is characteristic for proteins involved in copper ion storage and transport. While this motif has been shown to promote BACE1-TM trimerization and binding of copper ions in vitro, the structural basis for the interaction of copper ions with the BACE1-TM is still not well understood. Using molecular dynamics (MD) simulations, we show that membrane embedded BACE1-TMs adopt a flexible trimeric structure that binds and conducts copper ions through variable coordination. In coarse-grained (CG) MD simulations, the spontaneous assembly of BACE1-TMs trimers results in a right-handed helix packing arrangement. In subsequent atomistic MD simulations the sulfur rich motif defines characteristic copper ion coordination sites along a constricted partially solvated axial pore. Sliding and tilting of BACE1-TMs along smooth A₄₅₉xxxA_463/464xxA₄₆₇ surfaces, facilitated by a central P472 induced kink, enables copper ions to alternate between different coordination sites, including the prominent C466 and M470. We shed light into the structural arrangement of BACE1-TM trimers and propose a mechanism for copper ion conduction that might also apply to other proteins involved in metal ion transport.